The human embryonic pluripotent stem cell line (hESC) AND-2, which was obtained from the Biobanco de células madre de Granada (ISCIII, Spain), was used for this study. The study was approved by the ISCIII Ethics Committee (Ref. CEI-PI-93_2020 and CEI-PI-76_2023) and then authorized by the Spanish National Committee of Guarantees for the Use and Derivation of Human Cells and Tissues.

The AND-2 cell line was grown on mouse embryonic fibroblasts (MEFs) treated and inactivated overnight with Mitomycin C (1 μg/ml, Sigma, M0503). The culture was maintained in an hESC proliferation medium. This medium consists of knockOut DMEM (Gibco, 10829-018) supplemented with serum replacement (20%, Gibco, 10829-028), L-glutamine (2 mM, Lonza, BE17-605E), non-essential amino acids (1X, Gibco, 11140-050), penicillin/streptomycin (50 U/ml, Lonza, DE17-602E), 2-mercaptoethanol (50 μM, Gibco, M6250), fibroblast growth factor 2 (FGF2) (10 ng/ml, PeproTech, AF-100-18B), and ROCK Inhibitor Y-27632 (5 μM, Tocris, 129830-38-2). This medium was changed with a fresh medium every day, and the culture was maintained at 37°C at 5% CO₂.

To obtain human cerebral organoids, we relied on the protocol previously described by González-Sastre et al. (2024).

After obtaining an optimal density of AND-2 colonies, the hESC proliferation medium was changed to a neural induction medium. The neural induction medium consists of N2 [DMEM: F12 with GlutaMax (Gibco, 31331-028) with D-glucose (6 mg/ml, Merck, 104074), N2 supplement (1X, Gibco, 17502-048), AlbuMAX (2.6 mg/ml, Gibco, 11020-021), penicillin/streptomycin (50 U/ml, Lonza, DE17-602E), HEPES (5 mM, Gibco, 15630-056), non-essential amino acids (1X, Gibco, 11140-050)], Neurobasal without vitamin A [Neurobasal (Gibco 21103-049) with B27 supplement without vitamin A (1X, Gibco, 12587-010), L-glutamine (2 mM, Lonza, BE17-605E)] at a ratio of 1:1 supplemented with L-ascorbic acid (0.1 mM, Sigma, A4544), SB-431542 (10 μM, Tocris, 301836-41-9), Noggin (50 ng/ml, PeproTech, 120-10C), and CHIR99021 (3 μM, Tocris, 252917-06-9).

After 5–7 days, the colonies began to enlarge, and three-dimensional (3D) structures began to detach, which were transferred to a new multiwell plate pretreated with an anti-adherent solution (StemCell Technologies, 7010).

Subsequently, 5–7 days after the formation of the 3D structures, the neural induction medium was replaced by a neural differentiation medium. This medium consists of N2 and Neurobasal without vitamin A in a 1:1 ratio supplemented with 1.3 μg/ml of insulin (Gibco, 12585-014).

After another 5–7 days with a neural differentiation medium, it was replaced by a maintenance medium. This medium consists of N2 and Neurobasal with vitamin A [Neurobasal with B27 supplement with vitamin A (1X, Gibco, 17504-044) and 2mM L-glutamine] in a 1:1 ratio supplemented with 1.3 μg/ml of insulin.

During the whole process, the medium corresponding to each phase was replaced by a fresh medium every day. They were incubated at 37°C with 5% CO₂.

Once the organoids reached the desired maturity, after 45 days of culturing, they were fixed using Paraformaldehyde (PFA, 4%, Sigma, P6148) and embedded in gelatin (7.5%, Merck, 104070) and sucrose (15%, Merck, 107654). Sections of 15 μm were made using a cryostat (Leica).

These sections were blocked and permeabilized (1 h at room temperature (RT) in a blocking solution [Triton X-100 (0.3%, BioRad, 161-0407), normal horse serum (5%, NHS; Gibco, 2493028), and bovine serum albumin (BSA) (0.1%, Sigma, A7906) in PBS)] for immunohistochemical analysis. Sections were incubated with primary antibodies diluted in the blocking solution overnight at 4°C: rabbit anti-Ki67 [1:250] (Thermo Scientific, MA5-14520), mouse anti-Vimentin [1:500] (Santa Cruz, SC-6260), rabbit anti-Sox2 [1:1000] (Millipore, AB5603), mouse anti-ZO1 [1:200] (Invitrogen, 33-9100), mouse anti-βIIITubulin [1:500] (Biolegend, 801202), goat anti-DCX [1:100] (Santa Cruz, SC-8066), mouse anti-MAP2 [1:200] (Sigma, M4403), rabbit anti-SYN1 [1:200] (Millipore, AB1543), rabbit anti-S100β [1:100] (Abcam, ab52642), rabbit anti-GFAP [1:800] (Dako, Z0334), mouse anti-CNPase [1:150] (Millipore, MAB326), and rabbit anti-IBA1 [1:400] (Wako, 019-19741).

After the removal and washing (0.25% Triton X-100 in PBS) of the primary antibody, the sectioned organoids were incubated with the corresponding secondary antibody (for 1 h at RT): donkey anti-rabbit Alexa Fluor 448 [1:500] (Invitrogen, A21206), donkey anti-mouse Alexa Fluor 555 [1:400] (Invitrogen, A31570), donkey anti-goat Alexa Fluor 555 [1:400] (Invitrogen, A21432), and donkey anti-rabbit Alexa Fluor 555 [1:400] (Invitrogen, A31572). Finally, the nuclei were stained with Höechst 33258 (Thermo Fisher) diluted in PBS (1:500) (for 5 min at RT).

A Leica DMi8 fluorescence microscope was used for section analysis and photography. Photographs were taken at 10 × or 20 × magnification. All images were obtained with Leica LAS X V4.0 software.

The RNeasy Mini extraction kit (Qiagen, 74104) was used, as indicated in the instructions, to obtain RNA from hCOs. The hCOs were treated with DNAses to avoid the amplification of non-specific genomic DNA. The reverse transcription of 1 μg of total RNA (10 min at 25°C, 60 min at 50°C, and 10 min at 75°C) was performed in a 20-μl reagent mix using SuperScriptIII-RT (Invitogen, 56575). Relative cDNA levels were quantified by RT-qPCR (PowerUp SYBR-green system, Applied Biosystems, A25742) in a 15-μl reaction, with 10 μM of primers and 10 ng of cDNA. This quantification was performed at different stages: on organoids at the induction stage (5 days), at the differentiation stage (14 days), and during maintenance (45 days).

The human genes used were as follows: MKI67 (F: TGACCCTGATGAGAAAGCTCAA; R: CCCTGAGCAACACT GTCTTTT), VIM (F: TACAGGAAGCTGCTGGAAGG; R: ACCAGAGGGAG-TGAATCCAG), SOX2 (F: GGGGGAA TGGACCTTGTATAG; R: GCAAAGCTCCTACCGTACCA), SYN1 (F: GACGGAAGGGATCACATCAT; R: CTGGTGG TCACCAATGAGC), DCX (F: GGATCCAGGAAGATCGGAAG; R: TTGTCTGAGGAACAGACATAGCT), MAP2 (F: ATCTCT TCTTCAGCACGGCG; R: CAGGGGTAGTGGGTGTTGAG), TUBB3 (F: GCAACTACGTGGGCGACT; R: ATGGCTCGA GGCACGTACT), S100B (F: GGAAGGGGTGAGACAAGGA; R: GGTGGAAAACGTCGATGAG), GFAP (F: GTTCTT GAGGAA-GATCCACGA; R: CTTGGCCACGTCAAGCTC), AIF1 (F: TTAATGGAAATGGCGATATTGA; R: TTCTTTAGCTCTAGG TGAGTCTTGG), PLP1 (F: GGCTAGGACATCCCGACAAGTT; R: ACAGCAGAGCAGGCAAACAC), PDGFRA (F: TACACTT GCTATTACAACCACA; R: ATCCTCCACGATGACTAAAT), and housekeeping gene TBP (F: GAGCTGTGATGTGAAGTTTCC; R: TCTGGGTTTGATCATTCTGTAG).

RT-qPCR from Applied Biosystems QuantStudio 3 was used to determine the levels of target mRNA in each sample, normalizing the relative expression levels against the TBP levels of each sample. The relative gene levels were estimated by relative quantification using the 2^−ΔΔCt method.

Statistical analyses were performed using GraphPad Prism 9. The results are shown as mean ± SD for three experiments (n = 3). Data were compared by a multiple comparison ANOVA. The p < 0.05 were considered to be statistically significant (^*p < 0.05; ^**p < 0.01; ^***p < 0.001; ^****p < 0.0001).

Once the organoids were cultured for ~45 days, they were collected in a sodium phosphate buffer (0.1M, 7.4 pH) and fixed in the same buffer with 2% glutaraldehyde and 4% PFA for 2 h at room temperature (RT).

The hCOs were washed with sodium phosphate buffer three times. Post-fixation was done in the following order: 1% osmium tetroxide and 1% potassium ferricyanide (for 1 h at 4°C), 0.15% tannic acid (for 1 min at RT), and 2% uranyl acetate (for 1 h at RT in the dark).

Samples were dehydrated (10 min, 4°C) in ethanol with increasing concentrations (50%, 75%, 90%, 95%) and, finally, 100% ethanol (three times, 12 min, 4°C) and infiltrated with increasing concentrations of epoxy-resin (50%, 75%, 100%) before polymerization at 60°C for 48 h.

Ultrathin sections of 70 nm were cut using a Leica EM UC6 ultramicrotome. Images were obtained using a Talos F200CG2 transmission electron microscope equipped with a BM-CETA camera. Images were analyzed using MAPS 3.23 software.

The hCOs were collected with the aid of a pipette and treated for 15 min in Hank's Balanced Salt Solution (HBSS; 1X, Gibco, #14180046). After centrifugation, the dissociation was performed with trypsin for 20 min at 37°C and with DMEM:F12 + 10% FBS in a 1:1 ratio. Counting and viability were assessed using Trypan blue staining. The single-cell library was constructed using the Chromium Single Cell 3′ Library and Gel Bead Kit v3.1 workflow from 10 × Genomics at the Genomics Unit of the Instituto de Salud Carlos III, and it was sequenced using the Novaseq 6000Dx sequencer (Illumina). After using CellRanger Count (version 6.1.2. 10X Genomics), data analysis was performed using the Seurat (v4.0). Data visualization was carried out using the Uniform Manifold Approximation and Projection (UMAP), and the marker-based cell and cluster assignment were performed according to González-Sastre et al.'s (2024) protocol. Transcriptomic scRNAseq data can be retrieved using Gene Expression Omnibus (GEO) series accession number GSE266667 in NCBI.

We used the R packages Harmony within our Seurat workflow to perform the integration of the scRNAseq data and MAST to achieve the differential gene expression analysis. The summarized gene ontology terms were obtained from Enrichr (https://maayanlab.cloud/Enrichr/) and ReviGO (http://revigo.irb.hr/).

To obtain hCOs from hPSCs, we used the recently described protocol from our group (González-Sastre et al., 2024), which allows the generation of hCOs directly from the adherent cultures of pluripotent stem cells (PSCs) avoiding embryoid body formation in the detachment and aggregation stages. The different phases of proliferation, neural induction, differentiation, and maturation with the corresponding timelines and representative bright-field images of the stages are shown in Figure 1A.

The cellular and molecular characterization of the generated hCOs was performed after culturing for 45 days using immunohistochemistry and RT-qPCR for several markers. As can be observed in Figure 1B, hCOs presented an abundant number of proliferative zones (white dashed lines), with high immunoreactivity for Ki67 (a cell proliferation marker), Sox2 (a marker of neural precursor cells), ZO1 (Zonula Occludens-1, a marker of tight junction proteins) (Aaku-Saraste et al., 1996), and Vimentin (an intermediate filament protein found in many types of immature cells throughout the central nervous system (CNS), including radial glial cells (RGCs) and immature astrocytes) (Hohmann and Dehghani, 2019).

The gene expressions of SOX2 and MKI67 were higher at the differentiation stage but decreased at the maturation stage, as hCOs differentiate and maturate (Figure 1C). Nevertheless, VIM expression remains constant, as would be expected given that it is present in a variety of cell types at different stages of differentiation.

To further characterize the hCOs morphologically, we used transmission electron microscopy (TEM) to observe a representative image of a proliferative zone with a central cavity containing cell debris and intact cells, as shown in Figure 1D, in parallel cultures of 45 days. This cavity is surrounded by radially oriented cells that are connected to each other by tight junctions in the apical region, sometimes with a clathrin-coated pit near them, and by adherent junctions in the distal region (Figures 1E, H). These cells contain rough endoplasmic reticulum and abundant lipid vesicles (Figure 1E). In addition, in some of these cells, a centriole and a primary cilium composed of microtubules could be observed (Figures 1F–H).

These proliferative zones are of significant importance for the correct development and differentiation of neurons, astrocytes, and oligodendrocytes (Conti and Cattaneo, 2010). It has been previously observed in several protocols of hCOs how the aforementioned cell types are generated, differentiated, and migrated radially outward from these proliferative zones, which are composed of neural precursor cells (Lancaster and Knoblich, 2014; Pașca et al., 2015). In addition, neurodevelopmental changes have been observed when these regions are altered (Camblor-Perujo and Konon-enko, 2022; Bear and Caspary, 2024).

To verify the existence of differentiated and mature neurons in hCOs, we analyzed the expression of several neuronal markers. Doublecortin (DCX), a microtubule-stabilizing protein essential for neuronal migration during human brain development, is a marker of migrating neuroblasts. βIIITubulin (BIIITub), a microtubule element of the tubulin family found almost exclusively in neurons, is a marker of differentiated neurons. Microtubule-Associated Protein 2 (MAP2), the predominant cytoskeletal regulator within neuronal dendrites, is a marker of mature neurons. Synapsin-1 (SYN1), a protein present in pre-synaptic terminals, is a marker of synapsis.

As shown in Figure 2A, abundant immunoreactivity for DCX, BIIITub, MAP2, and SYN1 was observed in hCOs. These results were confirmed at the gene expression level using RT-qPCR, where a significant increase in the expression of all these genes was obtained at the maturation stage of hCOs (Figure 2B). All these data suggest the presence of migrating immature and mature neurons in the hCOs.

The TEM image of a representative proliferative zone (Figure 2C) shows the migration of radial-glia-like cells from the apical region and the differentiation into neuron-like cells in the distal region. The morphology of a representative neuron is presented in Figure 2D. Neurons exhibit a large nucleus, with indentations, a narrow ring of high electron density of heterochromatin, and one electron-dense round nucleolus. In addition, abundant organelles can be observed such as the extensive Golgi complex and mitochondria (Figures 2D, G, H). Interestingly, neurites (the neuron prolongations) contain an extensive array of microtubules that can be observed in transversally sectioned neurites (Figure 2E) or longitudinally sectioned neurites (Figure 2F), together with mitochondria.

Apart from neurons, other cell types (astrocytes and oligodendrocytes) develop from the proliferative zones at the later stages of neurogenesis (Arellano et al., 2021). As in other hCO generation protocols, the presence of astrocytes has been described (Lancaster et al., 2013; Pașca et al., 2015). Given their importance in brain function (Guillamón-Vivancos et al., 2015), we aimed to study the existence of astrocytes in the hCOs. Therefore, we analyzed the expression of two markers: glial fibrillary acid protein (GFAP), which is an intermediate filament protein expressed primarily by astrocytes, and a Ca²⁺-binding protein (S100β), which is expressed and secreted from astrocytes. Immunoreactivity for both proteins is observed in hCOs, as shown in Figure 3A. The mRNA expression levels for GFAP and S100B have been significantly increasing with time in the culture (Figure 3B).

At the ultrastructural level using TEM, astrocytes appear surrounded by dendrites and neuronal-like cells, which are characterized by an irregular nucleus with a high presence of euchromatin compared with the other cell types, with more electron-translucent areas than its cytoplasm (Figures 3C, D). Astrocytes contain numerous glycogen granules, mitochondria, endoplasmic reticulum, and lysosomes (Figure 3E). In addition, astrocytes are rich in intermediate filaments (IFs) interspersed with some scattered microtubules (Figure 3F).

Other cell types that perform essential functions in the brain are oligodendrocytes and microglia cells. Therefore, we aimed to analyze their presence in hCOs.

To detect the existence of oligodendrocyte precursor cells (OPCs), we used immunolabeling for CNPase, the earliest myelination-specific protein produced by oligodendrocytes (Figure 4A). In addition, as shown in Figure 4B, we observed an increase in the expression of PDGFRA, the gene implicated in the migration of oligodendrocyte precursors, and PLP1, the gene encoding a transmembrane proteolipid protein that is the predominant component of myelin.

At the ultrastructural level, the OPCs have a round, electron-dense nucleus with aggregated heterochromatin (Figure 4C). The cytoplasm contains short cisternae of rough endoplasmic reticulum with numerous short mitochondria and some glycogen granules and IFs (Figure 4D).

On the other hand, the presence of microglial-like cells in hCOs obtained after culturing for 45 days was observed by immunostaining with IBA1 (ionized Ca⁺²-binding adapter protein 1), an actin-interacting protein in microglia (Figure 4A). The expression of the gene encoded for IBA1, that is, the Allograft Inflammatory Factor 1 (AIF1), was significantly increased in the maturation stage (Figure 4B).

The ultrastructure of a typical microglial cell is shown in Figure 4E, which is composed of a large nucleus surrounded by a thin cytoplasm. The nucleus presents a dense heterochromatin lining the nuclear membrane, contrasting with a narrow rim of perinuclear cytoplasm containing a few organelles.

The progression of cell identities and possible functional changes that arise during the maturation stage of the hCOs was studied by the comparison of the transcriptional profile after culturing for 45 and 60 days [this scRNAseq data were published in a study by González-Sastre et al. (2024); GEO accession number GSE242329]. Supplementary Figures S1A–C show that, during organoid maturation, there is an increase in the proportions of cells in the hCO clusters corresponding to outer radial glia (oRG), excitatory neurons (NE), inhibitory neurons (IN), and oligodendrocyte precursor cells (OPCs), with a decrease in the proportions of cells in the clusters of apical radial glia (aRG) and intermediate precursor cells (IPCs). Supplementary Figure S1D shows that the expression of Cajal-Retzius, choroid plexus, dorsal anterior encephalon, hippocampus, and mid and posterior encephalon marker genes increases with an increase in the number of days in culture. Supplementary Figure S1E and Supplementary Table S1 show selected representative biological process GO terms enriched in the upregulated and downregulated differentially expressed genes (DEGs) identified during the comparison of hCOs after culturing for 60 days vs. after culturing for 45 days for the EN cluster.