This research was approved by the Ethics Committee of Zhejiang Xiaoshan Hospital (Hangzhou, China). A cohort of 30 patients with VaD at the Department of Neurology, Zhejiang Xiaoshan Hospital, and 12 healthy young and 22 healthy elder controls at the Department of Physical Examination Center, Zhejiang Xiaoshan Hospital were enrolled. All patients were Han Chinese and were recruited from November 2019 to January 2020. The patients with VaD were diagnosed by a neurologist based on the National Institute of Neurological Disorders and Stroke (NINDS)-Association Internationale pour la Recherche et I’Enseignement en Neurosciences (AIREN) clinical criteria (Román et al., 1993). Patients with VaD were scored with the clinical dementia rating (CDR), the Minimum Mental State Examination (MMSE) criteria and the Hachinski criteria (Table 1). The exclusion criteria were a history of a head injury with loss of consciousness, physical abnormalities, and meeting Diagnostic and Statistical Manual of Mental Disorders, the fourth edition (DSM-IV) criteria for substance dependence or current mood or anxiety disorders. In addition, patients administrated with anti-angiogenic medications for any indication were also excluded. All participants signed written informed consent.

Due to the time of blood drawing needed to accommodate the clinic and laboratory, all sample collection in this study were conducted between 9 a.m. and 11 a.m. Peripheral blood from all subjects was placed in a serum tube for 1 h, and the tubes were centrifuged at 3,000 × g for 10 min at 4°C. The supernatant was regarded as serum and stored at −80°C until detection.

The procedure of exosome preparation as described before with minor modification (Li et al., 2017). In brief, serum was melted in 37°C water bath and supplemented with 10 times the volume of phosphate-buffered saline (PBS) buffer. After filtration with 0.22 μm filter membrane, the supernatant was centrifuged at 100,000 × g overnight at 4°C (Optima-L80XP, Beckman Coulter, CA, United States). The supernatant was discarded carefully, then appropriate amount of PBS was added and centrifuged at 100,000 × g for 2 h. The obtained precipitate was exosome. The exosome samples were suspended in 20–30 μl PBS, and the morphology was observed using the Tecnai transmission electron microscopy (FEI, OR, United States) under 80 kV. The particle size of exosomes was detected with a ZetaView Nanoparticle Tracking Analysis (Particle Metrix, Meerbusch, Germany).

Differential gene expression was analyzed with RNA-sequencing assay. Exosome samples from healthy control and patients with VaD (n = 7 per condition) were used to isolate less than 200 nt RNA with miRNeasy Mini Kit (QIAGEN, Hilden, Germany). Sequencing libraries were built and transcriptome sequenced using a HiSeq 2000 (Illumina, San Diego, CA, United States). Agilent 2100 Bioanalyzer was chosen to analyze insert sizes in complementary DNA (cDNA) libraries. Gene expression data were evaluated on Dr. Tom system (BGI, Wuhan, China). Raw sequencing data are available in Supplementary material.

Total RNA from exosomes and tissues was extracted using TRIZOL reagent according to the manufacturer’s instruction (Takara) and was reverse-transcribed with a PrimeScript™ RT Reagent Kit (Takara). Real-time PCR was performed using SYBR Premix Ex Taq™ (Takara) with the LightCycler 480 System (Roche Diagnostics, Basel, Switzerland). Primer sequences were synthesized in Sangon Biotech (Shanghai, China) and listed in Table 1.

Male Sprague-Dawley rats were 18-month-old supplied by the Laboratory Animal Center of Hangzhou Medical College (SPF grade; Hangzhou, China). All animals were housed at 22–25°C and 40–60% humidity under a 12-h light/dark cycle. Rats were with free access to food and water. Efforts were made to minimize their suffering. The study procedures were carried out according to the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. The study protocol was approved by the Ethics Committee of Laboratory Animal Care and Welfare, Hangzhou Medical College. After adaptive feeding for a week, rats were randomly divided into sham group and VaD group.

The bilateral common carotid artery occlusion (BCCAO) rat model has been widely accepted as an experimental model of VaD (Leardini-Tristão et al., 2017, 2020). The procedures were carried out as previously reported (Leardini-Tristão et al., 2017, 2020). In brief, after rats were anesthetized with phenobarbital sodium (40 mg/kg, i.p.), the bilateral common carotid arteries were carefully isolated from the peripheral vagus nerve through a midline incision and double-ligated with surgical silk. Sham group was subjected to the same procedure, except that the bilateral common carotid artery was not ligated. The rats were kept on a heating pad at 38°C until recovery from anesthesia.

For cerebral blood flow monitoring, a laser speckle blood flow imaging system (SIM BFI-WF; SIM Opto-Technology Co., Ltd., Wuhan, China) was employed. The skin of the head was cut to expose the subdermal blood vessels. A thin circle of glass was inserted into the window frame, and cerebral blood flow velocity was detected before and after establishing of VaD rat model.

The Morris water maze (MWM) test was used to evaluate the spatial learning and memory of rats as previously reported with minor alteration (Xu et al., 2016). After 3 months of BCCAO operation, the rats began to place navigation test for 4 consecutive days. The pool was 1.2 m in diameter and height 0.6 m, and filled with water and opaque liquid maintained 24–26°C inside. The external visual reminder around the pool were kept constant, which helped for rats to spatial orientation. A platform (12 cm in diameter) was submerged 2.5 cm below the water surface in the northeaster quadrant. The animals received four trials per day. In each trial, rats were softly released into the water facing the tank wall at one of the four starting positions. The rats were permitted a maximum of 60 s to find the hidden platform. If the rats failed to find the hidden platform within the specified time, they were guided to the platform and allowed to stay for 15 s, and a score of 60 s was assigned. The escape latency was recorded to analyze the spatial learning. On the fifth day, a probe trial was carried out to assess spatial memory. Briefly, the rats were allowed to freely swim for 60 s in the pool from which the platform was removed, and the time spent in the target quadrant were recorded. The path taken by animals were monitored using a computer-based video camera, and the data was analyzed with the MT-200 image analyzing software (Taimeng Co., Chengdu, China).

Rats in both groups were sacrificed after the MWM test, and brain tissues were collected for pathological observation. Brain samples were incubated with 4% paraformaldehyde for 24 h at room temperature and were embedded in paraffin. After that, embedded brain paraffin sections were sliced into 5 μm section, then de-paraffinized with xylene and dehydrated with a graded concentration of ethanol. Nissl-stained sections were used to stain the section for 5 min. Representative pictures of Nissl-stained sections in the CA1, CA3, DG, and cortex regions were taken under a high-power optical microscope (Leica Microsystems, Wetzlar, Germany). The number of neurons was counted using ImageJ software (National Institutes of Health, Bethesda, MD, United States).

For immunofluorescence stain, angiogenesis in the brain tissues was detected using a monoclonal antibody CD31 (diluted 1:300; R&D System; Minneapolis, MN, United States), and Iba-1-positive microglial cells were evaluated using a rat antibody (diluted 1:200; Abcam, ab178846) followed by immunofluorescence staining using AlexaFluor 488 IgG antibody (Jackson ImmunoResearch; West Groove, PA, United States). Dapi (diluted 1:300; Beyotime, Shanghai, China) was used for nuclei staining. CD31-positive or Iba-1-positive stain were observed using a fluorescence microscope (Leica Microsystems, Wetzlar, Germany).

Apoptotic neurons were measured using a TUNEL Assay Kit (Wuhan Boster Biological Technology, Ltd., Wuhan, China) according to the manufacturer’s instructions. Briefly, brain samples were incubated with anti-neuronal nuclei antibody overnight at 4°C. Sections were then washed three times with PBS and incubated with TUNEL reaction mixture for 1 h at room temperature. Images of TUNEL-stained sections in the cortex were captured using a fluorescence microscope. TUNEL-positive neurons were quantitated using ImageJ software.

Serum from sham and VaD groups were collected for the measurement of oxidative stress-related biological parameters. The activities of malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase (GSH-PX) were determined with commercial kits according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The samples were analyzed in duplicate.

Brain tissue samples were analyzed for interleukin (IL)-1β, tumor-necrosis factor (TNF)-α, and myeloperoxidase (MPO) with commercial ELISA kits according to the manufacturer’s instructions (Anogen, Mississauga, ON, Canada). All readings were made from an ELISA plate reader. The samples were analyzed in duplicate.

Isolation and culturing of BM-EPCs were performed as previously described (Han et al., 2017a). To evaluate the ability of angiogenesis, Matrigel tube formation assay was performed. After 7 days of culture, BM-EPCs were replated into a 96-well plate, which was precoated with Matrigel (BD Biosciences; Bedford, MA, United States) with a concentration of 30,000 per 100 μl. Plate was incubated for 4–6 h at 37°C, images of tube morphology were captured using a microscope. Tube formation was assessed by counting tube numbers.

The ability of migration was estimated using a modified Boyden chamber assay as previously reported (Yu et al., 2016). Briefly, BM-EPCs were plated with a concentration of 30,000 per 100 μl on the upper chamber (8 μm pores), and cell-free medium containing 50 ng/ml VEGF (Sigma-Aldrich, Darmstadt, Germany) was added to the lower chamber of a 24-well Transwell plate (Corning; Lowell, MA, United States). The plate was incubated for 24 h at 37°C, and cells were then fixed with 2% paraformaldehyde and stained with Hoechst 33258 (Beyotime). The images were taken with a microscope. The migrated cells were counted using ImageJ software.

The adhesion assay was applied to assess the EPC function. A total of 30,000 cells were plated into a 96-well plate per well, which was precoated with the mouse vitronectin (1 μg/ml; Sigma). Cells were incubated for 2 h at 37°C, and non-adherent cells were carefully removed with PBS. Adherent cells were fixed with 2% paraformaldehyde and stained with Hoechst 33258. The stained cells were then assessed using a fluorescence microscope and counted with ImageJ software.

The concentrations of VEGF and stromal cell-derived factor-1α (SDF-1α) in culture medium were detected using commercial ELSA Kits (R&D System). The level of SOD was measured using a SOD Quantification Kit (Beyotime). The procedures were performed according to the manufacturers’ protocols. All samples were measured in duplicate.

Intracellular reactive oxygen species (ROS) level was measured with the membrane-permeable dye dihydroethidium (DHE; Invitrogen; Carlsbad, CA, United States). After 7 days cultivation, BM-EPCs were plated into 96-well plate and stained with DHE (2 μM) for 1 h at room temperature. Cells were gently washed with PBS twice to remove excess probe, and images were taken with a fluorescence microscope.

After 7 days of culture, BM-EPCs were transferred with adenovirus or Lipofectamine 3000 (Invitrogen) in M199 medium supplemented with 1% FBS for 36 h. The sequences of miR-154-5p inhibitor, negative control, and miR-154-5p mimics (GenePharma; Shanghai, China) were as follows (5′-3′): miR-154-5p inhibitor, CGAAGGCAACACGGAUAACCUA; negative control sense, UUCUCCGAA CGUGUCACGUTT; negative control antisense, ACGUGACACGUUCGG AGAATT; miR-154-5p mimics sense, UAGGUUAUCCGUGUUGCCUUCG; and miR-154-5p mimics antisense, AAGGCAACACGGAUAACCUAUU. After 36 h of quiescent culture, cells were used to functions assay and EPC transplantation assay.

After 5 days of culturing, BM-EPCs were labeled with 5-bromo-2′-deoxyuridine (BrdU; Thermo Fisher Scientific; Waltham, MA, United States) as previously described (Peng et al., 2018). In brief, endothelial growth medium-2 (EGM-2; Cambrex Corp; East Rutherford, NJ, United States) was used to dilute BrdU-labeled reagent (1:100), and the mixture was filtered with a 0.2 μm filter and heated to 37°C. A total of 2 ml of EGM-2 containing BrdU was added to cells that were plated in a six-well plate. On day 7, cells were washed with PBS for three times and harvested with 0.125% trypsin. Sprague-Dawley rat EPCs (400,000 cells) were transplanted into VaD rat via the tail vein. After 7 days of a single injection of EPCs, rats were sacrificed, and brain tissues were collected for immunofluorescence staining.

Data are expressed as mean ± SD. Statistical analysis was performed using one-way analysis of variance (ANOVA) with the Newman–Keuls multiple comparison test, and Student’s t-test for two group analysis. A value of p < 0.05 was considered to be statistically significant.

There were 52 participants included in this study, consisting of 30 (58%) patients with VaD and 22 (42%) healthy controls. The demographic and identity of these participators were summarized in Table 2. The extracellular vesicles derived from human serum were characterized using transmission electron microscopy, Nanoparticle Tracking Analysis, and Western blot assay. As shown in Figures 1A,B, the EVs were in the classical cup morphology of exosomes, and the particle size was in the range of 70–150 nm. Western blot analysis showed that the EVs expressed positive marker proteins of exosome, including Alix, CD63, and CD9, and did not express the glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a negative marker of exosome (Figure 1C). The results indicate that the EVs purified from human serum are qualified exosomes.

To explore whether the contents of exosomes were changed between patients with VaD and healthy controls, purify exosomes from seven normal subjects and seven patients with VaD who met the inclusion and exclusion criteria were selected to conduct miRNA library sequencing. Transcriptome analysis of miRNAs showed that a total of 598 mature miRNAs were detected, of which 33% were upregulated and 19% were downregulated both twice and more than twice high in VaD group compared with the control group (Figure 2A). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the genes targeted by these differentially expressed miRNAs were mainly enriched in blood vessel development, cellular migration, and cell adhesion signaling pathways (Figure 2B). This result indicates that the differentially expressed miRNAs may be involved in the regulation of cells, which possessed these biological functions. The miRNAs in VaD group that were upregulated by two times or more with statistical differences (p < 0.05) were chosen as the objects of study (Figure 2C), and specific change multiple is shown in Table 3. These 4 miRNAs were further verified in 15 normal subjects and 23 patients with VaD, and reverse transcription polymerase chain reaction (RT-PCR) results showed that miR-154-5p were significantly upregulated in the VaD group compared with the control group (p < 0.05, Figure 2D). Although there were no significant differences between control group and VaD group of miR-1294, miR-132-5p, and miR-155-5p (p > 0.05, Figures 2E–G). To further study the influence of aging on levels of miRNAs, 12 healthy young were recruited. The demographic and identity of healthy young and elder participators were summarized in Supplementary Table 1. There were no significant differences between young group and elder group for miR-154-5p, miR-1294, miR-132-5p, and miR-155-5p (p > 0.05, Supplementary Figure 1). These results suggest that miR-154-5p is confirmed to be significantly increased in serum exosomes of patients with VaD.

To evaluate the influence of miR-154-5p on VaD in brain tissue, BCCAO surgery was performed to induce VaD model. After 3 months of surgery, spatial memory was assessed by the MWM test, and TUNEL stain and Nissl stain were used to evaluate pathologic changes in the cerebral tissues of VaD rats. In the acquisition trials, VaD rats exhibited an obvious impairment in spatial learning, which was evidenced by longer latency time to reach the platform compared with sham group (p < 0.05, Figure 3A). In the probe trial, the trajectory chart showed decreased times in platform site crossings in VaD rats (Figure 3B). The analysis showed that the time spent in the target quadrant was greatly reduced in VaD rats compared with sham group (p < 0.05, Figure 3C). Moreover, as showed in Figures 3D,E, the number of TUNEL-positive cells was significantly increased in the cortex region of the VaD rats compared with sham rats (p < 0.05). Nissl staining revealed a marked neuronal injure evidenced by the disappeared Nissl bodies, and shrunken and deepened staining of cell bodies in the CA1, CA3, DG, and cortex region of VaD rats when compared to sham rats (p < 0.05, Figures 3F,G). In addition, representative images of cerebral blood flow before and after establishment of VaD model are showed in Figure 3H. The redder the color, the faster the blood flow, and the blue color indicates slow blood flow. The cerebral blood velocity decreased by 46.8% following BCCAO surgery was compared with before surgery (Figure 3I). The above results indicating a VaD rat model successfully established.

Levels of oxidative stress and inflammation in VaD rats were evaluated. VaD rats showed significantly higher serum MDA level, and lower SOD and GSH-PX levels than sham group (p < 0.05, Supplementary Figures 2A–C). Furthermore, the VaD rats exhibited more remarkable elevation of IL-1β, TNF-α, and MPO in cerebral tissues than sham rats (p < 0.05, Supplementary Figures 2D–F). Meanwhile, increased Iba-1-positive cells were confirmed by immunofluorescence staining of cortex sections from VaD rats (p < 0.05, Supplementary Figures 2G,H). These results suggest that levels of oxidative stress and inflammation are significantly increased in VaD rats.

To examine the expression of miR-154-5p in brain tissues and cellular, RT-PCR was performed. The expression of miR-154-5p was significantly increased in the hippocampus, cortex, and BM-EPC from VaD rats (p < 0.05, Supplementary Figure 2I), whereas there were no significant differences in microglia and astrocyte (p > 0.05, Supplementary Figure 2I), suggesting that miR-154-5p is likely involved in the development of VaD via endothelium.

Strong evidence demonstrates that cerebrovascular dysfunction links with VaD (Kalaria, 2018). Prior studies have reported that EPCs contribute to cerebral vascular repair disorders, such as AD and stroke (Bai et al., 2015; Zhang et al., 2018). To define the effect of miR-154-5p on EPC function in VaD rats, miR-154-5p inhibitor was used to knock down its expression. BM-EPCs were isolated from the VaD rats, and tube formation, migration, and adhesion ability were evaluated in vitro. BM-EPCs from VaD rats resulted in a significant decrease in the number of tubes (p < 0.05, Figures 4A,B), migration cells (p < 0.05, Figures 4C,D), and adhesion ability (p < 0.05, Figures 4E,F) compared with EPCs from sham group. miR-154-5p inhibitor significantly elevated tube formation, migration, and adhesion (p < 0.05, Figures 4A–F). In notice, miR-154-5p inhibitor markedly attenuated VaD-induced reduction of VEGF and SDF-1α concentrations in EPC from VaD rats (p < 0.05, Figures 4G,H).

Interestingly, miR-154-5p also potentially regulated adhesion molecules and oxidative stress. RT-PCR analysis revealed upregulated gene level expression of adhesion molecules, including ICAM-1, VCAM-1, and MCP-1, in BM-EPCs from VaD rats, whereas the miR-154-5p inhibitor significantly blunted the levels of these genes in BM-EPCs (p < 0.05, Figures 4I–K). Moreover, EPC from VaD rats showed a significant decrease of SOD, and miR-154-5p inhibitor dramatically increased the concentration of SOD in BM-EPCs (p < 0.05, Figure 4L). In agreement with this result, the miR-154-5p inhibitor effectively reduced production of ROS, as shown by DHE staining in EPC from VaD rats (p < 0.05, Figures 4M,N). In addition, we speculated the promising targets of miR-154-5p using miRDB, TargetScan 8.0, and miRNA.org PRKAA2, which could encode AMPKα2 was chosen as a potential target gene of miR-154-5p (Figure 4O). To prove that miR-154-5p could target AMPKα2, the protein expression of AMPKα2 was measured with Western blot. As shown in Figure 4P, the protein expression of AMPKα2 was remarkedly decreased in BM-EPCs from VaD rats compared with EPCs from sham group. The miR-154-5p inhibitor increased expression of AMPKα2 in BM-EPCs (Figure 4P). Taken together, these data indicate that inhibition of miR-154-5p was able to ameliorate EPC dysfunction in VaD rats, which may be associated with downregulated levels of adhesion molecules, oxidative stress, and AMPKα2 expression.

To further clarify the function of miR-154-5p on angiogenesis in VaD rats, we overexpressed miR-154-5p with RNA mimics in BM-EPCs. The overexpression of miR-154-5p alone markedly worsened EPC functions, reflected by reduced number of tubes, migration cells, and adhesion cells in rats compared with normal control group (p < 0.05, Figures 5A–F). Later, VaD rats were transplanted with BrdU-labeled EPCs, which were pretreated with miR-154-5p mimics or negative control, and immunofluorescent staining for endothelial cell-specific marker CD31 (green), followed by BrdU (red) were performed in the cortex of brain tissues. As shown in Figure 5G, some BrdU-positive cells were integrated into CD31-positive vessels in the cortex of VaD rats that received NC-EPC transplantation. However, the miR-154-5p-EPC transplantation showed little incorporation into cerebral angiogenesis of VaD rats (Figure 5G). Based on these results, miR-154-5p was sufficient to trigger poor angiogenesis in the brain of VaD rats.