<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Neurosci.</journal-id>
<journal-title>Frontiers in Cellular Neuroscience</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Neurosci.</abbrev-journal-title>
<issn pub-type="epub">1662-5102</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fncel.2022.892757</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Neuroscience</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Methamphetamine Exposure in Adolescent Impairs Memory of Mice in Adulthood Accompanied by Changes in Neuroplasticity in the Dorsal Hippocampus</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Liang</surname> <given-names> Min</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1434377/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Zhu</surname> <given-names>Li</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1434364/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wang</surname> <given-names>Rui</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1434393/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Su</surname> <given-names>Hang</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/1714229/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Ma</surname> <given-names>Dongliang</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/217214/overview"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Wang</surname> <given-names>Hongyan</given-names></name>
<xref ref-type="aff" rid="aff3"><sup>3</sup></xref>
<xref ref-type="aff" rid="aff4"><sup>4</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/335282/overview"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Chen</surname> <given-names>Teng</given-names></name>
<xref ref-type="aff" rid="aff1"><sup>1</sup></xref>
<xref ref-type="aff" rid="aff2"><sup>2</sup></xref>
<xref ref-type="corresp" rid="c001"><sup>&#x002A;</sup></xref>
<uri xlink:href="http://loop.frontiersin.org/people/397653/overview"/>
</contrib>
</contrib-group>
<aff id="aff1"><sup>1</sup><institution>College of Forensic Medicine, Xi&#x2019;an Jiaotong University Health Science Center</institution>, <addr-line>Xi&#x2019;an</addr-line>, <country>China</country></aff>
<aff id="aff2"><sup>2</sup><institution>The Key Laboratory of Health Ministry for Forensic Science, Xi&#x2019;an Jiaotong University</institution>, <addr-line>Xi&#x2019;an</addr-line>, <country>China</country></aff>
<aff id="aff3"><sup>3</sup><institution>Programme in Neuroscience and Behavioral Disorders, Duke-NUS Medical School</institution>, <addr-line>Singapore</addr-line>, <country>Singapore</country></aff>
<aff id="aff4"><sup>4</sup><institution>Department of Physiology, Yong Loo Lin School of Medicine, National University of Singapore</institution>, <addr-line>Singapore</addr-line>, <country>Singapore</country></aff>
<author-notes>
<fn fn-type="edited-by"><p>Edited by: Qiu Pingming, Southern Medical University, China</p></fn>
<fn fn-type="edited-by"><p>Reviewed by: Bing Xie, Hebei Medical University, China; Xiaofeng Zeng, Kunming Medical University, China</p></fn>
<corresp id="c001">&#x002A;Correspondence: Teng Chen, <email>chenteng@xjtu.edu.cn</email></corresp>
<fn fn-type="other" id="fn004"><p>This article was submitted to Cellular Neuropathology, a section of the journal Frontiers in Cellular Neuroscience</p></fn>
</author-notes>
<pub-date pub-type="epub">
<day>17</day>
<month>05</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>16</volume>
<elocation-id>892757</elocation-id>
<history>
<date date-type="received">
<day>09</day>
<month>03</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>13</day>
<month>04</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#x00A9; 2022 Liang, Zhu, Wang, Su, Ma, Wang and Chen.</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Liang, Zhu, Wang, Su, Ma, Wang and Chen</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p></license>
</permissions>
<abstract>
<p>Methamphetamine (METH) has been shown to alter learning and memory by affecting the neuroplasticity of the dorsal hippocampus, a key structure that undergoes extensive remodeling during adolescence. In this study, we investigated whether mid-to-late adolescent exposure to METH leads to long-lasting memory impairment. To do this, adolescents (35&#x2013;48 postnatal days) were exposed to different doses of METH for 14 days and then evaluated by the Morris water maze (MWM), new object recognition test (NORT), and the Y-maze, to investigate the learning and memory abilities of mice in their adolescence and adulthood, respectively. We also detected the mRNA levels of genes associated with neuroplasticity in the dorsal hippocampus. The synaptic ultrastructure and the number of neurons and astrocytes in the dorsal hippocampus were also determined by transmission electron microscopy (TEM) and immunofluorescence (IF). Exposure to METH in mid-to-late adolescence impaired spatial memory retrieval ability and the long-term recognition memory of mice in their adulthood, but not in their adolescence. Of note, the impairment of memory capacity in adulthood was accompanied by molecular and structural changes in synapses in the dorsal hippocampus. Our results indicate that mice exposed to METH in mid-to-late adolescence have impaired memory ability in their adulthood; this may be the result of abnormal changes in the structural plasticity of the dorsal hippocampus; the causal relationship between changes in synaptic structural plasticity and memory impairment needs to be further confirmed. In summary, our study provides evidence for the detrimental consequences of adolescent addiction and the prevention of adolescent drug abuse.</p>
</abstract>
<kwd-group>
<kwd>methamphetamine</kwd>
<kwd>adolescent</kwd>
<kwd>hippocampus</kwd>
<kwd>memory</kwd>
<kwd>neuroplasticity</kwd>
</kwd-group>
<contract-num rid="cn001">81772034</contract-num>
<contract-num rid="cn001">82171879</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content></contract-sponsor>
<counts>
<fig-count count="5"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="58"/>
<page-count count="13"/>
<word-count count="9048"/>
</counts>
</article-meta>
</front>
<body>
<sec id="S1" sec-type="intro">
<title>Introduction</title>
<p>Methamphetamine (METH) is a widely abused psychostimulant with strong neurotoxicity and obvious mental symptoms (<xref ref-type="bibr" rid="B26">Liu et al., 2021</xref>). Unfortunately, most METH abusers begin their exposure as teenagers. According to the recent data, half of all first-time drug abusers in China were adolescents and young people under the age of 25 years (<xref ref-type="bibr" rid="B58">Zhuang and Chen, 2016</xref>); this compares to a mean age of 18.9 years in the United States (<xref ref-type="bibr" rid="B28">Luikinga et al., 2018</xref>). The dominant feature of the adolescent brain is that synapses undergo extensive strengthening and elimination (<xref ref-type="bibr" rid="B56">Zeid et al., 2018</xref>). Furthermore, the adolescent brain is highly sensitive to stimuli from the internal and external environments (<xref ref-type="bibr" rid="B47">Smiley et al., 2021</xref>). Unbalanced development of the dopaminergic and GABAergic systems during adolescence has been shown to lead to an increased risk of motivation and decision-making among adolescents which may increase the use of psychoactive substances (<xref ref-type="bibr" rid="B29">Luna et al., 2015</xref>). This leads to abnormal structural changes in the brains of users with a history of adolescent abuse, making them more prone to substance abuse, emotional changes, and cognitive impairment in adulthood than normal adults (<xref ref-type="bibr" rid="B25">Levine et al., 2017</xref>; <xref ref-type="bibr" rid="B12">D&#x2019;Amico et al., 2021</xref>). The rate of substance abuse in mid-to-late adolescence is significantly higher in adolescents who abuse drugs than those in early adolescence (<xref ref-type="bibr" rid="B31">Marmorstein et al., 2010</xref>; <xref ref-type="bibr" rid="B33">McCabe et al., 2019</xref>); this may be the result of an increase in the risk factors related to social context (<xref ref-type="bibr" rid="B48">Staff et al., 2010</xref>; <xref ref-type="bibr" rid="B12">D&#x2019;Amico et al., 2021</xref>). However, most studies on adolescent METH exposure have focused on early adolescence (<xref ref-type="bibr" rid="B23">Joca et al., 2014</xref>; <xref ref-type="bibr" rid="B6">Buck et al., 2017</xref>). Therefore, in this study, we aimed to determine the effects of long-term exposure to METH during mid-to-late adolescence on learning and memory.</p>
<p>The long-term abuse of METH may ultimately affect learning and memory by altering the neuroplasticity of related brain regions such as the dorsal hippocampus. Studies have shown that the administration of METH can reduce the expression of synaptic molecules in the hippocampus, such as <italic>Arc</italic>, <italic>c-fos</italic>, and <italic>Bdnf</italic>, which are immediate early genes and can prompt rapid and transient synaptic activation responses while initiating signaling cascades to modulate neuronal plasticity (<xref ref-type="bibr" rid="B37">Minatohara et al., 2015</xref>; <xref ref-type="bibr" rid="B20">Hogan et al., 2020</xref>). Meanwhile, METH exposure can damage neurons and lead to a decline in the learning and memory abilities of adult mice (<xref ref-type="bibr" rid="B45">Ru et al., 2021</xref>; <xref ref-type="bibr" rid="B51">Veschsanit et al., 2021</xref>). In addition, METH increases glutamate levels in dorsal hippocampus synapses by reducing glutamate clearance in astrocytes and reduces postsynaptic neuronal activity, ultimately impairing spatial memory in adult mice (<xref ref-type="bibr" rid="B44">Robin et al., 2018</xref>; <xref ref-type="bibr" rid="B21">Hosseini et al., 2020</xref>). Moreover, changes in the ratio of gray to white matter in the brains of METH users in population studies have been associated with cognitive impairment (<xref ref-type="bibr" rid="B30">Lyoo et al., 2015</xref>). Collectively, these studies indicate that changes in neuroplasticity may be the main neural basis for the effects of drug exposure on learning and memory. However, whether exposure to METH in mid-to-late adolescence impairs learning and memory abilities in adulthood by affecting the neuroplasticity of the dorsal hippocampus remains unclear.</p>
<p>In this study, we investigated the effects of long-term exposure to METH during mid-to-late adolescence on learning and memory and determined the changes in neuroplasticity in the dorsal hippocampus. To do this, adolescent mice were exposed to METH for 14 days. We then investigated the effects of METH exposure on learning and memory during adolescence and adulthood by performing the Morris water maze (MWM), new object recognition test (NORT), and the Y-maze test (<xref ref-type="bibr" rid="B3">Antunes and Biala, 2012</xref>; <xref ref-type="bibr" rid="B8">Cao et al., 2018</xref>; <xref ref-type="bibr" rid="B55">Yan et al., 2019</xref>). The expression of plasticity-related molecules (<italic>Arc</italic>, <italic>c-fos</italic>, and <italic>Bdnf</italic>) in dorsal hippocampus was detected by real-time quantitative polymerase chain reaction (RT-qPCR). Furthermore, transmission electron microscopy (TEM) and immunofluorescence (IF) were used to identify the changes in synaptic plasticity, including synaptic ultrastructure and the number of neurons and astrocytes in different subregions of the dorsal hippocampus.</p>
</sec>
<sec id="S2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="S2.SS1">
<title>Animals</title>
<p>During our studies, we used 4-week-old adolescent male C57BL/6J mice weighing 15&#x2013;18 g (Beijing Vital River Laboratory Animal Technology, Beijing, China). Mice were randomly divided into groups of four individuals per cage under controlled conditions (12-h light/dark cycle from 7:00 to 19:00, 50 &#x00B1; 10% humidity, and 23 &#x00B1; 2&#x00B0;C temperature control) with food and water <italic>ad libitum</italic>. Mice were accustomed to this experimental environment for 7 days and allowed to adapt prior to each individual experiment. There were 36 mice in the saline (Sal) group and 36 mice in the METH group. Animal procedures were conducted in accordance with the United Kingdom Animals (Scientific Procedures) Act and Institutional Animal Care Committee at Xi&#x2019;an Jiaotong University.</p>
</sec>
<sec id="S2.SS2">
<title>Drugs</title>
<p>Methamphetamine hydrochloride (National Institute for the Control of Pharmaceutical and Biological Products, Beijing, China) was dissolved in 0.9% physiological saline to a concentration of 0.2 mg/ml and injected intraperitoneally at a volume of 10 ml/kg (i.p.). All mice were consecutively exposed to corresponding concentrations of METH (1, 2 mg/kg) or saline one time a day from 9:00 a.m. to 11:00 a.m. for 14 days after adaptation (35&#x2013;48 postnatal days). The rationale for the dosing regimen was based on a previous study that demonstrated that the treatment of mice with METH for 14 days led to a clear impairment in recognition memory (<xref ref-type="bibr" rid="B39">North et al., 2013</xref>).</p>
</sec>
<sec id="S2.SS3">
<title>Morris Water Maze</title>
<p>The Morris Water Maze (MWM) protocol was based on a previous study with some modifications (<xref ref-type="bibr" rid="B8">Cao et al., 2018</xref>). In brief, the surface of the water was artificially divided into four quadrants, each with an entry point. Signs of the same size and color, but in different shapes, were pasted in the middle of the water tank wall in each quadrant. During the spatial learning phase, a plexiglass platform with a diameter of 10 cm was hidden 1&#x2013;1.5 cm below the water surface in the second quadrant; this platform was subsequently removed until the probe test phase. A camera was placed above the tank and was used to automatically track each animal&#x2019;s performance with a video-computerized tracking system (SMART, Panlab SL, Barcelona, Spain).</p>
<p>The MWM was performed during adolescence or adulthood; there were eight mice in the METH group or Sal group in different periods (adolescence, adulthood) and at different doses (1, 2 mg/kg), respectively. The experiment was divided into a spatial learning phase (four trials a day for 4 or 5 days) and a probe test phase (24 h after the last trial). During the learning phase, the mice were permitted to acclimatize to the environment for 1 day before the learning phase; they were then placed randomly in the water facing the tank wall at one of four fixed entry points. If the mice climbed onto the platform within 60 s, they were allowed to stay there for 10 s and the latency was recorded; if not, the mice were manually placed on the platform for 15 s and the latency was recorded as 60 s. After each trail, the mice were wiped with a towel and placed in their home cage for at least 10&#x2013;15 min until the next training session. The mean latency and speed in four trails per day were set as the key indices for the learning ability of the mice. During the probe test phase, the mice were placed in water from the point farthest away from the platform and recorded for 60 s without the platform. During this phase, the spatial memory retention ability was represented by the number of platform site crossings, the time in the target quadrant, and the time in the target.</p>
</sec>
<sec id="S2.SS4">
<title>New Object Recognition Test</title>
<p>The procedure used for the New Object Recognition Test (NORT) was described previously (<xref ref-type="bibr" rid="B3">Antunes and Biala, 2012</xref>). The 4-day experiment was carried out in adulthood after exposure to 2 mg/kg of METH during adolescence (<italic>n</italic> = 8). The mice were adapted to the empty box for 10 min a day for the first 2 days of the experiment. During the familiarization phase on day 3, two identical objects were placed at an equal distance from the box, and the mice were allowed to explore freely for 5 min. Each mouse was required to perform three training sessions at 15-min intervals. A short-term memory test (test 1) was performed 3 h after the last training session, in which one object (A) was replaced by another object (B) of the same size but a different shape. The long-term memory test (test 2) was administered 24 h after the last training session and was the same as the short-term memory test, except that object (B) was replaced by another new object (C); the time was recorded for 5 min. We also determined the recognition index (%). The top of the box was recorded by the camera and finally analyzed by software (SMART, Panlab SL, Barcelona, Spain).</p>
</sec>
<sec id="S2.SS5">
<title>Y-Maze Spontaneous Alternation Test</title>
<p>The Y-maze spontaneous alternation test was carried out as described previously (<xref ref-type="bibr" rid="B55">Yan et al., 2019</xref>). The experiment was conducted 1 week after the NORT (<italic>n</italic> = 8). During this experiment, each mouse was placed at the central point and allowed to explore freely for 5 min; we recorded the order in which the animals entered each arm. Alternation was defined as continuous entry into three different arms, such as (A, B, C or C, A, B). Next, we calculated the alternation triplet (%), as follows: Alternation triplet (%) = actual alternative/maximum alternative &#x00D7; 100%. Mice with less than eight total arm entries were excluded. The behavioral indicators for each mouse were recorded by specific software (SMART, Panlab SL, Barcelona, Spain).</p>
</sec>
<sec id="S2.SS6">
<title>Quantitative Real-Time PCR</title>
<p>After the behavioral experiments, the mice were sacrificed (<italic>n</italic> = 6) and their brains were quickly removed. Next, we prepared tissue sections from the dorsal hippocampus (<xref ref-type="bibr" rid="B14">Franklin and Paxinos, 2001</xref>) using a cryostat; these sections were stored at &#x2013;80&#x00B0;C until treatment. Then, total RNA was isolated using an E.Z.N.A. DNA/RNA/Protein Kit (Omega Bio-Tek, Norcross, GA, United States). The concentration and mass of the extracted RNAs were determined by a Nano Drop spectrophotometer (Thermo Scientific, Waltham, MA, United States). Next, 500 ng of total RNA was reverse transcribed-into 10 &#x03BC;l of cDNAs with a PrimeScript&#x2122; RT Master Mix (Takara Biomedical Technology, Beijing, China) at 37&#x00B0;C for 15 min, 85&#x00B0;C for 5 s, and 4&#x00B0;C for 5 min. Then, we determined the relative expression levels of <italic>Arc</italic>, <italic>c-fos</italic>, and <italic>Bdnf</italic> mRNA in dorsal hippocampus of mice. qPCR was performed with SYBR Premix Ex Taq II (Takara Biomedical Technology, Beijing, China) and a Bio-Rad iQ5 detection instrument (Bio-Rad, Hercules, CA, United States) under the following conditions: 95&#x00B0;C for 30 s, followed by 40 cycles of 95&#x00B0;C for 10 s, 60&#x00B0;C for 30 s, and 72&#x00B0;C for 30 s. After the completion of the reaction, specificity was verified by melting curve analysis. The relative mRNA values were normalized to the control values of the <italic>Gapdh</italic> gene and calculated using the 2<sup>&#x2013;&#x25B3;&#x25B3;<italic>Ct</italic></sup> method (<xref ref-type="bibr" rid="B27">Livak and Schmittgen, 2001</xref>). The sequences of the forward (F) and reverse (R) primers are shown in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap position="float" id="T1">
<label>TABLE 1</label>
<caption><p>Primers used for quantitative polymerase chain reaction (qPCR).</p></caption>
<table cellspacing="5" cellpadding="5" frame="hsides" rules="groups">
<thead>
<tr>
<td valign="top" align="left">Gene</td>
<td valign="top" align="center">T<sub><italic>m</italic></sub> (&#x00B0;C)</td>
<td valign="top" align="center">Forward (5&#x2032;&#x2013;3&#x2032;)</td>
<td valign="top" align="center">Reverse (5&#x2032;&#x2013;3&#x2032;)</td>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left"><italic>Gapdh</italic></td>
<td valign="top" align="center">60</td>
<td valign="top" align="center">TGTGTCCGTCGTGGATCTGA</td>
<td valign="top" align="center">TTGCTGTTGAAGTCGCAGGAG</td>
</tr>
<tr>
<td valign="top" align="left"><italic>Arc</italic></td>
<td valign="top" align="center">60</td>
<td valign="top" align="center">GCCAAACCCAATGTGATCCTG</td>
<td valign="top" align="center">CTGCTTGGACACTTCGGTCAAC</td>
</tr>
<tr>
<td valign="top" align="left"><italic>c-fos</italic></td>
<td valign="top" align="center">60</td>
<td valign="top" align="center">CGACTCCTTCTCCAGCAT</td>
<td valign="top" align="center">TCACCGTGGGGATAAAGTTG</td>
</tr>
<tr>
<td valign="top" align="left"><italic>Bdnf</italic></td>
<td valign="top" align="center">60</td>
<td valign="top" align="center">CTGAGCGTGTGTGACAGT<break/>ATTAGC</td>
<td valign="top" align="center">GTAGTTCGGCATTGCGA<break/>GTTCC</td>
</tr>
</tbody>
</table></table-wrap>
</sec>
<sec id="S2.SS7">
<title>Transmission Electron Microscope Analysis</title>
<p>To prepare tissue for Transmission Electron Microscope (TEM), mice (<italic>n</italic> = 3) were exposed to 2 mg/kg of METH and then anesthetized after completing the final behavioral experiment in adulthood. The brain tissue was fixed by left ventricular vascular perfusion; we injected the following in sequence: 0.9% physiological saline, 0.1 M phosphate buffer (PB), and a mixed solution of 4% paraformaldehyde and 0.25% glutaraldehyde (pH 7.4). Then, the brain was removed and the bilateral dorsal hippocampus were extracted and dissected into tissue blocks that were approximately 1 mm<sup>3</sup> in size. These small tissue blocks were then fixed in 0.1 M PB containing 4% paraformaldehyde and 2.5% glutaraldehyde (pH 7.4) at 4&#x00B0;C for at least 2 h. Next, the samples were immersed in 0.1 M PB for more than 30 min, followed by fixation in a fresh 1% solution of osmium tetroxide for 120 min and immersed in 0.1 M PB for 10 min. Next, the tissues were dehydrated in different concentrations of ethanol and then embedded in Epon-Araldite resin. Next, the brain tissue was cut into 1-&#x03BC;m-semi-thin sections, stained with methylene blue, and then cut into 50-nm-ultra-thin sections. A total of three ultra-thin sections of each mouse were randomly selected for photography, and 3&#x2013;5 images of each ultra-thin section were taken for statistical analysis. Images were acquired by an electron microscope (H-7650, Hitachi Limited, Tokyo, Japan), so that we could analyze the number of synapses (magnification 20,000&#x00D7;; 30 photographs) and the synaptic ultrastructure (magnification 40,000&#x00D7;; 38 photographs). For analysis, synapses needed to contain three or more synaptic vesicles in their presynaptic elements and obvious dense layers in the postsynaptic elements (<xref ref-type="bibr" rid="B52">Wang et al., 2020</xref>). Image Pro Plus 6.0 (Media Cybernetics, Rockville, MD, United States) was used to measure the thickness of postsynaptic density (PSD) at the thickest part, the width of the synaptic cleft, the length of the presynaptic active zone, and the total number of synapses. All analyses were performed in a blinded manner.</p>
</sec>
<sec id="S2.SS8">
<title>Immunofluorometric Assay</title>
<p>Mice (<italic>n</italic> = 3) were deeply anesthetized and then fixed by brain perfusion with 0.9% physiological saline and 4% paraformaldehyde <italic>via</italic> the left ventricular vessels. Then, the brain tissue was fixed with 4% paraformaldehyde at room temperature for 4 h and dehydrated with 30% sucrose solution. When completely dehydrated, the tissues were embedded with optimal cutting temperature compound and frozen in liquid nitrogen. Coronal sections (20 &#x03BC;m) at the hippocampal level were prepared using a freezing microtome (Leica CM1850, LEICA, Wetzlar, Germany). Subsequently, sections were blocked with 5% bovine serum albumin at 37&#x00B0;C for 60 min. Subsequently, brain tissue sections were incubated with chicken-anti GFAP (1:200; Abcam Cat# ab134436, <ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/RRID:AB_2818977">RRID:AB_2818977</ext-link>) and rabbit-anti NeuN (1:100; Abcam Cat# ab177487, <ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/RRID:AB_2532109">RRID:AB_2532109</ext-link>) specific primary antibody mixed solution at 4&#x00B0;C for 24&#x2013;48 h. In the following morning, the sections were washed with phosphate buffer saline (PBS) and incubated with goat anti-chicken Alexa fluor 488 (1:500; Abcam Cat# ab150173, <ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/RRID:AB_2827653">RRID:AB_2827653</ext-link>) and goat anti-rabbit coralite594 conjugate (1:500; Proteintech Cat# SA00013-4, <ext-link ext-link-type="uri" xlink:href="https://scicrunch.org/resolver/RRID:AB_2810984">RRID:AB_2810984</ext-link>) for 90 min at room temperature, respectively. Finally, after 5 min of incubation with 4&#x2032;,6-diamidino-2-phenylindole (DAPI), stained sections were examined under a fluorescence microscope (Carl Zeiss, Axio scope A1, Germany); 10&#x2013;15 regions were randomly selected from each group. The positive cell density was determined and the NeuN/GFAP ratio was calculated. All stained sections were analyzed by observers who were unaware of the experimental cohort.</p>
</sec>
<sec id="S2.SS9">
<title>Statistical Analysis</title>
<p>Statistical analyses were performed using SPSS 18.0 (IBM, Armonk, NY, United States) or Prism 8.0 (Blue Prism, London, United Kingdom). Data collection and analysis were not performed blinded to the experimental conditions. The mice were randomly assigned into study groups. All data are presented as the mean &#x00B1; standard error of the mean (SEM). The two-way repeated measures analysis of variance (ANOVA) was used to analyze the latency to platform in the MWM, and a post hoc multiple comparison (Bonferroni test) was used to analyze the differences between different days. Other data were analyzed by the Student&#x2019;s <italic>t</italic>-test according to the homogeneity of variance. <italic>p</italic>-Values &#x003C; 0.05 were considered statistically significant.</p>
</sec>
</sec>
<sec id="S3" sec-type="results">
<title>Results</title>
<sec id="S3.SS1">
<title>Exposure to Methamphetamine During Adolescence Did Not Affect the Learning and Memory Abilities of Mice in Adolescence</title>
<p>To investigate the effect of METH on learning and memory in adolescent mice (49&#x2013;54 postnatal days), we first exposed mice to 1 mg/kg of METH for 14 days (35&#x2013;48 postnatal days). MWM was performed immediately after drug exposure to identify the changes in the learning and memory abilities of mice (<xref ref-type="fig" rid="F1">Figure 1A</xref>). During the spatial learning phase, as the number of training days increased, the latency of the mice to the platform shortened; however, there was no significant difference between the two groups with this respect (<xref ref-type="fig" rid="F1">Figure 1C</xref>, when compared to day 16 of the same group, <italic>p</italic> &#x003C; 0.05). We also tested the swimming speed to exclude potential interference effects; there was no significant difference between the groups (<xref ref-type="fig" rid="F1">Figure 1B</xref>). In addition, probe test 1 showed that there was no significant difference between the groups in terms of platform site crossings (<xref ref-type="fig" rid="F1">Figure 1D</xref>), the time in the target quadrant (<xref ref-type="fig" rid="F1">Figure 1E</xref>), and the time in the target (<xref ref-type="fig" rid="F1">Figure 1F</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption><p>Exposure to Methamphetamine (METH) during adolescence did not impair the memory ability of mice during this period of development. <bold>(A&#x2013;F)</bold> The results of the Morris water maze (MWM) in adolescent mice after exposure to 1 mg/kg of METH. <bold>(A)</bold> Experimental protocol. <bold>(B)</bold> Mean swimming speed in the spatial learning phase. <bold>(C)</bold> Latency to the platform (day: F<sub>(3,42)</sub>=10.505, <italic>p</italic> &#x003C; 0.001; group: F<sub>(1,14)</sub> = 0.062, <italic>p</italic> &#x003E; 0.05; day &#x00D7; group: F<sub>(3,42)</sub> = 0.147, <italic>p</italic> &#x003E; 0.05). &#x002A;<italic>p</italic> &#x003C; 0.05 compared with day 16 in the saline group (Sal). #<italic>P</italic> &#x003C; 0.05 compared with day 16 in the METH group (METH). <bold>(D)</bold> Platform site crossings. <bold>(E)</bold> Time in the target quadrant. <bold>(F)</bold> Time in the target. <bold>(G&#x2013;L)</bold> The results of the MWM in adolescent mice after exposure to 2 mg/kg of METH. <bold>(G)</bold> Experimental protocol. <bold>(H)</bold> Mean swimming speed in the spatial learning phase. <bold>(I)</bold> Latency to the platform [day: F<sub>(4, 56)</sub> = 16.564, <italic>p</italic> &#x003C; 0.001; group: F<sub>(1, 14)</sub> = 3.188, <italic>p</italic> &#x003E; 0.05; day &#x00D7; group: F<sub>(4, 56)</sub> = 0.529, <italic>p</italic> &#x003E; 0.05]. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with day 16 in the Sal group. <sup>#</sup><italic>p</italic> &#x003C; 0.05 compared with day 16 in the METH group. <sup>&#x0026;</sup><italic>p</italic> &#x003C; 0.05 METH group compared with the Sal group. <bold>(J)</bold> Platform site crossings. <bold>(K)</bold> Time in the target quadrant. <bold>(L)</bold> Time in the target. Data are presented as mean &#x00B1; SEM, <italic>n</italic> = 8.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fncel-16-892757-g001.tif"/>
</fig>
<p>Next, we changed the dose of METH. Adolescent mice were exposed to 2 mg/kg of METH for 14 days, and the MWM was also performed in adolescence (<xref ref-type="fig" rid="F1">Figure 1G</xref>). The results were very similar to those seen with the 1 mg/kg treatment (<xref ref-type="fig" rid="F1">Figures 1H&#x2013;L</xref>). During the spatial learning process, the latency to the platform in all groups of mice decreased as the number of training days increased, although the drug had no significant effect (<xref ref-type="fig" rid="F1">Figure 1I</xref>, compared with day 16 of the same group, <italic>p</italic> &#x003C; 0.05). We also found that speed had no significant effect on latency (<xref ref-type="fig" rid="F1">Figure 1H</xref>). In probe test 1, there was no significant difference between the Sal group and the METH group in terms of platform site crossings (<xref ref-type="fig" rid="F1">Figure 1J</xref>), the time in the target quadrant (<xref ref-type="fig" rid="F1">Figure 1K</xref>), and the time in the target (<xref ref-type="fig" rid="F1">Figure 1L</xref>). These results showed that long-term exposure to METH during adolescence did not affect the learning and memory abilities of mice in their adolescence.</p>
</sec>
<sec id="S3.SS2">
<title>Exposure to Methamphetamine During Adolescence Impaired Spatial Memory of Mice in Adulthood</title>
<p>Next, we investigated whether drug exposure in adolescence would cause changes in learning and memory abilities at adulthood (63&#x2013;84 postnatal days). Mice were exposed to 14 days of METH (1 or 2 mg/kg). The MWM experiment was performed in adulthood to verify whether the learning and memory abilities had changed. As shown in <xref ref-type="fig" rid="F2">Figures 2A&#x2013;F</xref>, during the phase of spatial learning, all mice learned to find the platform faster as training continued (<xref ref-type="fig" rid="F2">Figure 2C</xref>, when compared to day 46 of the same group, <italic>p</italic> &#x003C; 0.05). Swimming speed had no effect on latency to the platform (<xref ref-type="fig" rid="F2">Figure 2B</xref>). There were no significant differences arising from probe test 2 in terms of platform site crossings (<xref ref-type="fig" rid="F2">Figure 2D</xref>), the time in the target quadrant (<xref ref-type="fig" rid="F2">Figure 2E</xref>), and the time in the target (<xref ref-type="fig" rid="F2">Figure 2F</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption><p>Exposure to METH during adolescence impaired the memory ability of mice in adulthood. <bold>(A&#x2013;F)</bold> The results of the MWM in adulthood after exposure to 1 mg/kg of METH during adolescence. <bold>(A)</bold> Experimental protocol. <bold>(B)</bold> Mean swimming speed in the spatial learning phase. <bold>(C)</bold> Latency to the platform [day: F<sub>(3,42)</sub>=13.275, <italic>p</italic> &#x003C; 0.001; group: F<sub>(1,14)</sub> = 1.307, <italic>p</italic> &#x003E; 0.05; day &#x00D7; group: F<sub>(3,42)</sub> = 0.780, <italic>p</italic> &#x003E; 0.05]. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with day 46 in the Sal group. <sup>#</sup><italic>p</italic> &#x003C; 0.05 compared with day 46 in the METH group. <bold>(D)</bold> Platform site crossings. <bold>(E)</bold> Time in the target quadrant. <bold>(F)</bold> Time in the target. <bold>(G&#x2013;L)</bold> The results of the MWM in adulthood after exposure to 2 mg/kg of METH during adolescence. <bold>(G)</bold> Experimental protocol. <bold>(H)</bold> Mean swimming speed in the spatial learning phase. <bold>(I)</bold> Latency to the platform [day: F<sub>(4, 56)</sub> = 10.184, <italic>p</italic> &#x003C; 0.001; group: F<sub>(1, 14)</sub> = 0.447, <italic>p</italic> &#x003E; 0.05; day &#x00D7; group: F<sub>(4, 56)</sub> = 1.280, <italic>p</italic> &#x003E; 0.05]. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with day 45 in the Sal group. <sup>#</sup><italic>p</italic> &#x003C; 0.05 compared with day 45 in the METH group. Platform site crossings <bold>(J)</bold>, time in the target quadrant <bold>(K)</bold>, and time in the target <bold>(L)</bold> in probe test 2 were decreased. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with the Sal group. Memory ability indices in probe test 1 <bold>(M)</bold> and probe test 2 <bold>(N)</bold>. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with the corresponding group. <bold>(O)</bold> Short-term memory recognition index in the new object recognition test (NORT). <bold>(P)</bold> Long-term memory recognition index was decreased in the NORT. &#x002A;<italic>p</italic> &#x003C; 0.05 compared with the Sal group. <bold>(Q)</bold> Alternation triplet in the Y-maze. Data are presented as mean &#x00B1; SEM, <italic>n</italic> = 8.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fncel-16-892757-g002.tif"/>
</fig>
<p>In contrast, exposure to 2 mg/kg of METH during adolescence impaired spatial memory retention but not acquisition in their adulthood. As shown in <xref ref-type="fig" rid="F2">Figures 2G&#x2013;L</xref>, during the training stage of the MWM (<xref ref-type="fig" rid="F2">Figure 2I</xref>), the latency of mice climbing the platform was not affected by the drug after 5 days of training when the groups were compared (<xref ref-type="fig" rid="F2">Figure 2I</xref>, when compared to day 45 of the same group, <italic>p</italic> &#x003C; 0.05). Mean swimming speed did not have a significant effect on latency to the platform (<xref ref-type="fig" rid="F2">Figure 2H</xref>). In probe test 2, the mice exposed to METH during adolescence underwent fewer platform site crossings [<xref ref-type="fig" rid="F2">Figure 2J</xref>, t<sub>(14)</sub>=2.849, <italic>p</italic> &#x003C; 0.05], less time in the target quadrant [<xref ref-type="fig" rid="F2">Figure 2K</xref>, t<sub>(14)</sub>=2.233, <italic>p</italic> &#x003C; 0.05], and less time in the target [<xref ref-type="fig" rid="F2">Figure 2L</xref>, t<sub>(14)</sub>=2.158, <italic>p</italic> &#x003C; 0.05]. We compared the mean METH/Sal ratio between different doses of exposure in probe test 1 (<xref ref-type="fig" rid="F2">Figure 2M</xref>) and probe test 2 (<xref ref-type="fig" rid="F2">Figure 2N</xref>), including platform site crossings, the time in the target quadrant, and the time in the target. This allowed us to investigate the dose effects on changes in spatial memory in adolescence (probe test 1) and adulthood (probe test 2). The smaller the index, the more serious damage was revealed. As expected, the damage caused by the 2 mg/kg dose was more serious than that caused by the 1 mg/kg dose in adulthood [t<sub>(4)</sub>=3.161, <italic>p</italic> &#x003C; 0.05].</p>
<p>In addition, we conducted the NORT and Y-maze to investigate the cognitive ability of mice during adulthood (<xref ref-type="fig" rid="F2">Figure 2G</xref>). The NORT showed that the short-term memory recognition ability of mice was not significantly affected (<xref ref-type="fig" rid="F2">Figure 2O</xref>). However, during the long-term memory recognition stage (<xref ref-type="fig" rid="F2">Figure 2P</xref>), the recognition index of the METH group was significantly lower than that of the Sal group [t<sub>(14)</sub>=2.547, <italic>p</italic> &#x003C; 0.05]. The Y-maze was performed 7 days after the end of the NORT and revealed no change in the number of spontaneous alternations (<xref ref-type="fig" rid="F2">Figure 2Q</xref>). Collectively, these results suggested that adolescent mice exposed to 2 mg/kg METH suffered from impaired spatial memory and long-term recognition memory in their adulthood.</p>
</sec>
<sec id="S3.SS3">
<title>Exposure to Methamphetamine During Adolescence Resulted in the Reduced Expression of Genes Related to Dorsal Hippocampal Neuroplasticity in Adulthood</title>
<p>To explore the neural plasticity mechanism of memory impairment in adulthood, we first examined the changes in the mRNA expression of genes related to neuroplasticity, including <italic>Arc</italic>, <italic>c-fos</italic>, and <italic>Bdnf</italic> in the dorsal hippocampus of mice exposed to METH (2 mg/kg) during adolescence. The expression levels of <italic>Arc</italic> [<xref ref-type="fig" rid="F3">Figure 3A</xref>, t<sub>(10)</sub>=3.776, <italic>p</italic> &#x003C; 0.01], <italic>c-fos</italic> [<xref ref-type="fig" rid="F3">Figure 3B</xref>, t<sub>(10)</sub>=8.220, <italic>p</italic> &#x003C; 0.001], and <italic>Bdnf</italic> [<xref ref-type="fig" rid="F3">Figure 3C</xref>, t<sub>(10)</sub>=4.267, <italic>p</italic> &#x003C; 0.01] in the METH group were significantly reduced when compared to controls.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption><p>Exposure to METH during adolescence reduced the expression of genes related to synaptic plasticity in the dorsal hippocampus of mice in adulthood. The expression of genes related to neural plasticity in the dorsal hippocampus <bold>(A&#x2013;C)</bold> in adulthood, including <bold>(A)</bold> <italic>Arc</italic>, <bold>(B)</bold> <italic>c-fos</italic>, and <bold>(C)</bold> <italic>Bdnf</italic>. Student&#x2019;s <italic>t</italic>-test: &#x002A;&#x002A;<italic>p</italic> &#x003C; 0.01, &#x002A;&#x002A;&#x002A;<italic>p</italic> &#x003C; 0.001 compared with the Sal group. Data are presented as mean &#x00B1; SEM, <italic>n</italic> = 6.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fncel-16-892757-g003.tif"/>
</fig>
</sec>
<sec id="S3.SS4">
<title>Exposure to Methamphetamine During Adolescence Resulted in Significant Alterations in the Ultrastructure of Synapses in the Dorsal Hippocampus During Adulthood</title>
<p>We then investigated the changes in the ultrastructure of synapses in the dorsal hippocampus (<xref ref-type="fig" rid="F4">Figure 4A</xref>) of adult mice that had been exposed to METH during their adolescence (2 mg/kg). Using TEM, we observed the number of synapses (the left side of <xref ref-type="fig" rid="F4">Figure 4B</xref>, 20,000&#x00D7;) and the ultrastructure of the synapses (the right side of <xref ref-type="fig" rid="F4">Figure 4B</xref>, 40,000&#x00D7;), including the thickness of the PSD, synaptic cleft width, and the length of the presynaptic activity zone. The statistical results are shown in <xref ref-type="fig" rid="F4">Figures 4C&#x2013;F</xref>; compared with the Sal group, the number of synapses [<xref ref-type="fig" rid="F4">Figure 4C</xref>, t<sub>(58)</sub>=5.135, <italic>p</italic> &#x003C; 0.001] and the thickness of the PSD [<xref ref-type="fig" rid="F4">Figure 4D</xref>, t<sub>(74)</sub>=2.72, <italic>p</italic> &#x003C; 0.01] in the METH group were significantly higher, whereas the width of the synaptic cleft was significantly reduced in the METH group [<xref ref-type="fig" rid="F4">Figure 4E</xref>, t<sub>(74)</sub>=3.176, <italic>p</italic> &#x003C; 0.01]. In addition, the length of the presynaptic activity zone was also reduced significantly in the METH group when compared to the Sal group [<xref ref-type="fig" rid="F4">Figure 4F</xref>, t<sub>(74)</sub>=4.751, <italic>p</italic> &#x003C; 0.001]. These results indicated that exposure to METH during adolescence changed synaptic ultrastructure in the dorsal hippocampus during adulthood; this may be the structural basis for spatial memory impairment.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption><p>Exposure to METH during adolescence changed the synaptic ultrastructure in the dorsal hippocampus of mice in adulthood. <bold>(A)</bold> Bilateral dorsal hippocampus images of experimental mice. <bold>(B)</bold> Representative electron micrographs. Images on the left show representative images of the number of synapses (20,000&#x00D7;, scale bars = 500 nm); the red arrow points to a single synapse. Images on the right are representative images of the synaptic ultrastructure (40,000&#x00D7;, scale bars = 200 nm). The length of the segment shown by the white line represents the thickness of the PSD, the width of synaptic cleft, and the length of the presynaptic active zone, respectively. Histograms show the increase in synapse density <bold>(C)</bold> and the thickness of the PSD at its thickest part <bold>(D)</bold>, the reduction in width of the synaptic cleft <bold>(E),</bold> and length of the active zone <bold>(F)</bold>. &#x002A;&#x002A;<italic>p</italic> &#x003C; 0.01, &#x002A;&#x002A;&#x002A;<italic>p</italic> &#x003C; 0.001 compared with the Sal group. Data are presented as mean &#x00B1; SEM, <italic>n</italic> = 3.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fncel-16-892757-g004.tif"/>
</fig>
</sec>
<sec id="S3.SS5">
<title>Exposure to Methamphetamine During Adolescence Resulted in a Significant Reduction in the Number of Neurons in the CA Region of the Dorsal Hippocampus of Mice in Their Adulthood</title>
<p>Structural plasticity includes not only synaptic changes but also the number of neurons and glial cells (<xref ref-type="bibr" rid="B2">Allen and Eroglu, 2017</xref>). Astrocytes are the most abundant glial cells in the central nervous system and have been repeatedly shown to be involved in neuroplasticity; many studies have reported that astrocytes are vital for learning and memory (<xref ref-type="bibr" rid="B2">Allen and Eroglu, 2017</xref>; <xref ref-type="bibr" rid="B44">Robin et al., 2018</xref>). Therefore, we labeled GFAP and NeuN to detect the changes in the number of astrocytes and neurons in the CA and dentate gyrus (DG) regions of the dorsal hippocampus in adult mice that had been exposed to METH during their adolescence (2 mg/kg) (<xref ref-type="fig" rid="F5">Figure 5</xref>). There was no significant difference in terms of cell density of astrocytes in the CA1 region (<xref ref-type="fig" rid="F5">Figures 5A,B</xref>) when compared between the METH group and the Sal group (<xref ref-type="fig" rid="F5">Figure 5C</xref>); However, we identified a significant reduction in the cell density of neurons [<xref ref-type="fig" rid="F5">Figure 5C</xref>, t<sub>(21.175)</sub>=4.025, <italic>p</italic> &#x003C; 0.01], and the ratio of NeuN to GFAP [<xref ref-type="fig" rid="F5">Figure 5C</xref>, t<sub>(25)</sub>=4.078, <italic>p</italic> &#x003C; 0.001] in the METH group. Similarly, in the CA3 region (<xref ref-type="fig" rid="F5">Figures 5A,B</xref>), there was no significant difference in the number of GFAP-positive cells in the METH group when compared to the Sal group (<xref ref-type="fig" rid="F5">Figure 5D</xref>); however, the density of NeuN-positive cells was significantly lower [<xref ref-type="fig" rid="F5">Figure 5D</xref>, t<sub>(19)</sub>=2.427, <italic>p</italic> &#x003C; 0.05]. The ratio of NeuN to GFAP was also significantly reduced in the METH group [<xref ref-type="fig" rid="F5">Figure 5D</xref>, t<sub>(19)</sub>=2.67, <italic>p</italic> &#x003C; 0.05]. Surprisingly, there was no change in the DG region (<xref ref-type="fig" rid="F5">Figure 5E</xref>). In summary, exposure to METH during adolescence can reduce the number of neurons in the CA region in adulthood.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption><p>Exposure to METH during adolescence reduced the number of neurons in the dorsal CA region of mice in adulthood. Fluorescence representative images of the Sal group <bold>(A)</bold> and the METH group <bold>(B)</bold>. The upper part of the figure shows the localization of the CA1, CA3, and DG regions in the dorsal hippocampus under low magnification. Scale bar = 80 &#x03BC;m. The lower part of the figure shows the count image for each partition. Scale bar = 40 &#x03BC;m. Neuronal marker (NeuN, red) and astrocyte marker (GFAP, green). Nuclei (DAPI, blue). Panels <bold>(C&#x2013;E)</bold> represent the density of GFAP-positive cells, NeuN-positive cells, and the ratio of NeuN to GFAP in the CA1, CA3, and DG, respectively. &#x002A;<italic>p</italic> &#x003C; 0.05, &#x002A;&#x002A;<italic>p</italic> &#x003C; 0.01, &#x002A;&#x002A;&#x002A;<italic>p</italic> &#x003C; 0.001 compared with the Sal group. Data are presented as mean &#x00B1; SEM, <italic>n</italic> = 3.</p></caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fncel-16-892757-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="S4" sec-type="discussion">
<title>Discussion</title>
<p>The main findings of this study were 2-fold: (1) exposure to METH during mid-to-late adolescence impaired the memory ability of mice in their adulthood; and (2) the impairment of memory capacity in adulthood is accompanied by molecular and structural changes in the synapses of the dorsal hippocampus.</p>
<p>In our study, we found that exposure to 1 mg/kg or 2 mg/kg of METH during mid-to-late adolescence did not affect the cognitive level of mice at that time, whereas exposure to 2 mg/kg of METH during adolescence resulted in memory impairment in their adulthood. These findings are similar to those published previously which demonstrated cognitive impairment in mice caused by METH exposure during adolescence (<xref ref-type="bibr" rid="B23">Joca et al., 2014</xref>; <xref ref-type="bibr" rid="B6">Buck et al., 2017</xref>; <xref ref-type="bibr" rid="B55">Yan et al., 2019</xref>). One of the possible mechanisms by which METH exposure during adolescence leads to delayed cognitive impairment in adulthood is that METH disrupts the normal brain maturation during late adolescence, thus leading to the gradual development of behavioral deficits and pathological changes in synaptic structure (<xref ref-type="bibr" rid="B15">Grochecki et al., 2021</xref>). Previous studies have shown that the effect of continuous METH exposure may prevent learning and memory damages in mice during adolescence (<xref ref-type="bibr" rid="B23">Joca et al., 2014</xref>; <xref ref-type="bibr" rid="B6">Buck et al., 2017</xref>). This short-term protective mechanism may be due to the negative feedback effect of METH on the activation of the hypothalamic&#x2013;pituitary&#x2013;adrenal (HPA) axis, thus weakening the damaging effects of drugs; however, long-term activation of the HPA axis may lead to adverse effects (<xref ref-type="bibr" rid="B1">Acevedo et al., 2008</xref>; <xref ref-type="bibr" rid="B22">Hueston et al., 2017</xref>). As a key hub of the HPA axis, the paraventricular nucleus of the hypothalamus has been shown to be extensively involved in drug addiction over the recent years (<xref ref-type="bibr" rid="B57">Zhou and Zhu, 2019</xref>). Interestingly, the dorsal hippocampus, which is closely associated with cognitive ability and gradually matures during late adolescence (<xref ref-type="bibr" rid="B29">Luna et al., 2015</xref>; <xref ref-type="bibr" rid="B7">Calabro et al., 2020</xref>), is negatively regulated by glucocorticoids released by the HPA axis and exhibits a projection relationship with the paraventricular nucleus of the hypothalamus (<xref ref-type="bibr" rid="B19">Herman and Cullinan, 1997</xref>). Therefore, exposure to METH during adolescence may cause delayed damage to hippocampal maturation by activating the HPA axis, particularly the paraventricular nucleus of the hypothalamus (<xref ref-type="bibr" rid="B34">McKenna and Vertes, 2004</xref>; <xref ref-type="bibr" rid="B57">Zhou and Zhu, 2019</xref>). These events may explain the damaging effect of METH exposure during adolescence on memory impairment in adulthood, as observed in this study.</p>
<p>Our research confirmed that the decline of learning and memory abilities was accompanied by the changes of synaptic plasticity in the dorsal hippocampus. Here, we first found that the expression levels of <italic>Arc</italic>, <italic>c-fos</italic>, and <italic>Bdnf</italic> were significantly reduced in the dorsal hippocampus of mice suffering from memory impairment in adulthood. As immediate early genes, the rapid and transient response of <italic>Arc</italic> and <italic>c-fos</italic> to synaptic activation is related to long-term potentiation (LTP) maintenance and memory formation (<xref ref-type="bibr" rid="B37">Minatohara et al., 2015</xref>). The main role of <italic>Bdnf</italic> is to initiate a signal cascade by binding to tyrosine kinase receptor B and regulating neuronal plasticity that is conducive to cognition (<xref ref-type="bibr" rid="B20">Hogan et al., 2020</xref>). The expression levels of these molecules have been widely confirmed to be altered by psychostimulant drugs (<xref ref-type="bibr" rid="B10">Cheng et al., 2015</xref>). This suggests that exposure to METH during adolescence leads to the changes in molecules related to neuroplasticity in the dorsal hippocampus in adulthood. We then found that the length of the dorsal hippocampus presynaptic active zone (<xref ref-type="fig" rid="F4">Figure 4F</xref>), an electron-dense network structure in the presynaptic membrane that is important for rapid vesicle fusion and the transmission rate of neurotransmitters in synapses, was reduced in the METH group. Previous studies showed that damage to the presynaptic membrane or a reduction in the length of the presynaptic active zone in the hippocampus could lead to cognitive impairment (<xref ref-type="bibr" rid="B17">Hara et al., 2014</xref>; <xref ref-type="bibr" rid="B50">Vasek et al., 2016</xref>). Collectively, the available evidence suggests that the synaptic transmission rate in the dorsal hippocampus may be reduced by exposure to METH during adolescence, ultimately contributing to the development of memory impairment (<xref ref-type="bibr" rid="B9">Chen et al., 2020</xref>).</p>
<p>Synaptic structural plasticity includes not only changes in the ultrastructure of the synapse but also changes in the number of neurons and glial cells (<xref ref-type="bibr" rid="B2">Allen and Eroglu, 2017</xref>). In this study, we found a significantly reduced number of neurons in the CA region of the dorsal hippocampus rather than the DG region in the METH group of mice during adulthood. Studies have shown that METH can induce neuronal damage in the mouse hippocampus <italic>via</italic> peroxidation stress and mitochondrial dysfunction, thus resulting in a decrease in the number of neurons (<xref ref-type="bibr" rid="B41">Park et al., 2017</xref>; <xref ref-type="bibr" rid="B51">Veschsanit et al., 2021</xref>). During late adolescence, the nervous system begins to mature, including the maturation of the dorsal hippocampus neurons. The cell bodies, synapses, and related neurotransmitter systems of the late maturation region undergo extensive remodeling, thus supporting higher levels of cognitive function (<xref ref-type="bibr" rid="B56">Zeid et al., 2018</xref>; <xref ref-type="bibr" rid="B42">Patel et al., 2021</xref>). Therefore, exposure to METH during late adolescence may affect these developmental processes, resulting in impaired neuronal maturation, reduced neuronal numbers, and impaired memory in adulthood. Furthermore, the CA region is more susceptible to oxidative stress and pressure than the DG region, thus resulting in structural damage (<xref ref-type="bibr" rid="B40">Ouyang et al., 2007</xref>). The activity of pyramidal cells in the CA1&#x2013;CA3 region was shown to be more active than that of granulosa cells in response to the new environment and spatial coding changes induced by learning (<xref ref-type="bibr" rid="B16">Hainmueller and Bartos, 2018</xref>), highlighting the importance of the CA region in new object recognition and spatial memory. A reduction in the number of neurons in the CA region leads to the consequences that are consistent with our behavior performance results in that memory retention in the MWM test, and long-term recognition memory in the NORT, which were found to be impaired in adulthood. Granulosa cells in the DG play a role in initial encoding and the early consolidation of hippocampal memory (<xref ref-type="bibr" rid="B24">Kheirbek et al., 2013</xref>). Consistently, we found that in adult mice, learning and short-term memory abilities remained unchanged, since the Y-maze spontaneous alternate test is thought to be a manifestation of short-term memory (<xref ref-type="bibr" rid="B54">Yamada et al., 1996</xref>). Combined with the previous findings, our results suggest that exposure to METH during mid-to-late adolescence may cause a reduction of neurons in the CA region which may contribute to the impairment of memory retrieval and long-term recognition ability in adulthood.</p>
<p>In addition, we found that mice in the METH group exhibited an increased synaptic number and PSD thickness, along with a reduced synaptic cleft width, in adulthood. This phenomenon was also reported by the previous studies. For example, blocking neuronal activity with tetrodotoxin or AMPA receptor antagonists can increase the size of synapses and amplify the efficacy of synapses (<xref ref-type="bibr" rid="B49">Turrigiano et al., 1998</xref>; <xref ref-type="bibr" rid="B38">Murthy et al., 2001</xref>). Intermittent ethanol intake during adolescence was shown to be associated with increased LTP and dendritic spines, but also showed an impaired memory function (<xref ref-type="bibr" rid="B43">Risher et al., 2015</xref>; <xref ref-type="bibr" rid="B11">Crews et al., 2016</xref>). After several weeks of METH treatment, both the hippocampus and the dorsal striatum showed compensatory effects involving the expression levels of dopamine 1 receptor (D1), dopamine transporter, and tyrosine hydroxylase (<xref ref-type="bibr" rid="B5">Braren et al., 2014</xref>). Collectively, we speculate that the increased number of synapses and thickness of PSD, along with the reduced width of the synaptic cleft, in adulthood may arise due to the compensatory effects of homeostatic plasticity mechanisms induced by METH (<xref ref-type="bibr" rid="B13">Davis and Bezprozvanny, 2001</xref>).</p>
<p>In general, the morphological and molecular compositions of synapses provide the structural basis for synaptic function (<xref ref-type="bibr" rid="B18">Harris and Weinberg, 2012</xref>). Of these, the presynaptic active zone is the site where synaptic vesicles containing neurotransmitters exist (<xref ref-type="bibr" rid="B18">Harris and Weinberg, 2012</xref>). Recent studies, involving sections of mature rat hippocampus, reported the recruitment of presynaptic vesicles to nascent areas of pre-existing synapses to convert them into functionally active areas and that this may constitute the initial phase of LTP (<xref ref-type="bibr" rid="B4">Bell et al., 2014</xref>). In addition, synaptic vesicles contain cadherins that can modulate AMPAR trafficking, thus contributing to the stabilization of enhanced synaptic efficacy during LTP (<xref ref-type="bibr" rid="B35">Mendez et al., 2010</xref>; <xref ref-type="bibr" rid="B18">Harris and Weinberg, 2012</xref>). The PSD is the postsynaptic component corresponding to the presynaptic active region, including glutamate receptors directly related to synaptic transmission, as well as a variety of receptors and scaffolds involved in synaptic transmission and plasticity, such as CaMKII and PSD95 (<xref ref-type="bibr" rid="B53">Wheal et al., 1998</xref>; <xref ref-type="bibr" rid="B36">Miller et al., 2012</xref>). In addition, postsynaptic densities are the heads of dendritic spines, and structural changes in these densities can lead to changes in the synthesis and localization of molecular signaling pathway proteins and cytoskeletal proteins associated with both LTP and LTD (<xref ref-type="bibr" rid="B32">Matsuzaki et al., 2004</xref>). The anchoring or internalization of AMPA glutamate receptors produces more functional dendritic spines (LTP) or leads to the contraction of existing dendritic spines (LTD) (<xref ref-type="bibr" rid="B46">Russo et al., 2010</xref>). The above-mentioned studies indicated that changes in synaptic structure can lead to the changes in functional plasticity, which ultimately influence behavior. Thus, investigation of how METH exposure during adolescence induces the changes in synaptic structure, and whether it affects functional plasticity and ultimately leads to the mice exhibiting memory impairment in adulthood needs to be further confirmed.</p>
<p>There are some limitations of our research which are need to be considered: (1) the changes in transmission efficiency caused by synaptic structure need to be further verified by synaptic function, (2) the causal relationship between changes in synaptic structural plasticity and memory impairment needs to be confirmed; and (3) there is insufficient evidence to indicate the specific mechanisms underlying memory impairment in mice exposed to METH during adolescence and in particular, whether this involves the activation of the HPA axis and related changes in the neural circuit changes deserves further exploration.</p>
<p>In summary, the exposure of mice to METH during mid-to-late adolescence impaired memory retrieval and long-term recognition memory ability in adulthood. These effects were accompanied by the changes in dorsal hippocampal neuronal and synaptic structure; it is possible that these changes may underlie this delayed impairment, at least in part. These results suggest that by identifying the regulatory mechanisms associated with neuroplasticity changes in this process could provide more evidence to prevent drug abuse in juveniles.</p>
</sec>
<sec id="S5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="S6">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by Institutional Animal Care Committee at Xi&#x2019;an Jiaotong University.</p>
</sec>
<sec id="S7">
<title>Author Contributions</title>
<p>TC initiated the project. TC, ML, and LZ designed the experiments. ML and RW carried out the METH exposure and behavior experiments and performed the TEM and IF experiments. ML performed the PCR experiments and wrote the manuscript. RW and HS assisted with data analysis and interpretation of findings. LZ, DM, and HW provided critical revision of the manuscript for intellectual content. All authors critically reviewed the content and approved the final version of the manuscript for publication.</p>
</sec>
<sec id="conf1" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="pudiscl1" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<sec id="S8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the grants from the National Natural Science Foundation of China to TC (nos. 81772034 and 82171879).</p>
</sec>
<ack><p>We wish to thank Yanjiong Chen, Department of Immunology and Pathogenic Biology, College of Basic Medicine, Xi&#x2019;an Jiaotong University Health Science Center for kindly revised the article. We also thank Dan Liu, Tong Ni, and Shuai Wang for stimulating discussions and providing animal care.</p>
</ack>
<ref-list>
<title>References</title>
<ref id="B1"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Acevedo</surname> <given-names>S. F.</given-names></name> <name><surname>Pfankuch</surname> <given-names>T.</given-names></name> <name><surname>van Meer</surname> <given-names>P.</given-names></name> <name><surname>Raber</surname> <given-names>J.</given-names></name></person-group> (<year>2008</year>). <article-title>Role of histamine in short- and long-term effects of methamphetamine on the developing mouse brain.</article-title> <source><italic>J. Neurochem.</italic></source> <volume>107</volume> <fpage>976</fpage>&#x2013;<lpage>986</lpage>. <pub-id pub-id-type="doi">10.1111/j.1471-4159.2008.05673.x</pub-id> <pub-id pub-id-type="pmid">18786166</pub-id></citation></ref>
<ref id="B2"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Allen</surname> <given-names>N. J.</given-names></name> <name><surname>Eroglu</surname> <given-names>C.</given-names></name></person-group> (<year>2017</year>). <article-title>Cell biology of astrocyte-synapse interactions.</article-title> <source><italic>Neuron</italic></source> <volume>96</volume> <fpage>697</fpage>&#x2013;<lpage>708</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuron.2017.09.056</pub-id> <pub-id pub-id-type="pmid">29096081</pub-id></citation></ref>
<ref id="B3"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Antunes</surname> <given-names>M.</given-names></name> <name><surname>Biala</surname> <given-names>G.</given-names></name></person-group> (<year>2012</year>). <article-title>The novel object recognition memory: neurobiology, test procedure, and its modifications.</article-title> <source><italic>Cogn. Process.</italic></source> <volume>13</volume> <fpage>93</fpage>&#x2013;<lpage>110</lpage>. <pub-id pub-id-type="doi">10.1007/s10339-011-0430-z</pub-id> <pub-id pub-id-type="pmid">22160349</pub-id></citation></ref>
<ref id="B4"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Bell</surname> <given-names>M. E.</given-names></name> <name><surname>Bourne</surname> <given-names>J. N.</given-names></name> <name><surname>Chirillo</surname> <given-names>M. A.</given-names></name> <name><surname>Mendenhall</surname> <given-names>J. M.</given-names></name> <name><surname>Kuwajima</surname> <given-names>M.</given-names></name> <name><surname>Harris</surname> <given-names>K. M.</given-names></name></person-group> (<year>2014</year>). <article-title>Dynamics of nascent and active zone ultrastructure as synapses enlarge during long-term potentiation in mature hippocampus.</article-title> <source><italic>J. Comp. Neurol.</italic></source> <volume>522</volume> <fpage>3861</fpage>&#x2013;<lpage>3884</lpage>. <pub-id pub-id-type="doi">10.1002/cne.23646</pub-id> <pub-id pub-id-type="pmid">25043676</pub-id></citation></ref>
<ref id="B5"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Braren</surname> <given-names>S. H.</given-names></name> <name><surname>Drapala</surname> <given-names>D.</given-names></name> <name><surname>Tulloch</surname> <given-names>I. K.</given-names></name> <name><surname>Serrano</surname> <given-names>P. A.</given-names></name></person-group> (<year>2014</year>). <article-title>Methamphetamine-induced short-term increase and long-term decrease in spatial working memory affects protein Kinase M zeta (PKMzeta), dopamine, and glutamate receptors.</article-title> <source><italic>Front. Behav. Neurosci.</italic></source> <volume>8</volume>:<issue>438</issue>. <pub-id pub-id-type="doi">10.3389/fnbeh.2014.00438</pub-id> <pub-id pub-id-type="pmid">25566006</pub-id></citation></ref>
<ref id="B6"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Buck</surname> <given-names>J. M.</given-names></name> <name><surname>Morris</surname> <given-names>A. S.</given-names></name> <name><surname>Weber</surname> <given-names>S. J.</given-names></name> <name><surname>Raber</surname> <given-names>J.</given-names></name> <name><surname>Siegel</surname> <given-names>J. A.</given-names></name></person-group> (<year>2017</year>). <article-title>Effects of adolescent methamphetamine and nicotine exposure on behavioral performance and MAP-2 immunoreactivity in the nucleus accumbens of adolescent mice.</article-title> <source><italic>Behav. Brain Res.</italic></source> <volume>323</volume> <fpage>78</fpage>&#x2013;<lpage>85</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbr.2017.01.010</pub-id> <pub-id pub-id-type="pmid">28089854</pub-id></citation></ref>
<ref id="B7"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Calabro</surname> <given-names>F. J.</given-names></name> <name><surname>Murty</surname> <given-names>V. P.</given-names></name> <name><surname>Jalbrzikowski</surname> <given-names>M.</given-names></name> <name><surname>Tervo-Clemmens</surname> <given-names>B.</given-names></name> <name><surname>Luna</surname> <given-names>B.</given-names></name></person-group> (<year>2020</year>). <article-title>Development of hippocampal-prefrontal cortex interactions through adolescence.</article-title> <source><italic>Cereb. Cortex</italic></source> <volume>30</volume> <fpage>1548</fpage>&#x2013;<lpage>1558</lpage>. <pub-id pub-id-type="doi">10.1093/cercor/bhz186</pub-id> <pub-id pub-id-type="pmid">31670797</pub-id></citation></ref>
<ref id="B8"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cao</surname> <given-names>G.</given-names></name> <name><surname>Zhang</surname> <given-names>Y.</given-names></name> <name><surname>Zhu</surname> <given-names>L.</given-names></name> <name><surname>Zhu</surname> <given-names>J.</given-names></name> <name><surname>Zhao</surname> <given-names>N.</given-names></name> <name><surname>Dong</surname> <given-names>N.</given-names></name><etal/></person-group> (<year>2018</year>). <article-title>The inhibitory effect of levo-tetrahydropalmatine on the methamphetamine-induced spatial memory impairment in mice.</article-title> <source><italic>Neurosci. Lett.</italic></source> <volume>672</volume> <fpage>34</fpage>&#x2013;<lpage>39</lpage>. <pub-id pub-id-type="doi">10.1016/j.neulet.2018.02.018</pub-id> <pub-id pub-id-type="pmid">29447954</pub-id></citation></ref>
<ref id="B9"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname> <given-names>X.</given-names></name> <name><surname>Wu</surname> <given-names>X.</given-names></name> <name><surname>Wu</surname> <given-names>H.</given-names></name> <name><surname>Zhang</surname> <given-names>M.</given-names></name></person-group> (<year>2020</year>). <article-title>Phase separation at the synapse.</article-title> <source><italic>Nat. Neurosci.</italic></source> <volume>23</volume> <fpage>301</fpage>&#x2013;<lpage>310</lpage>. <pub-id pub-id-type="doi">10.1038/s41593-019-0579-9</pub-id> <pub-id pub-id-type="pmid">32015539</pub-id></citation></ref>
<ref id="B10"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Cheng</surname> <given-names>M. C.</given-names></name> <name><surname>Hsu</surname> <given-names>S. H.</given-names></name> <name><surname>Chen</surname> <given-names>C. H.</given-names></name></person-group> (<year>2015</year>). <article-title>Chronic methamphetamine treatment reduces the expression of synaptic plasticity genes and changes their DNA methylation status in the mouse brain.</article-title> <source><italic>Brain Res.</italic></source> <volume>1629</volume> <fpage>126</fpage>&#x2013;<lpage>134</lpage>. <pub-id pub-id-type="doi">10.1016/j.brainres.2015.10.021</pub-id> <pub-id pub-id-type="pmid">26496011</pub-id></citation></ref>
<ref id="B11"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Crews</surname> <given-names>F. T.</given-names></name> <name><surname>Vetreno</surname> <given-names>R. P.</given-names></name> <name><surname>Broadwater</surname> <given-names>M. A.</given-names></name> <name><surname>Robinson</surname> <given-names>D. L.</given-names></name></person-group> (<year>2016</year>). <article-title>Adolescent alcohol exposure persistently impacts adult neurobiology and behavior.</article-title> <source><italic>Pharmacol. Rev.</italic></source> <volume>68</volume> <fpage>1074</fpage>&#x2013;<lpage>1109</lpage>. <pub-id pub-id-type="doi">10.1124/pr.115.012138</pub-id> <pub-id pub-id-type="pmid">27677720</pub-id></citation></ref>
<ref id="B12"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>D&#x2019;Amico</surname> <given-names>E. J.</given-names></name> <name><surname>Davis</surname> <given-names>J. P.</given-names></name> <name><surname>Tucker</surname> <given-names>J. S.</given-names></name> <name><surname>Seelam</surname> <given-names>R.</given-names></name> <name><surname>Stein</surname> <given-names>B. D.</given-names></name></person-group> (<year>2021</year>). <article-title>Opioid misuse during late adolescence and its effects on risk behaviors, social functioning, health, and emerging adult roles.</article-title> <source><italic>Addict. Behav.</italic></source> <volume>113</volume>:<issue>106696</issue>. <pub-id pub-id-type="doi">10.1016/j.addbeh.2020.106696</pub-id> <pub-id pub-id-type="pmid">33264695</pub-id></citation></ref>
<ref id="B13"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Davis</surname> <given-names>G. W.</given-names></name> <name><surname>Bezprozvanny</surname> <given-names>I.</given-names></name></person-group> (<year>2001</year>). <article-title>Maintaining the stability of neural function: a homeostatic hypothesis.</article-title> <source><italic>Annu. Rev. Physiol.</italic></source> <volume>63</volume> <fpage>847</fpage>&#x2013;<lpage>869</lpage>. <pub-id pub-id-type="doi">10.1146/annurev.physiol.63.1.847</pub-id> <pub-id pub-id-type="pmid">11181978</pub-id></citation></ref>
<ref id="B14"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Franklin</surname> <given-names>K. B. J.</given-names></name> <name><surname>Paxinos</surname> <given-names>G.</given-names></name></person-group> (<year>2001</year>). <source><italic>The Mouse Brain: in Stereotaxic Coordinates.</italic></source> <publisher-loc>Amsterdam</publisher-loc>: <publisher-name>Academic Press:</publisher-name>.</citation></ref>
<ref id="B15"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Grochecki</surname> <given-names>P.</given-names></name> <name><surname>Smaga</surname> <given-names>I.</given-names></name> <name><surname>Lopatynska-Mazurek</surname> <given-names>M.</given-names></name> <name><surname>Gibula-Tarlowska</surname> <given-names>E.</given-names></name> <name><surname>Kedzierska</surname> <given-names>E.</given-names></name> <name><surname>Listos</surname> <given-names>J.</given-names></name><etal/></person-group> (<year>2021</year>). <article-title>Effects of mephedrone and amphetamine exposure during adolescence on spatial memory in adulthood: behavioral and neurochemical analysis.</article-title> <source><italic>Int. J. Mol. Sci.</italic></source> <volume>22</volume>:<issue>589</issue>. <pub-id pub-id-type="doi">10.3390/ijms22020589</pub-id> <pub-id pub-id-type="pmid">33435576</pub-id></citation></ref>
<ref id="B16"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hainmueller</surname> <given-names>T.</given-names></name> <name><surname>Bartos</surname> <given-names>M.</given-names></name></person-group> (<year>2018</year>). <article-title>Parallel emergence of stable and dynamic memory engrams in the hippocampus.</article-title> <source><italic>Nature</italic></source> <volume>558</volume> <fpage>292</fpage>&#x2013;<lpage>296</lpage>. <pub-id pub-id-type="doi">10.1038/s41586-018-0191-2</pub-id> <pub-id pub-id-type="pmid">29875406</pub-id></citation></ref>
<ref id="B17"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hara</surname> <given-names>Y.</given-names></name> <name><surname>Yuk</surname> <given-names>F.</given-names></name> <name><surname>Puri</surname> <given-names>R.</given-names></name> <name><surname>Janssen</surname> <given-names>W. G.</given-names></name> <name><surname>Rapp</surname> <given-names>P. R.</given-names></name> <name><surname>Morrison</surname> <given-names>J. H.</given-names></name></person-group> (<year>2014</year>). <article-title>Presynaptic mitochondrial morphology in monkey prefrontal cortex correlates with working memory and is improved with estrogen treatment.</article-title> <source><italic>Proc. Natl. Acad. Sci. U.S.A.</italic></source> <volume>111</volume> <fpage>486</fpage>&#x2013;<lpage>491</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1311310110</pub-id> <pub-id pub-id-type="pmid">24297907</pub-id></citation></ref>
<ref id="B18"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Harris</surname> <given-names>K. M.</given-names></name> <name><surname>Weinberg</surname> <given-names>R. J.</given-names></name></person-group> (<year>2012</year>). <article-title>Ultrastructure of synapses in the mammalian brain.</article-title> <source><italic>Cold Spring Harb. Perspect. Biol.</italic></source> <volume>4</volume>:<issue>a005587a</issue>. <pub-id pub-id-type="doi">10.1101/cshperspect.a005587</pub-id> <pub-id pub-id-type="pmid">22357909</pub-id></citation></ref>
<ref id="B19"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Herman</surname> <given-names>J. P.</given-names></name> <name><surname>Cullinan</surname> <given-names>W. E.</given-names></name></person-group> (<year>1997</year>). <article-title>Neurocircuitry of stress: central control of the hypothalamo-pituitary-adrenocortical axis.</article-title> <source><italic>Trends Neurosci.</italic></source> <volume>20</volume> <fpage>78</fpage>&#x2013;<lpage>84</lpage>. <pub-id pub-id-type="doi">10.1016/s0166-2236(96)10069-2</pub-id></citation></ref>
<ref id="B20"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hogan</surname> <given-names>M. K.</given-names></name> <name><surname>Hamilton</surname> <given-names>G. F.</given-names></name> <name><surname>Horner</surname> <given-names>P. J.</given-names></name></person-group> (<year>2020</year>). <article-title>Neural stimulation and molecular mechanisms of plasticity and regeneration: a review.</article-title> <source><italic>Front. Cell Neurosci.</italic></source> <volume>14</volume>:<issue>271</issue>. <pub-id pub-id-type="doi">10.3389/fncel.2020.00271</pub-id> <pub-id pub-id-type="pmid">33173465</pub-id></citation></ref>
<ref id="B21"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hosseini</surname> <given-names>S.</given-names></name> <name><surname>Michaelsen-Preusse</surname> <given-names>K.</given-names></name> <name><surname>Grigoryan</surname> <given-names>G.</given-names></name> <name><surname>Chhatbar</surname> <given-names>C.</given-names></name> <name><surname>Kalinke</surname> <given-names>U.</given-names></name> <name><surname>Korte</surname> <given-names>M.</given-names></name></person-group> (<year>2020</year>). <article-title>Type I interferon receptor signaling in astrocytes regulates hippocampal synaptic plasticity and cognitive function of the healthy CNS.</article-title> <source><italic>Cell Rep.</italic></source> <volume>31</volume>:<issue>107666</issue>. <pub-id pub-id-type="doi">10.1016/j.celrep.2020.107666</pub-id> <pub-id pub-id-type="pmid">32433975</pub-id></citation></ref>
<ref id="B22"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Hueston</surname> <given-names>C. M.</given-names></name> <name><surname>Cryan</surname> <given-names>J. F.</given-names></name> <name><surname>Nolan</surname> <given-names>Y. M.</given-names></name></person-group> (<year>2017</year>). <article-title>Stress and adolescent hippocampal neurogenesis: diet and exercise as cognitive modulators.</article-title> <source><italic>Transl. Psychiatry</italic></source> <volume>7</volume>:<issue>e1081</issue>. <pub-id pub-id-type="doi">10.1038/tp.2017.48</pub-id> <pub-id pub-id-type="pmid">28375209</pub-id></citation></ref>
<ref id="B23"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Joca</surname> <given-names>L.</given-names></name> <name><surname>Zuloaga</surname> <given-names>D. G.</given-names></name> <name><surname>Raber</surname> <given-names>J.</given-names></name> <name><surname>Siegel</surname> <given-names>J. A.</given-names></name></person-group> (<year>2014</year>). <article-title>Long-term effects of early adolescent methamphetamine exposure on depression-like behavior and the hypothalamic vasopressin system in mice.</article-title> <source><italic>Dev. Neurosci.</italic></source> <volume>36</volume> <fpage>108</fpage>&#x2013;<lpage>118</lpage>. <pub-id pub-id-type="doi">10.1159/000360001</pub-id> <pub-id pub-id-type="pmid">24686407</pub-id></citation></ref>
<ref id="B24"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Kheirbek</surname> <given-names>M. A.</given-names></name> <name><surname>Drew</surname> <given-names>L. J.</given-names></name> <name><surname>Burghardt</surname> <given-names>N. S.</given-names></name> <name><surname>Costantini</surname> <given-names>D. O.</given-names></name> <name><surname>Tannenholz</surname> <given-names>L.</given-names></name> <name><surname>Ahmari</surname> <given-names>S. E.</given-names></name><etal/></person-group> (<year>2013</year>). <article-title>Differential control of learning and anxiety along the dorsoventral axis of the dentate gyrus.</article-title> <source><italic>Neuron</italic></source> <volume>77</volume> <fpage>955</fpage>&#x2013;<lpage>968</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuron.2012.12.038</pub-id> <pub-id pub-id-type="pmid">23473324</pub-id></citation></ref>
<ref id="B25"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Levine</surname> <given-names>A.</given-names></name> <name><surname>Clemenza</surname> <given-names>K.</given-names></name> <name><surname>Rynn</surname> <given-names>M.</given-names></name> <name><surname>Lieberman</surname> <given-names>J.</given-names></name></person-group> (<year>2017</year>). <article-title>Evidence for the risks and consequences of adolescent cannabis exposure.</article-title> <source><italic>J. Am. Acad. Child Adolesc. Psychiatry</italic></source> <volume>56</volume> <fpage>214</fpage>&#x2013;<lpage>225</lpage>. <pub-id pub-id-type="doi">10.1016/j.jaac.2016.12.014</pub-id> <pub-id pub-id-type="pmid">28219487</pub-id></citation></ref>
<ref id="B26"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname> <given-names>D.</given-names></name> <name><surname>Liang</surname> <given-names>M.</given-names></name> <name><surname>Zhu</surname> <given-names>L.</given-names></name> <name><surname>Zhou</surname> <given-names>T. T.</given-names></name> <name><surname>Wang</surname> <given-names>Y.</given-names></name> <name><surname>Wang</surname> <given-names>R.</given-names></name><etal/></person-group> (<year>2021</year>). <article-title>Potential Ago2/miR-3068-5p cascades in the nucleus accumbens contribute to methamphetamine-induced locomotor sensitization of mice.</article-title> <source><italic>Front. Pharmacol.</italic></source> <volume>12</volume>:<issue>708034</issue>. <pub-id pub-id-type="doi">10.3389/fphar.2021.708034</pub-id> <pub-id pub-id-type="pmid">34483916</pub-id></citation></ref>
<ref id="B27"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Livak</surname> <given-names>K. J.</given-names></name> <name><surname>Schmittgen</surname> <given-names>T. D.</given-names></name></person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.</article-title> <source><italic>Methods</italic></source> <volume>25</volume> <fpage>402</fpage>&#x2013;<lpage>408</lpage>. <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id> <pub-id pub-id-type="pmid">11846609</pub-id></citation></ref>
<ref id="B28"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Luikinga</surname> <given-names>S. J.</given-names></name> <name><surname>Kim</surname> <given-names>J. H.</given-names></name> <name><surname>Perry</surname> <given-names>C. J.</given-names></name></person-group> (<year>2018</year>). <article-title>Developmental perspectives on methamphetamine abuse: exploring adolescent vulnerabilities on brain and behavior.</article-title> <source><italic>Prog. Neuropsychopharmacol. Biol. Psychiatry</italic></source> <volume>87(Pt A)</volume> <fpage>78</fpage>&#x2013;<lpage>84</lpage>. <pub-id pub-id-type="doi">10.1016/j.pnpbp.2017.11.010</pub-id> <pub-id pub-id-type="pmid">29128447</pub-id></citation></ref>
<ref id="B29"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Luna</surname> <given-names>B.</given-names></name> <name><surname>Marek</surname> <given-names>S.</given-names></name> <name><surname>Larsen</surname> <given-names>B.</given-names></name> <name><surname>Tervo-Clemmens</surname> <given-names>B.</given-names></name> <name><surname>Chahal</surname> <given-names>R.</given-names></name></person-group> (<year>2015</year>). <article-title>An integrative model of the maturation of cognitive control.</article-title> <source><italic>Annu. Rev. Neurosci.</italic></source> <volume>38</volume> <fpage>151</fpage>&#x2013;<lpage>170</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-neuro-071714-034054</pub-id> <pub-id pub-id-type="pmid">26154978</pub-id></citation></ref>
<ref id="B30"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Lyoo</surname> <given-names>I. K.</given-names></name> <name><surname>Yoon</surname> <given-names>S.</given-names></name> <name><surname>Kim</surname> <given-names>T. S.</given-names></name> <name><surname>Lim</surname> <given-names>S. M.</given-names></name> <name><surname>Choi</surname> <given-names>Y.</given-names></name> <name><surname>Kim</surname> <given-names>J. E.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Predisposition to and effects of methamphetamine use on the adolescent brain.</article-title> <source><italic>Mol. Psychiatry</italic></source> <volume>20</volume> <fpage>1516</fpage>&#x2013;<lpage>1524</lpage>. <pub-id pub-id-type="doi">10.1038/mp.2014.191</pub-id> <pub-id pub-id-type="pmid">25666756</pub-id></citation></ref>
<ref id="B31"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Marmorstein</surname> <given-names>N. R.</given-names></name> <name><surname>Iacono</surname> <given-names>W. G.</given-names></name> <name><surname>Malone</surname> <given-names>S. M.</given-names></name></person-group> (<year>2010</year>). <article-title>Longitudinal associations between depression and substance dependence from adolescence through early adulthood.</article-title> <source><italic>Drug Alcohol Depend.</italic></source> <volume>107</volume> <fpage>154</fpage>&#x2013;<lpage>160</lpage>. <pub-id pub-id-type="doi">10.1016/j.drugalcdep.2009.10.002</pub-id> <pub-id pub-id-type="pmid">19926409</pub-id></citation></ref>
<ref id="B32"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Matsuzaki</surname> <given-names>M.</given-names></name> <name><surname>Honkura</surname> <given-names>N.</given-names></name> <name><surname>Ellis-Davies</surname> <given-names>G. C.</given-names></name> <name><surname>Kasai</surname> <given-names>H.</given-names></name></person-group> (<year>2004</year>). <article-title>Structural basis of long-term potentiation in single dendritic spines.</article-title> <source><italic>Nature</italic></source> <volume>429</volume> <fpage>761</fpage>&#x2013;<lpage>766</lpage>. <pub-id pub-id-type="doi">10.1038/nature02617</pub-id> <pub-id pub-id-type="pmid">15190253</pub-id></citation></ref>
<ref id="B33"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>McCabe</surname> <given-names>S. E.</given-names></name> <name><surname>Veliz</surname> <given-names>P. T.</given-names></name> <name><surname>Dickinson</surname> <given-names>K.</given-names></name> <name><surname>Schepis</surname> <given-names>T. S.</given-names></name> <name><surname>Schulenberg</surname> <given-names>J. E.</given-names></name></person-group> (<year>2019</year>). <article-title>Trajectories of prescription drug misuse during the transition from late adolescence into adulthood in the USA: a national longitudinal multicohort study.</article-title> <source><italic>Lancet Psychiatry</italic></source> <volume>6</volume> <fpage>840</fpage>&#x2013;<lpage>850</lpage>. <pub-id pub-id-type="doi">10.1016/S2215-0366(19)30299-8</pub-id></citation></ref>
<ref id="B34"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>McKenna</surname> <given-names>J. T.</given-names></name> <name><surname>Vertes</surname> <given-names>R. P.</given-names></name></person-group> (<year>2004</year>). <article-title>Afferent projections to nucleus reuniens of the thalamus.</article-title> <source><italic>J. Comp. Neurol.</italic></source> <volume>480</volume> <fpage>115</fpage>&#x2013;<lpage>142</lpage>. <pub-id pub-id-type="doi">10.1002/cne.20342</pub-id> <pub-id pub-id-type="pmid">15514932</pub-id></citation></ref>
<ref id="B35"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Mendez</surname> <given-names>P.</given-names></name> <name><surname>De Roo</surname> <given-names>M.</given-names></name> <name><surname>Poglia</surname> <given-names>L.</given-names></name> <name><surname>Klauser</surname> <given-names>P.</given-names></name> <name><surname>Muller</surname> <given-names>D.</given-names></name></person-group> (<year>2010</year>). <article-title>N-cadherin mediates plasticity-induced long-term spine stabilization.</article-title> <source><italic>J. Cell Biol.</italic></source> <volume>189</volume> <fpage>589</fpage>&#x2013;<lpage>600</lpage>. <pub-id pub-id-type="doi">10.1083/jcb.201003007</pub-id> <pub-id pub-id-type="pmid">20440002</pub-id></citation></ref>
<ref id="B36"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Miller</surname> <given-names>E. C.</given-names></name> <name><surname>Zhang</surname> <given-names>L.</given-names></name> <name><surname>Dummer</surname> <given-names>B. W.</given-names></name> <name><surname>Cariveau</surname> <given-names>D. R.</given-names></name> <name><surname>Loh</surname> <given-names>H.</given-names></name> <name><surname>Law</surname> <given-names>P. Y.</given-names></name><etal/></person-group> (<year>2012</year>). <article-title>Differential modulation of drug-induced structural and functional plasticity of dendritic spines.</article-title> <source><italic>Mol. Pharmacol.</italic></source> <volume>82</volume> <fpage>333</fpage>&#x2013;<lpage>343</lpage>. <pub-id pub-id-type="doi">10.1124/mol.112.078162</pub-id> <pub-id pub-id-type="pmid">22596350</pub-id></citation></ref>
<ref id="B37"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Minatohara</surname> <given-names>K.</given-names></name> <name><surname>Akiyoshi</surname> <given-names>M.</given-names></name> <name><surname>Okuno</surname> <given-names>H.</given-names></name></person-group> (<year>2015</year>). <article-title>Role of immediate-early genes in synaptic plasticity and neuronal ensembles underlying the memory trace.</article-title> <source><italic>Front. Mol. Neurosci.</italic></source> <volume>8</volume>:<issue>78</issue>. <pub-id pub-id-type="doi">10.3389/fnmol.2015.00078</pub-id> <pub-id pub-id-type="pmid">26778955</pub-id></citation></ref>
<ref id="B38"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Murthy</surname> <given-names>V. N.</given-names></name> <name><surname>Schikorski</surname> <given-names>T.</given-names></name> <name><surname>Stevens</surname> <given-names>C. F.</given-names></name> <name><surname>Zhu</surname> <given-names>Y.</given-names></name></person-group> (<year>2001</year>). <article-title>Inactivity produces increases in neurotransmitter release and synapse size.</article-title> <source><italic>Neuron</italic></source> <volume>32</volume> <fpage>673</fpage>&#x2013;<lpage>682</lpage>. <pub-id pub-id-type="doi">10.1016/s0896-6273(01)00500-1</pub-id></citation></ref>
<ref id="B39"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>North</surname> <given-names>A.</given-names></name> <name><surname>Swant</surname> <given-names>J.</given-names></name> <name><surname>Salvatore</surname> <given-names>M. F.</given-names></name> <name><surname>Gamble-George</surname> <given-names>J.</given-names></name> <name><surname>Prins</surname> <given-names>P.</given-names></name> <name><surname>Butler</surname> <given-names>B.</given-names></name><etal/></person-group> (<year>2013</year>). <article-title>Chronic methamphetamine exposure produces a delayed, long-lasting memory deficit.</article-title> <source><italic>Synapse</italic></source> <volume>67</volume> <fpage>245</fpage>&#x2013;<lpage>257</lpage>. <pub-id pub-id-type="doi">10.1002/syn.21635</pub-id> <pub-id pub-id-type="pmid">23280858</pub-id></citation></ref>
<ref id="B40"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ouyang</surname> <given-names>Y. B.</given-names></name> <name><surname>Voloboueva</surname> <given-names>L. A.</given-names></name> <name><surname>Xu</surname> <given-names>L. J.</given-names></name> <name><surname>Giffard</surname> <given-names>R. G.</given-names></name></person-group> (<year>2007</year>). <article-title>Selective dysfunction of hippocampal CA1 astrocytes contributes to delayed neuronal damage after transient forebrain ischemia.</article-title> <source><italic>J. Neurosci.</italic></source> <volume>27</volume> <fpage>4253</fpage>&#x2013;<lpage>4260</lpage>. <pub-id pub-id-type="doi">10.1523/JNEUROSCI.0211-07.2007</pub-id> <pub-id pub-id-type="pmid">17442809</pub-id></citation></ref>
<ref id="B41"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Park</surname> <given-names>J. H.</given-names></name> <name><surname>Seo</surname> <given-names>Y. H.</given-names></name> <name><surname>Jang</surname> <given-names>J. H.</given-names></name> <name><surname>Jeong</surname> <given-names>C. H.</given-names></name> <name><surname>Lee</surname> <given-names>S.</given-names></name> <name><surname>Park</surname> <given-names>B.</given-names></name></person-group> (<year>2017</year>). <article-title>Asiatic acid attenuates methamphetamine-induced neuroinflammation and neurotoxicity through blocking of NF-kB/STAT3/ERK and mitochondria-mediated apoptosis pathway.</article-title> <source><italic>J. Neuroinflammation</italic></source> <volume>14</volume>:<issue>240</issue>. <pub-id pub-id-type="doi">10.1186/s12974-017-1009-0</pub-id> <pub-id pub-id-type="pmid">29228978</pub-id></citation></ref>
<ref id="B42"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Patel</surname> <given-names>P. K.</given-names></name> <name><surname>Leathem</surname> <given-names>L. D.</given-names></name> <name><surname>Currin</surname> <given-names>D. L.</given-names></name> <name><surname>Karlsgodt</surname> <given-names>K. H.</given-names></name></person-group> (<year>2021</year>). <article-title>Adolescent neurodevelopment and vulnerability to psychosis.</article-title> <source><italic>Biol. Psychiatry</italic></source> <volume>89</volume> <fpage>184</fpage>&#x2013;<lpage>193</lpage>. <pub-id pub-id-type="doi">10.1016/j.biopsych.2020.06.028</pub-id> <pub-id pub-id-type="pmid">32896384</pub-id></citation></ref>
<ref id="B43"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Risher</surname> <given-names>M. L.</given-names></name> <name><surname>Fleming</surname> <given-names>R. L.</given-names></name> <name><surname>Risher</surname> <given-names>W. C.</given-names></name> <name><surname>Miller</surname> <given-names>K. M.</given-names></name> <name><surname>Klein</surname> <given-names>R. C.</given-names></name> <name><surname>Wills</surname> <given-names>T.</given-names></name><etal/></person-group> (<year>2015</year>). <article-title>Adolescent intermittent alcohol exposure: persistence of structural and functional hippocampal abnormalities into adulthood.</article-title> <source><italic>Alcohol Clin. Exp. Res.</italic></source> <volume>39</volume> <fpage>989</fpage>&#x2013;<lpage>997</lpage>. <pub-id pub-id-type="doi">10.1111/acer.12725</pub-id> <pub-id pub-id-type="pmid">25916839</pub-id></citation></ref>
<ref id="B44"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Robin</surname> <given-names>L. M.</given-names></name> <name><surname>Oliveira da Cruz</surname> <given-names>J. F.</given-names></name> <name><surname>Langlais</surname> <given-names>V. C.</given-names></name> <name><surname>Martin-Fernandez</surname> <given-names>M.</given-names></name> <name><surname>Metna-Laurent</surname> <given-names>M.</given-names></name> <name><surname>Busquets-Garcia</surname> <given-names>A.</given-names></name><etal/></person-group> (<year>2018</year>). <article-title>Astroglial CB1 receptors determine synaptic d-serine availability to enable recognition memory.</article-title> <source><italic>Neuron</italic></source> <volume>98</volume> <fpage>935</fpage>&#x2013;<lpage>944 e935</lpage>. <pub-id pub-id-type="doi">10.1016/j.neuron.2018.04.034</pub-id> <pub-id pub-id-type="pmid">29779943</pub-id></citation></ref>
<ref id="B45"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Ru</surname> <given-names>Q.</given-names></name> <name><surname>Tian</surname> <given-names>X.</given-names></name> <name><surname>Xiong</surname> <given-names>Q.</given-names></name> <name><surname>Xu</surname> <given-names>C.</given-names></name> <name><surname>Chen</surname> <given-names>L.</given-names></name> <name><surname>Wu</surname> <given-names>Y.</given-names></name></person-group> (<year>2021</year>). <article-title>Krill oil alleviated methamphetamine-induced memory impairment <italic>via</italic> the MAPK signaling pathway and dopaminergic synapse pathway.</article-title> <source><italic>Front. Pharmacol.</italic></source> <volume>12</volume>:<issue>756822</issue>. <pub-id pub-id-type="doi">10.3389/fphar.2021.756822</pub-id> <pub-id pub-id-type="pmid">34776973</pub-id></citation></ref>
<ref id="B46"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Russo</surname> <given-names>S. J.</given-names></name> <name><surname>Dietz</surname> <given-names>D. M.</given-names></name> <name><surname>Dumitriu</surname> <given-names>D.</given-names></name> <name><surname>Morrison</surname> <given-names>J. H.</given-names></name> <name><surname>Malenka</surname> <given-names>R. C.</given-names></name> <name><surname>Nestler</surname> <given-names>E. J.</given-names></name></person-group> (<year>2010</year>). <article-title>The addicted synapse: mechanisms of synaptic and structural plasticity in nucleus accumbens.</article-title> <source><italic>Trends Neurosci.</italic></source> <volume>33</volume> <fpage>267</fpage>&#x2013;<lpage>276</lpage>. <pub-id pub-id-type="doi">10.1016/j.tins.2010.02.002</pub-id> <pub-id pub-id-type="pmid">20207024</pub-id></citation></ref>
<ref id="B47"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Smiley</surname> <given-names>C. E.</given-names></name> <name><surname>Saleh</surname> <given-names>H. K.</given-names></name> <name><surname>Nimchuk</surname> <given-names>K. E.</given-names></name> <name><surname>Garcia-Keller</surname> <given-names>C.</given-names></name> <name><surname>Gass</surname> <given-names>J. T.</given-names></name></person-group> (<year>2021</year>). <article-title>Adolescent exposure to delta-9-tetrahydrocannabinol and ethanol heightens sensitivity to fear stimuli.</article-title> <source><italic>Behav. Brain Res.</italic></source> <volume>415</volume>:<issue>113517</issue>. <pub-id pub-id-type="doi">10.1016/j.bbr.2021.113517</pub-id> <pub-id pub-id-type="pmid">34389427</pub-id></citation></ref>
<ref id="B48"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Staff</surname> <given-names>J.</given-names></name> <name><surname>Schulenberg</surname> <given-names>J. E.</given-names></name> <name><surname>Maslowsky</surname> <given-names>J.</given-names></name> <name><surname>Bachman</surname> <given-names>J. G.</given-names></name> <name><surname>O&#x2019;Malley</surname> <given-names>P. M.</given-names></name> <name><surname>Maggs</surname> <given-names>J. L.</given-names></name><etal/></person-group> (<year>2010</year>). <article-title>Substance use changes and social role transitions: proximal developmental effects on ongoing trajectories from late adolescence through early adulthood.</article-title> <source><italic>Dev. Psychopathol.</italic></source> <volume>22</volume> <fpage>917</fpage>&#x2013;<lpage>932</lpage>. <pub-id pub-id-type="doi">10.1017/S0954579410000544</pub-id> <pub-id pub-id-type="pmid">20883590</pub-id></citation></ref>
<ref id="B49"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Turrigiano</surname> <given-names>G. G.</given-names></name> <name><surname>Leslie</surname> <given-names>K. R.</given-names></name> <name><surname>Desai</surname> <given-names>N. S.</given-names></name> <name><surname>Rutherford</surname> <given-names>L. C.</given-names></name> <name><surname>Nelson</surname> <given-names>S. B.</given-names></name></person-group> (<year>1998</year>). <article-title>Activity-dependent scaling of quantal amplitude in neocortical neurons.</article-title> <source><italic>Nature</italic></source> <volume>391</volume> <fpage>892</fpage>&#x2013;<lpage>896</lpage>. <pub-id pub-id-type="doi">10.1038/36103</pub-id> <pub-id pub-id-type="pmid">9495341</pub-id></citation></ref>
<ref id="B50"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Vasek</surname> <given-names>M. J.</given-names></name> <name><surname>Garber</surname> <given-names>C.</given-names></name> <name><surname>Dorsey</surname> <given-names>D.</given-names></name> <name><surname>Durrant</surname> <given-names>D. M.</given-names></name> <name><surname>Bollman</surname> <given-names>B.</given-names></name> <name><surname>Soung</surname> <given-names>A.</given-names></name><etal/></person-group> (<year>2016</year>). <article-title>A complement-microglial axis drives synapse loss during virus-induced memory impairment.</article-title> <source><italic>Nature</italic></source> <volume>534</volume> <fpage>538</fpage>&#x2013;<lpage>543</lpage>. <pub-id pub-id-type="doi">10.1038/nature18283</pub-id> <pub-id pub-id-type="pmid">27337340</pub-id></citation></ref>
<ref id="B51"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Veschsanit</surname> <given-names>N.</given-names></name> <name><surname>Yang</surname> <given-names>J. L.</given-names></name> <name><surname>Ngampramuan</surname> <given-names>S.</given-names></name> <name><surname>Viwatpinyo</surname> <given-names>K.</given-names></name> <name><surname>Pinyomahakul</surname> <given-names>J.</given-names></name> <name><surname>Lwin</surname> <given-names>T.</given-names></name><etal/></person-group> (<year>2021</year>). <article-title>Melatonin reverts methamphetamine-induced learning and memory impairments and hippocampal alterations in mice.</article-title> <source><italic>Life Sci.</italic></source> <volume>265</volume>:<issue>118844</issue>. <pub-id pub-id-type="doi">10.1016/j.lfs.2020.118844</pub-id> <pub-id pub-id-type="pmid">33278389</pub-id></citation></ref>
<ref id="B52"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname> <given-names>J.</given-names></name> <name><surname>Lai</surname> <given-names>S.</given-names></name> <name><surname>Li</surname> <given-names>G.</given-names></name> <name><surname>Zhou</surname> <given-names>T.</given-names></name> <name><surname>Wang</surname> <given-names>B.</given-names></name> <name><surname>Cao</surname> <given-names>F.</given-names></name><etal/></person-group> (<year>2020</year>). <article-title>Microglial activation contributes to depressive-like behavior in dopamine D3 receptor knockout mice.</article-title> <source><italic>Brain Behav. Immun.</italic></source> <volume>83</volume> <fpage>226</fpage>&#x2013;<lpage>238</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbi.2019.10.016</pub-id> <pub-id pub-id-type="pmid">31626970</pub-id></citation></ref>
<ref id="B53"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Wheal</surname> <given-names>H. V.</given-names></name> <name><surname>Chen</surname> <given-names>Y.</given-names></name> <name><surname>Mitchell</surname> <given-names>J.</given-names></name> <name><surname>Schachner</surname> <given-names>M.</given-names></name> <name><surname>Maerz</surname> <given-names>W.</given-names></name> <name><surname>Wieland</surname> <given-names>H.</given-names></name><etal/></person-group> (<year>1998</year>). <article-title>Molecular mechanisms that underlie structural and functional changes at the postsynaptic membrane during synaptic plasticity.</article-title> <source><italic>Prog. Neurobiol.</italic></source> <volume>55</volume> <fpage>611</fpage>&#x2013;<lpage>640</lpage>. <pub-id pub-id-type="doi">10.1016/s0301-0082(98)00026-4</pub-id></citation></ref>
<ref id="B54"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yamada</surname> <given-names>K.</given-names></name> <name><surname>Noda</surname> <given-names>Y.</given-names></name> <name><surname>Hasegawa</surname> <given-names>T.</given-names></name> <name><surname>Komori</surname> <given-names>Y.</given-names></name> <name><surname>Nikai</surname> <given-names>T.</given-names></name> <name><surname>Sugihara</surname> <given-names>H.</given-names></name><etal/></person-group> (<year>1996</year>). <article-title>The role of nitric oxide in dizocilpine-induced impairment of spontaneous alternation behavior in mice.</article-title> <source><italic>J. Pharmacol. Exp. Ther.</italic></source> <volume>276</volume> <fpage>460</fpage>&#x2013;<lpage>466</lpage>.</citation></ref>
<ref id="B55"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Yan</surname> <given-names>P.</given-names></name> <name><surname>Xu</surname> <given-names>D.</given-names></name> <name><surname>Ji</surname> <given-names>Y.</given-names></name> <name><surname>Yin</surname> <given-names>F.</given-names></name> <name><surname>Cui</surname> <given-names>J.</given-names></name> <name><surname>Su</surname> <given-names>R.</given-names></name><etal/></person-group> (<year>2019</year>). <article-title>LiCl pretreatment ameliorates adolescent methamphetamine exposure-induced long-term alterations in behavior and hippocampal ultrastructure in adulthood in mice.</article-title> <source><italic>Int. J. Neuropsychopharmacol.</italic></source> <volume>22</volume> <fpage>303</fpage>&#x2013;<lpage>316</lpage>. <pub-id pub-id-type="doi">10.1093/ijnp/pyz001</pub-id> <pub-id pub-id-type="pmid">30649326</pub-id></citation></ref>
<ref id="B56"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zeid</surname> <given-names>D.</given-names></name> <name><surname>Kutlu</surname> <given-names>M. G.</given-names></name> <name><surname>Gould</surname> <given-names>T. J.</given-names></name></person-group> (<year>2018</year>). <article-title>Differential effects of nicotine exposure on the hippocampus across lifespan.</article-title> <source><italic>Curr. Neuropharmacol.</italic></source> <volume>16</volume> <fpage>388</fpage>&#x2013;<lpage>402</lpage>. <pub-id pub-id-type="doi">10.2174/1570159X15666170714092436</pub-id> <pub-id pub-id-type="pmid">28714396</pub-id></citation></ref>
<ref id="B57"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname> <given-names>K.</given-names></name> <name><surname>Zhu</surname> <given-names>Y.</given-names></name></person-group> (<year>2019</year>). <article-title>The paraventricular thalamic nucleus: a key hub of neural circuits underlying drug addiction.</article-title> <source><italic>Pharmacol. Res.</italic></source> <volume>142</volume> <fpage>70</fpage>&#x2013;<lpage>76</lpage>. <pub-id pub-id-type="doi">10.1016/j.phrs.2019.02.014</pub-id> <pub-id pub-id-type="pmid">30772461</pub-id></citation></ref>
<ref id="B58"><citation citation-type="journal"><person-group person-group-type="author"><name><surname>Zhuang</surname> <given-names>S. M.</given-names></name> <name><surname>Chen</surname> <given-names>F.</given-names></name></person-group> (<year>2016</year>). <article-title>Chinese adolescents and youth with methamphetamine dependence: prevalence and concurrent psychological problems.</article-title> <source><italic>Nurs. Res.</italic></source> <volume>65</volume> <fpage>117</fpage>&#x2013;<lpage>124</lpage>. <pub-id pub-id-type="doi">10.1097/NNR.0000000000000141</pub-id> <pub-id pub-id-type="pmid">26938360</pub-id></citation></ref>
</ref-list>
</back>
</article>