The compounds Ionomycin calcium salt from Streptomyces conglobatus, Neurotensin, PD149163 tetrahydrochloride hydrate, SR48692 were purchased from Sigma Millipore, St Louis, MO, USA. Phosphate Buffered Saline was purchased from ThermoFisher, Waltham, MA, USA.

The mouse coding sequence of mouse Gαq was subcloned into pcDNA3.1 using Gibson assembly [New England Biolabs (NEB), Ipswich, MA, USA] with the following primers integrating the restriction sites NHE1-Xho1: mGq-Fwd: 5′-atacgactcactata gggagacccaagctggctagcgtttaaacttaagcttggtaccgc−3′. mGq-Rvs: 5′ -tccaccacactggactagtggatccgagctgaccagattgtactccttcaggttcagctg− 3′. The mouse coding sequence of NTSR1 was PCR amplified from pCMV6-mNTSR1 (Origene, Rockville, MD, USA) and subcloned upstream from the IRES feature with a STOP codon before IRES into pIRES (Invitrogen, Waltham, MA, USA) and pIRES-Venus vector previously described (Hamdan et al., 2005) resulting in expression of either untagged NTSR1 or NTSR1-Venus. Additionally, pcDNA3.1-RlucII vector previously described (Namkung et al., 2016) using Gibson assembly with the following primers integrating the restriction site BamHI for both pIRES and pcDNA3.1: pIRES-mNTSR1-fwd: 5′-tatctgcggcctagctagccaccaggatccgccaccatgcacctcaacagctccgtgcagc aggga−3′ for both pIRES constructions. pIRES-mNTSR1-rvs: 5′-gcccttgctcaccatggtggcgatggatccttagtacagggtttcccgggtggcgctgg t−3′. pIRES-mNTSR1-Venus-rvs: 5′-gcccttgctcaccatggtggcgatg gatccgtacagggtttcccgggtggcgctggtgga−3′. pcDNA3.1-mNTSR1-RlucII-fwd: 5′-atagggagacccaagctggctagcggatccgccgccgcgatcgcc atggaagatgatggt−3′. pcDNA3.1-mNTSR1-RlucII-rvs: 5′ gat ggcgcgcccaccggtaccggcggatccgtccacaagggtttcttgactatagggaat−3′. The pIRES vector was used The rGFP-CAAX BRET and G_q GEMTA biosensors construct were generated as previously described (Namkung et al., 2016; Avet et al., 2022).

HEK293 clonal cell line (HEK293SL cells), hereafter referred as HEK293 cells, were a gift from S. Laporte (McGill University, Montreal, Quebec, Canada) and previously described (Namkung et al., 2016). Cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM, Wisent, Saint-Jean-Baptiste, QC, Canada) supplemented with 10% fetal bovine serum (FBS, Wisent) and 1% antibiotics [100 U/mL penicillin and 100 μg/mL streptomycin (PS); Wisent]. Cells were grown at 37°C in 5% CO2 and 90% humidity and checked for mycoplasma contamination. Two days prior to experiments, cells were trypsinized (Wisent) and 35,000 cells were transfected with 1 μg of total DNA containing the appropriate expression vectors/biosensors. The total quantity of DNA was completed at 1 μg with salmon sperm DNA (Invitrogen, Waltham, MA, USA). Transfection was performed using the transfecting agent polyethylenimine 25 kD linear (PEI; Polysciences, Warrington, PA, USA) at a ratio of 3:1 PEI/DNA. Cells were then immediately plated onto poly-ornithine (Sigma-Aldrich) coated 96-well white culture plates (PerkinElmer, Waltham, MA, USA).

Forty-eight hours post-transfection, cells were washed once with phosphate-buffered saline (PBS) then incubated 1 h at 37°C in Tyrode buffer (137 mM NaCI, 0.9 mM KCI, 1 mM MgCI2, 1 1.9 mM NaHCO3, 3.6 mM NaH2PO4, 25 mM HEPES, 5.5 mM Glucose, and 1 mM CaCI2, pH 7.4). Cells were then treated with the ligands and prior to measurement treated with the substrate (5 min with 2.5 μM Coelantarazine 400a). Bioluminescence resonance energy transfer (BRET) was then measured between RlucII (BRET energy donor) and rGFP (enhanced bystander ebBRET acceptor)–tagged proteins. BRET values were read for 1 s per well using a Mithras™ LB940 Multimode Microplate Reader (Berthold Technologies, Bad Wildbad, Germany) for concentration–response curves. ebBRET values were obtained by calculating the ratio of the light emitted by the energy acceptor over the light emitted by the energy donor (donor 410 ± 70 nm/acceptor 515 ± 20 nm). Data were collected using the MicroWin 2000 software (Berthold Technologies, Bad Wildbad, Germany). They were then fitted and analyzed in GraphPad Prism (v9.0, GraphPad Software, Inc., San Diego, CA, USA).

The NTSR1-Venus mouse line was established by PHENOMIN at the MCI/ICS [Mouse Clinical Institute–Institut Clinique de la Souris (ICS), Illkirch, France¹ ]. The targeting vector was constructed as follows (Figure 2A). A 3.5 kb fragment encompassing exon 2, intron 2, exon 3, and partial intron 3 of Ntsr1 was amplified by PCR (from RP23-299O18 BAC containing Ntsr1) and subcloned in an ICS proprietary vector. This ICS vector bares a floxed Neomycin resistance cassette associated with a Cre autoexcision transgene that will allow the excision of the whole cassette in the chimera’s male germ line. Three fragments of 784 bps for the linker-Venus fragment, 730 bps for the partial intron 3-exon 4 fragment and 3619 bps for the end of exon 4 (3′UTR) and surrounding genomic region were amplified by PCR and subcloned by SLIC cloning in step 1 plasmid to generate the final targeting construct. The linearized construct was electroporated in C57BL/6N mouse embryonic stem (ES) cells (ICS proprietary line). After G418 selection, targeted clones were identified by long-range PCR and further confirmed by Southern blot with an internal (Neo) probe and a 5′ external probe. Two positive ES clones were validated by karyotype spreading and microinjected into BALB/C blastocysts. Resulting male chimeras were bred with wild type C57BL/6N females. Germline transmission with the direct excision of the selection cassette was achieved in the first litter.

Ntsr1^Venus/WT mice were intercrossed to generate Ntsr1^Venus/Venus mice, which are fertile and develop normally. Ntsr1^WT/WT, Ntsr1^Venus/WT, and Ntsr1^Venus/Venus mice were bred in-house (Neurophenotyping Center, McGill University/Douglas Hospital Research Institute, Montreal, Canada) on a C57Bl/6N (Charles River Laboratories, Wilmington, MA, USA) background. Animals were group-housed and maintained on a 12-h light/dark cycle (lights on at 8:00 a.m.) at a controlled temperature (22 ± 1°C) and humidity (45 ± 5%). Food and water were available ad libitum throughout all experiments, unless otherwise stated. Male and female mice between 8 and 14 weeks were used for immunohistochemistry, and male mice 8–16 weeks were used for behavior experiments. All experimental procedures were performed in accordance with the guidelines of the Canadian Council of Animal Care, and all animal procedures were approved by the McGill University/Douglas Hospital Animal Care Committee. All animals were routinely genotyped at weaning and after experimental endpoints using the following genotyping primers: Forward 5′-GCTAAGCATGACTCAGGCTCCCAG-3′ Reverse 5′-GATCTTAACTCCCATCTCCAGGCAAC-3′ which produced the following sized bands for each genotype: bp 299–Ntsr1^WT/WT, 394 bp—Ntsr1^Venus/Venus mice, both bands are visible for Ntsr1^Venus/WT. For multiphoton experiments, animals were bred and housed at UCSF and cared for by Laboratory Animal Resource Center Staff following Institutional Animal Care and Use Committee approved protocol (AN185688).

RNA was collected using freshly dissected brains on ice, brains were severed along the midline and hemispheres were immediately frozen on dry ice and stored at −80°C until use. TRIzol (Invitrogen, Waltham, MA, USA) reagent was added directly into the collected sample tubes. Mechanical dissociation was applied to yield a homogenate and tissue extraction was done according to the manufacturer’s protocol. The precipitate carrier, Dr. Gentle (Takara, Kusatsu, Shiga, Japan), was added to visualize RNA pellets. RNase-and DNase- free water was used to resuspend the Total RNA (ThermoFisher, Waltham, MA, USA). Purity and concentration of total RNA was evaluated on a NanoDrop ND2000 (ThermoFisher, Waltham, MA, USA).

RT-qPCR was performed as described previously (Ehrlich et al., 2019, 2021). M-MLV Reverse Transcriptase Kit (Invitrogen, Waltham, MA, USA) reverse transcribed 400 ng of RNA according to the manufacturer’s instructions. cDNA was diluted 2 times in RNase- and DNase-free water. 2 μl of cDNA together with forward and reverse primers (0.5 μM each primer) and 5 μl of LightCycler 480 SYBR I Green Master Mix (Roche, Basel, Switzerland) was used. cDNA samples were loaded in 384-well white polypropylene plates (Roche, Basel, Switzerland) in triplicates. Samples were run for 45 cycles of amplification on the LightCycler 480 II Real-Time PCR System (Roche, Basel, Switzerland). Water, in place of cDNA, served as a no template control reaction to check for non-specific amplification. Tyrosine hydroxylase (Th) expression was used to validate VTA specific samples. Samples with low Th expression were excluded from the analysis. The average of housekeeping gene B2m, was subtracted from the average of the triplicate CT values for each sample. Relative fold changes were obtained using the comparative CT method (2^–ΔΔCT) (Livak and Schmittgen, 2001) and multiplied by 100 to show the data in percent.

To isolate hippocampal neurons, P0 pups were removed from the cage of NTSR1-Venus homozygous knock-in breeding pairs. Pups were decapitated, brains were removed dorsal side up into fresh ice-cold Hank’s balanced salt solution (HBSS; Gibco, Grand Island, NY, USA), meninges were removed, and hippocampi were dissected into Hibernate A (Gibco, Grand Island, NY, USA) on ice. Tissue dissociation was carried out with the Papain Dissociation System according to the manufacturer’s protocol (Worthington Biochemical Corporation, Lakewood, NJ, USA). Neurons were plated on Poly-D-Lysine (Sigma) coated surfaces at 100,000 cells per 12 mm coverslip (NeuVitro, Camas, WA, USA) in a 24-well plate for immunostaining or 50,000 cells per well of an 8 well chamber slide (Ibidi, Grafelfing, Germany) for calcium measurements. Plating media [Neurobasal A (Gibco, Grand Island, NY, USA), 1% FBS (Fisher Scientific), 2% B-27 (Gibco, Grand Island, NY, USA), 0.5 mM GlutaMAX (Gibco, Grand Island, NY, USA), and 1x Penicillin/Streptomycin (Invitrogen, Waltham, MA, USA)] was exchanged 1 h after plating to maintenance media (Neurobasal A, 2% B-27, 0.5 mM GlutaMAX, and 1x Penicillin/Streptomycin). Half of the volume of media was exchanged for fresh media every 3–4 days. On day in vitro (DIV) 3 Cytosine arabinoside hydrochloride (Sigma) was added to media with a final concentration of 0.1 μM to decrease glial cell proliferation.

Hippocampal neurons were grown until DIV 7. Fluo-4 NW Calcium Assay kit (Thermo Fisher) was used according to the manufacturer’s protocol. Briefly, drugs were prepared at 4 μM stock solutions in the assay buffer provided without probenecid. Growth media was removed and 150 μL of the dye loading solution was added to each well. Imaging dishes were incubated at 37°C without added CO₂ for 30 min and then a further 30 min at room temperature. Fluorescence was imaged with a 10x objective on an (Olympus, Shinjuku City, Tokyo, Japan) IX73 microscope (Fluo-4 em. 506 nm).

Live imaging settings of Fluo-4 were as follows, 79 ms exposure, 2 s intervals for 90 cycles (180 s). 50 μL of drug for a final concentration of 1 μM was added at cycle 20 (40 s). Data analysis was performed using FIJI Image J as follows. First regions of interest (ROI) were automatically determined using the analyze particles plug in. Then integrated density was obtained for all ROIs across all 90 images. For each agonist treated well ∼200 cells were examined to identify cells with activation between 40 and 60 s. For vehicle treated wells, all Fluo4-loaded cells were included in the analysis. Relative fluorescence is defined as F/F₀ where F corresponds to the cell fluorescence and F₀ to the basal fluorescence.

Hippocampal neurons from Ntsr1^Venus/Venus animals were cultured on PDL coated coverslips (NeuVitro, Camas, WA, USA) in a 24 well plate until DIV7. Drugs were prepared in Neurobasal A without serum or antibiotics. 1 mL of drug or vehicle containing media was added to the neurons and they were returned to the incubator for the indicated times (0, 5, 10, 20, or 60 min). All media was aspirated, and neurons were fixed in 4% paraformaldehyde (PFA; Electron Microscopy Sciences, Hatfield, PA, USA)/PBS pH 7.4 (ThermoFisher, Waltham, MA, USA) for 10 min at room temperature. Permeabilization followed in 0.1% Triton X-100/PBS (Sigma-Aldrich) for 10 min at room temperature. Coverslips were blocked in 1x PBS, 3% NGS, and 0.2% Triton X-100 (Sigma-Aldrich) for 1 h at room temperature. Primary antibodies chicken Anti-Venus (GFP, Novus, St Louis, MO, USA, 1:2000) and rabbit Anti-EEA1 (Cell Signaling Technology, Danvers, MA, USA, 1:1000) were diluted with blocking buffer and incubated overnight. Three washes with 0.1% Triton X-100/PBS were followed by secondary antibody incubation for 1 h at room temperature (Alexa 488 Anti Chicken 1:2000—Life Technologies and Alexa 647 Anti-Rabbit 1:2000—Life Technologies). Coverslips were washed in PBS and then incubated in DAPI (ThermoFisher, Waltham, MA, USA)/PBS and washed in PBS before mounting with Prolong Gold (ThermoFisher, Waltham, MA, USA) and drying overnight. An Olympus FV1200 confocal microscope with oil-immersion 60 × objective, was used to take z-stack images with laser settings–Alexa Fluor 488 Ex. 488/Em. 520 Alexa Fluor 647 Ex. 650/Em. 668.

For live imaging experiments, DIV6 neurons cultured on 8 well slide chambers (ibidi, Grafelfing, Germany) were transferred to incubators at the ABIF Imaging facility McGill University to acclimate overnight. DIV7 neurons were imaged at room temperature in phenol-red free cell imaging media (Thermo Fisher) with a 63x objective (Zeiss, Oberkochen, Germany) on an LSM710 microscope (Leica, Wetzlar, Germany). Venus was detected at Ex. 514 nm/Em. 528 nm. Microscope was set as follows, Line average 4, Gain 900, Zoom 2 with 3.87 s scan time. Movies were taken for 20 min with 30 s intervals. Drug or vehicle was diluted in cell imaging media and was added at 1 min.

Three animals of each genotype, homozygous wild type Ntsr1-^WT/WT, heterozygous knock-in Ntsr1-^Venus/WT, and homozygous knock-in Ntsr1-^Venus/Venus were perfused at around 8 weeks old. The mice were anesthetized with 100 μl/100 g i.p. rodent cocktail mixture (ketamine, xylazine, acepromazine) intracardially cleared with ice cold 1x PBS, followed by 5 min with ice-cold 4% PFA (Cedarlane, Burlington, ON, Canada) using a peristaltic pump at 10 ml/min. The brains were then extracted and post-fixed in 4% PFA for 24 h, at 4°C. Then, the samples were cryo- protected in 30% sucrose (Thermo Fisher) for 24–48 h. Finally, the brains were stored in OCT (Thermo Fisher) at −80°C until processing. Brains were sliced on a Leica CM3050s cryostat at 30 μm thick, coronally, and stored free floating in 1x PBS at 4°C for storage. Sections were then washed in PBS-T (0.1% Triton X-100) to permeabilize the tissue, before blocking with 3% normal goat serum for 1 h at room temperature. Primary antibodies used included Chicken Anti-Venus (GFP, Novus, St Louis, MO, USA, NB100-16-17, 1:2000), Rabbit Anti-Tyrosine Hydroxylase (Abcam, Cambridge, UK AB112, 1:1000), Rabbit Anti-Dopamine-Beta-hydroxylase (Immunostar, Hudson, WI, USA 22806, 1:400), and were applied and incubated overnight at 4°C. There were 3 washes in PBS-T before addition of secondary antibodies; Goat Anti-Chicken Alexafluor 488 (Life Technologies A11039, 1:2000), Goat Anti- Chicken Alexafluor 594 (Life Technologies A11042, 1:2000), and Goat Anti-Rabbit Alexafluor 594 (Life Technologies A11012, 1:2000). These were incubated for 2 h at room temperature. The secondary antibody was then removed, before washing was done with PBS-T, followed by a PBS + DAPI wash to stain nuclei before a final wash in PBS and storage at 4°C before mounting.

For subcellular localization of NTSR1-Venus, confocal images were acquired on a laser scanning Olympus FV1200 microscope (Olympus Corporation, Shinjuku City, Tokyo, Japan) at 20x and 40x for higher magnification images. All images were acquired as Z-stacks and maximum projections of the original Z-stack are shown. Confocal imaging was done with the following laser settings, Alexa Fluor 488 Ex. 488/Em. 520, Venus Ex. 518/Em. 543, Alexa Fluor 594 Ex. 543/Em. 618.

For whole brain imaging, fixed, permeabilized, and stained 30 μm coronal sections were taken at intervals of 360 μm. Sections were imaged on an Olympus VS120 slide scanner at 10x objective Intrinsic Venus detected using FITC (Ex. 490 nm, Em. 520 nm) and amplified Venus detected using TRITC (Ex. 535 nm, Em. 590 nm). To map the expression of NTSR1-Venus, 92 brain regions were assessed for NTSR1-Venus according to the Allen Brain Interactive Atlas Viewer² categorization. NTSR1-Venus expression level was assessed using the amplified signal (Anti-Venus). Exposure was first adjusted based on the region of highest signal (VTA) and the same scaled exposure setting was applied to each section. Qualitative expression analysis was ranked in 4 categories, none (0), low (1), moderate (2), and high (3). The final regional expression score is representative of the average of the expression observed in three independent Ntsr1^Venus/Venus animals.

3D reconstructions of whole brain were done as follows. Images taken on a slide scanner (Olympus, Shinjuku City, Tokyo, Japan) were imported to FIJI (Schindelin et al., 2012) #3981 using the Olympus viewer plugin (Olympus, Shinjuku City, Tokyo, Japan) and concatenated into a stack. The individual sections were then imported into photoshop (Adobe, San Jose, CA, USA) to align them in 3D format and remove any artifacts manually and then exported back into FIJI for 3D reconstruction. The stack was then converted into a 3D stack with the 3D projection plugin with a 50 pixel gap on a 1024 × 1024 canvas and exported as .avi.

Male and female Ntsr1^Venus/Venus mice aged 5 weeks were anesthetized, and 250 μm-thick coronal slices containing substantia nigra pars compacta and ventral tegmental area were prepared. Cutting solution contained (in mM): 87 NaCl, 25 NaHCO₃, 25 glucose, 75 sucrose, 2.5 KCl, 1.25 NaH₂PO₄, 0.5 CaCl₂, and 7 MgCl₂; bubbled with 5% CO₂/95%O₂; 4°C. Following cutting, slices were incubated in the same solution for 30 min at 33°C. For control experiments, slices were subsequently incubated in the same solution at room temperature until imaging. For antagonist experiments, slices were subsequently incubated in cutting solution with 1 μM SR48962 until imaging. SR48962 was prepared as a 1 mM stock in water.

Imaging solution referred to as aCSF contained (in mM): 125 NaCl, 2.5 KCl, 2 CaCl₂, 1 MgCl₂, 25 NaHCO₃, 1.25 NaH₂PO₄, 25 glucose; bubbled with 5% CO₂/95% O₂; 31–34°C, ∼310 mOsm. For antagonist-only experiments, 1 μM SR48962 was added to the imaging solution. For antagonist plus agonist experiments, a baseline image was taken with no NTSR1 agonist or antagonist in the imaging solution, and subsequently, 10 μM PD149163 [prepared from a stock solution in water] was added to the imaging solution. As a precautionary measure, all components that were exposed to antagonist were rinsed first with 70% ethanol and then water. All components that were exposed to agonist were replaced between experiments.

For two-photon laser scanning microscopy (2PLSM), a 2-photon source (Coherent Ultra II, Santa Clara, CA, USA) was tuned to 920 nm for imaging. Epi- and transfluorescence signals were captured through a 60x, 1.0 NA objective, paired with a 1.4 NA oil immersion condenser (Olympus, Shinjuku City, Tokyo, Japan). Epifluorescence was acquired without bandpass filtering; transfluorescence was captured through a 550/49 nm bandpass filter (Semrock). Both epi and transfluorescence were detected with R9110 photomultiplier tubes (Hamamatsu, Shizuoka, Japan). Laser power measured at the focal plane under the objective was between 8 and 34 mW. NTSR1 localization images were acquired through Z-stacks taken in 1 μm steps every 15 min.

Locomotor activity was measured using Plexiglas activity boxes (20 × 20 × 20 cm) surrounded by horizontal and vertical infrared sensor beams (Versamax Omnitech Electronics, Columbus, OH, USA) during the light phase. The total numbers of animals used in locomotion experiments were n = 16 Ntsr1^Venus/Venus and n = 15 Ntsr1^WT/WT mice. Animals were habituated to the room in singly housed cages with home bedding for 1 h, before being injected with either 0.9% saline, 0.2, 0.5, 1, 5 mg/kg, PD149163, dissolved in 0.9% saline, and returned to their home cages for 30 min. Then mice were placed in horizontally opposed chambers, and horizontal movement (cm) was measured over the course of 2 h, in bins of 10 min.

All images were viewed and analyzed using FIJI ImageJ (Schindelin et al., 2012). Statistical comparisons were carried out using GraphPad Prism. For BRET assays, Mann–Whitney unpaired T tests were used. For qPCR 2way ANOVA with Dunnett’s multiple comparisons test was used. Endocytosis in neurons and locomotor assays were analyzed by 2way ANOVA with Sidak’s or Bonferroni’s multiple comparisons test. Endocytosis in acute slices was analyzed by 2way ANOVA with Tukey’s multiple comparisons test. Differences were considered significant if P was less than 0.05.

We first compared the ability of both neurotensin and PD149163 to induce NTSR1 internalization. We set-up an enhanced bystander bioluminescence energy resonance transfer (ebBRET) assay by fusing RlucII at the NTSR1 C-tail and expressing this construct together with rGFP-CAAX in HEK293 cells (Figure 1A). Using this assay, we monitored the NTSR1-RlucII internalization induced by both neurotensin and PD149163 by measuring the decrease in BRET between the RlucII donor and the rGFP acceptor (Figure 1B). Both compounds were able to induce NTSR1 internalization with significantly different potency (5.89 nM and 307 nM for neurotensin and PD149163, respectively, p = 0.0079) and efficacy (−0.180 and −0.245 for neurotensin and PD149163, respectively, p = 0.0159; Table 1).

To test the functionality of the NTSR1-Venus construct used to generate the knock-in mice, the NTSR1 receptor was genetically fused to the fluorescent protein, Venus-YFP (Venus), at its C-tail. With another ebBRET assay, we compared its property to activate Gq with that of the wild-type (WT) NTSR1 by expressing in HEK293 cells either receptor, together with Gq effector membrane translocation assay; EMTA (Avet et al., 2022) effector, p63RhoGEF, tagged with RlucII and rGFP-CAAX. Using this assay, we monitored the increase in BRET transduction to assess the ability of both neurotensin and PD149163 to activate Gq, which leads to a relocalization of the Gq EMTA effector to the plasma membrane decorated on its intracellular face with rGFP-CAAX (Figure 1C). Neurotensin and PD149163 induced activation of Gq by both receptors (Figures 1D,E). For the untagged and WT receptors neurotensin and PD149163 have significantly different potencies to activate Gq with EC50s of 1.65 nM and 30.6 nM (p = 0.0079) respectively, for WT-NTSR1 and 1.08 nM and 28.0 nM (p = 0.0079), for NTSR1-Venus (Table 1). When we compared efficacy for neurotensin and PD149163 at each receptor, both compounds produced similar efficacies at a given receptor (0.248 and 0.220, respectively, for NTSR1 with p = 0.0556 vs. 0.435 and 0.476, respectively, for NTSR1-Venus with p = 0.222). However, the efficacies of the compounds at NTSR1-Venus were higher when compared to WT-NTSR1. Together, these data show that agonist-promoted receptor internalization and Gq activation are maintained for the C-tail modified NTSR1 (NTSR1-Rluc or NTSR1-Venus) with the expected potency differences between the compounds tested.

Next, we created NTSR1-Venus knock-in mice to study NTSR1 localization and activity in native neurons and the brain. Ntsr1^Venus/Venus animals were generated using homologous recombination (Figure 2A). A sequence encoding NTSR1 encompassing the linker-Venus fragment in frame with the open reading frame of NTSR1 at exon 4 was used to generate the targeting vector that included a floxed Neomycin resistance gene, which was later excised in the chimera’s male germ line (see Section “Materials and methods” for more details). To characterize the new animals, Ntsr1 mRNA levels were measured in brain regions which were previously reported (Alexander and Leeman, 1998) to highly express Ntsr1 and no significant alteration in Ntsr1 levels was found between Ntsr1^Venus/WT or Ntsr1^Venus/Venus as compared to Ntsr1^WT/WT animals (Figure 2B). Venus transcript levels were detected in a gene-dose-dependent fashion in the prefrontal cortex, ventral tegmental and substantia nigra areas but not detected in the habenula (Figure 2C). Although habenula had been previously determined to highly express Ntsr1 using in situ hybridization in rat (Nicot et al., 1994; Alexander and Leeman, 1998), we failed to detect a high transcript level in this region for all genotypes of mice examined.

To examine NTSR1-Venus functionality, we evaluated NTSR1-Venus expression and agonist mediated redistribution in different neuronal preparations (hippocampal, cortical and midbrain; data not shown) and while NTSR1-Venus in all the preparations responded to the drug, we determined that expression was best detectable in hippocampal cultures. In mouse hippocampal neurons live imaged on an epifluorescent microscope, we first examined G protein signaling by measuring agonist-induced intracellular calcium levels using the calcium indicator, Fluo-4-AM. In both Ntsr1^WT/WT (Figure 2D) and Ntsr1^Venus/Venus (Figure 2E) neurons, vehicle did not elicit a calcium response while 1 μM Ionomycin, included to determine maximal calcium response in our experimental setting, induced a 3-fold calcium increase. 0.1 and 1 μM PD149163 induced a 2-fold intracellular calcium peak increase that was observed for Ntsr1^WT/WT (Figure 2D) and Ntsr1^Venus/Venus (Figure 2E) neurons indicating that the Venus fusion receptor can couple to Gq and elicit a calcium response.

Receptor endocytosis has often been used as a metric to distinguish drug activities. We next measured agonist-induced endocytosis in primary hippocampal cultures from Ntsr1^Venus/Venus animals. Live confocal imaging of NTSR1-Venus neurons treated with 1 μM PD149163 showed robust internalization of the receptor (Supplementary Video 1). Whereas NTSR1-Venus remained diffuse across the plasma membrane in vehicle treated neurons (Supplementary Video 2). To quantify receptor endocytosis, hippocampal neurons were treated with either PD149163 or neurotensin for 5, 10, 20, or 60 min, fixed, permeabilized and stained for Venus (GFP) or an early endosome marker (EEA1) and then imaged on a confocal microscope. We quantified receptor endocytosis by measuring the ratio of Venus and EEA1 positive to total EEA1 positive endosomes. Dose-response curves following 5 min of agonist treatment showed an expected lower potency for PD149163 when compared to neurotensin (EC50, 4.03 nM and 465 nM for neurotensin and PD149163, respectively, Figure 2F), demonstrating that monitoring endogenous NTSR1-Venus receptor endocytosis could differentiate NTSR1 agonists. Since the two agonists elicited a similar response at a 1 μM concentration, we used this concentration to evaluate the kinetics of receptor endocytosis. Time-dependent changes in receptor distribution demonstrated that NTSR1-Venus redistribution to endosomes was rapid, occurring within the first 5 min (98.5% ± 1.29 or 92.7% ± 6.9 for neurotensin and PD149163, respectively) of agonist treatment (Figure 2G). Whereas neurotensin-induced endocytosis began decreasing after 10 min, the amount of NTSR1-Venus detected in early endosomes from neurons treated with PD149163 remained stable, leading to a significantly higher percentage of endosomes containing NTSR1 after 60 min (Figures 2G,H). Together, these results demonstrate distinct potencies and kinetics of the two agonists on NTSR1-Venus receptor internalization which is detectable in living neurons.

Having established evidence supporting functional NTSR1-Venus receptor signaling (Gq/Ca2+) and receptor endocytosis we next evaluated behavioral responses in these animals. Previous reports have demonstrated that systemic administration of NTSR1 agonists induces hypolocomotion (Vadnie et al., 2014). First, when animals were not yet habituated to the activity chambers and only received saline injections, we observed somewhat higher activity counts for Ntsr1^Venus/Venus compared to Ntsr1^WT/WT animals (Supplementary Figure 1). Upon intraperitoneal administration of the brain penetrable Ntsr1 agonist, PD149163, for both genotypes we saw a dose-dependent decrease in total distance traveled over 2 h as compared to saline animals. A significant difference at 0.2 mg/kg and a trend that was not significant at higher doses (0.5, 1, or 5 mg/kg) was observed between Ntsr1^Venus/Venus and Ntsr1^WT/WT animals (Figure 2I). Notably, saline responses in mice already habituated to the activity chambers were similar in Ntsr1^Venus/Venus and Ntsr1^WT/WT animals. We next used 0.5 mg/kg since it was the lowest concentration of PD149163 capable of inducing the hypolocomotor effect without significant differences between genotypes. In this cohort, 0.5 mg/kg PD149163 induced NTSR1 mediated hypolocomotion to a similar extent in Ntsr1^Venus/Venus and Ntsr1^WT/WT animals albeit with a statistically insignificant slower onset (Figure 2J) but comparable total distance traveled (Figure 2K). These data suggest that NTSR1-Venus signaling, and function appear essentially intact, with however slightly lower responses to agonist treatment.

Once NTSR1-Venus animals were found to have functional receptors, we next examined where NTSR1-Venus is observable in tissues. To this end, we fixed, permeabilized and stained adult tissue sections for Venus (Anti-Venus) in a separate channel from Venus to be able to compare the intrinsic (non-amplified) (Figure 3A) and amplified NTSR1-Venus (Figure 3B) signals between Ntsr1^Venus/Venus, Ntsr1^Venus/WT to the background level in Ntsr1^WT/WT animals (Supplementary Figure 2). At regional level, NTSR1 expression in olfactory, cortical, septal, hippocampal, thalamic, and midbrain nuclei were already observable using the Venus-intrinsic fluorescent signal and was further enhanced with antibody-amplified signal. We collected samples from 16 peripheral tissues including liver, heart, intestine, stomach, and colon but NTSR1-Venus was not reliably detected in any of the collected sections (data not shown). We also collected various central nervous system tissues including dorsal root ganglion and trigeminal ganglion. Intrinsic and amplified NTSR1-Venus was weakly detected in trigeminal ganglion and only amplified signal was detected in dorsal root ganglion (data not shown).

At regional level, slide scanner imaged brain sections were utilized to fully reconstruct the whole brain in 3D revealing the most prominent expressing regions in cortex, thalamus and midbrain (Supplementary Video 3). For a detailed analysis of NTSR1-Venus at regional brain level, amplified fluorescent signal was semi-quantified across 92 regions (Table 2). The regions with moderate to high expression include the cortical layer 6 where NTSR1 is visible throughout the brain, and all cortical layers in the infralimbic area (IFL) of the prefrontal cortex (PFC), the gustatory cortex (GuCtx), and hippocampal areas including CA1. NTSR1 expression was also high in thalamic nuclei including anterior groups of the dorsal thalamus (ATN) and medial geniculate (MG). Midbrain areas comprising dorsal raphe nucleus (DR), substantia nigra (SN), and ventral tegmental area (VTA) also contained high NTSR1 expression. Finally, striatal related areas consisting of medial septum (MS) and olfactory areas like the nucleus of the lateral olfactory tract (NLOT), accessory olfactory bulb (AOB), and cortical amygdalar area (COA) also contained higher levels of NTSR1-Venus fluorescence than other brain regions examined.

To examine subcellular expression, we imaged amplified sections on a confocal microscope (Figure 3C). We observed two types of NTSR1-Venus expression patterns which we categorized as cell bodies/dendrites (neuronal soma and processes) or axons/terminals (fiber/projection). The former pattern, in which neuronal soma were evident, was observed in CA1, CA3, dentate gyrus, MS, lateral septal complex, DR, SN, and VTA. The latter pattern, a more diffuse unstructured signal, was observed in PFC, GuCtx, COA, and anterior group of the dorsal thalamus. A schematic summarizes the above-described brain mapping of NTSR1-Venus regional and subcellular distribution (Figure 3D). These results suggest that adult NTSR1-Venus animals possess expected tissue distribution (cortical, thalamic, midbrain, etc.) as predicted by the literature and allows for subcellular localization of the receptor in brain sections.

Our brain mapping identified enrichment of NTSR1-Venus positive neurons in the midbrain. Based on previous in situ hybridization reports (Nicot et al., 1995), we reasoned that neurons in the SN and VTA were likely dopaminergic and not noradrenergic which heavily concentrates in the locus coeruleus (LC). To test this hypothesis, we first immunostained adult Ntsr1^Venus/Venus brain sections for Venus and dopamine beta-hydroxylase (DBH) to identify noradrenergic cells using epifluorescence microscopy. We did not observe any colocalization between DBH and Venus in the VTA, where cells were NTSR1-Venus positive and DBH negative (Figure 4A; Supplementary Video 1) or in the LC where DBH positive neurons were Venus negative (Figure 4B). However, when we stained brain sections for Venus and tyrosine hydroxylase (TH), a dopaminergic neuron marker, TH colocalized with Venus in the VTA (Figure 4C) but not in LC (Figure 4D). When slide scanner imaged brain sections were used to 3D reconstruct the whole brain, we noticed that the VTA and SN areas were the most enriched areas for Venus/TH neurons (Supplementary Video 4). Upon closer examination of the dual Venus/TH-stained brain sections using confocal microscopy, we observed colocalization on soma and processes in SN (Figure 4E) and VTA (Figure 4F) neurons. These results suggest that NTSR1-Venus mice show enriched expression in dopaminergic neurons within the midbrain.

Studying GPCR trafficking in living tissues has been a highly desired yet unfulfilled goal. The robust labeling of NTSR1-Venus on soma of dopaminergic neurons motivated us to ask whether we could use these animals to monitor receptor endocytosis in living tissue sections? We prepared acute coronal slices containing SN and VTA (Figure 5A) from 5-week-old Ntsr1^Venus/Venus animals for multiphoton imaging. In untreated slices, we observed that basal NTSR1-Venus was visible at the membrane and punctate internal structures throughout soma and processes (Figure 5B) suggesting that endogenous neuropeptide/neurotransmitter release could have promoted receptor endocytosis.

To test whether NTSR1 receptors are indeed being bound by endogenous ligand in acute slice, we compared NTSR1 distribution in slices treated with the NTSR1 specific antagonist, SR48692 (Gully et al., 1993). In these experiments, slices were prepared as before and a third of them were placed in cutting solution (control) whereas the rest of the slices were placed in cutting solution (see Section “Materials and methods”) containing 1 μM SR48692 for the duration of slice recovery. Following slice recovery, VTA/SN-containing slices were placed in the imaging chamber with circulating aCSF and a baseline image (0 min) was acquired. Immediately following image acquisition, either drug was added to the circulating aCSF or for control slices, nothing was added. For slices which had recovered in 1 μM SR48692, either 1 μM SR48692, or 10 μM PD149163 was added to the slice (Figure 5C). We began each 60-min imaging session with a baseline Z-stack image taken at 0 min and subsequent Z-stack acquired images were taken every 15 min. In control slices, NTSR1-Venus expression was observed at plasma membrane and internal punctate structures for the duration of imaging (Figure 5D). In antagonist recovered and treated slices, NTSR1-Venus remained visible at internal punctate structures as well as plasma membrane. Remarkably, addition of 10 μM PD149163 onto slices preincubated with antagonist during slice recovery, enabled the observation of agonist-induced NTSR1-Venus puncta throughout soma and processes. NTSR1-Venus puncta were then quantified in the acquired image projections by counting vesicle-sized particles (Figure 5E). In control slices, a similar number of puncta were visible at the start (0 min) and at the end (60 min) of imaging. Antagonist-only treated slices showed a trend of decreasing puncta across imaging time perhaps suggesting increased membrane localized receptors. In 10 μM PD149163 stimulated slices, vesicle-sized particle counts were significantly higher than controls at 30, 45, and 60 min and significantly higher than antagonist-only treated slices at 15, 30, 45, and 60 min. Taken together, these results indicate that our endogenous labeling strategy enables the subcellular localization and trafficking of NTSR1 to be visualized directly, and with high spatiotemporal resolution, in intact brain slices.