Zebrafish (Danio rerio), TL line, were bred and housed at the Zebrafish Core Facility (ZCF) at the International Institute of Molecular and Cell Biology in Warsaw, Poland (license no. PL14656251 from the District Veterinary Inspectorate in Warsaw; license no. 064 and 0051 from the Ministry of Science and Higher Education in Poland). All of the animal procedures were performed in accordance with fundamental ethical principles for the protection of animals that are used for scientific or educational purposes (Act of January 15, 2015; Directive 2010/63/EU). Embryos at 5–13 days postfertilization (dpf) were kept in static tanks with rotifer (Brachionus plicatilis) culture (maintained inhouse; rotifer and the rotifer diet were originally purchased from Varicon Aqua Solutions Ltd, United Kingdom). At 2 weeks of age, the fish were kept in circulating water. Fish at 13–30 dpf were fed Gemma Micro three times per day, artemia once a day, and also received rotifers at least once a day. Thereafter, rotifers were excluded while the diet remained unchanged (dry feed three times a day and artemia once a day. The facility maintains a 14 h light/10 h dark photoperiod. The fish were kept in groups of >5 individuals. Larvae and fish up to 6 weeks of age were kept at a maximal density of 50 fish in 3.5 L tanks. From 4 to 6 weeks of age, the fish were kept at a maximal density of 24 fish in 3.5 L tanks. Average values of water quality were the following: salinity of 800 ± 10 μS, pH 7.0 ± 0.2, temperature of 28 ± 0.4°C, undetectable NO₂^– and NH₃/NH₄⁺ levels, GH 4, KH 6, dissolved O₂ of 8.6 ± 0.1 mg/L, and 20% of daily water change. The chosen donor fish were outcrossed to the TL line. Some embryos were sacrificed for genotyping, and the rest were left to grow and used to establish new stable lines with a mutation of the npc2 gene.

For CRISPR prediction, the following free web tools were used to select target sites: CHOPCHOP², E-CRISP³, CRISPRscan⁴, and CCTop⁵. Sequences that were common in at least three predictions and were scored as low risk for off-targets were chosen. The correctness of the sequence in the targeted area in the TL fish at the ZCF was confirmed by Sanger sequencing. Mutagenesis was performed according to the protocol of Gagnon et al. (2014), with modifications (Gagnon et al., 2014). The following gene-specific oligos with T7 overlaps were used: npc2b_(86/34aa) 5′-taatacgactcactataGGTAG ACGGAAAAGTAGTTCgttttagagctagaa-3′ (to create guide IT8). During gRNA preparation, annealing and filling in steps were combined, and the template was prepared for polymerase chain reaction (PCR) using 10 μl of PCR Mix Plus (A&A Biotechnology), 2 μl of gene-specific and constant oligo (5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAA CGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAA AC-3; each at 100 mM stock), 2 μl dNTPs (100 mM stock), and water up to 20 μl. The PCR conditions were the following: pre-incubation at 95°C for 3 min, followed by 35 cycles of 95°C for 15 s, 40°C for 15 s, and 68°C for 15 s. sgRNA was prepared using 1 μl of gene-cleaned template (145 ng), 0.5 μl T7 RNA polymerase (20 U/μl, A&A Biotechnology), 2 μl NTPs (75 mM each, A&A Biotechnology), 1 μl of buffer (5×, A&A Biotechnology), and water up to 5 μl. The reaction was incubated for 2 h at 37°C. Thereafter, a mixture of 1 μl of RNA-free DNAse (Qiagen) and 14 μl of water was added to each sample. After 15 min of incubation, 10 μl of ammonium acetate (5 M stock) and 60 μl of pure ethanol were added, and the samples were left for precipitation over night at -20°C. gRNA was suspended in water, and the concentration was adjusted to 500 ng/μl. Cas9 protein (14 mg/ml stock, made in-house) was diluted in KCl/HEPES (200 mM/10 mM, pH 7.5) buffer to a final concentration of 600 ng/μl. The injection mixture was assembled fresh by mixing 2 μl of gRNA, 2 μl of gRNA, and 0.4 μl phenol red (Sigma, catalog no. P0290) and left for complex formation at room temperature for 5–10 min. Thereafter, the samples were kept on ice.

Microneedles were pulled from borosilicate glass capillaries (Sutter; catalog no. BF 100-50-10) using a P-1000 Flaming/Brown micropipette puller (Sutter) set to the following parameters: heat 542, pull 80, velocity 80, time 170, pressure 500, and RAMP 552. The needle tip was chipped with Dumont no. 5 ceramic-coated fine forceps (Dumostar). One picoliter of the gRNA/Cas9/phenol red mixture was injected into the yolk (just below the zygote) at 1–2 cell-stage zebrafish embryos using a PV 820 Pneumatic PicoPump (World Precision Instruments). Injected embryos were sorted 50/plate and incubated up to 5 dpf in 9 cm diameter Petri dishes that were two-thirds filled with E3 medium in an HPP110 incubator (Memmert) set to 28.5°C, a 14 h/10 h light/dark cycle, 20% light intensity (cold/warm light, 1:1), and 60% humidity.

Fin clipping of adult zebrafish was performed under anesthesia with tricaine (Sigma, catalog no. A-5040). The fish were immersed in 0.7 mM tricaine solution in system water until they stop moving and exhibited no response to tough. Euthanasia of - larvae was performed by an overdose of tricaine. Fish tissue (fragment of the tail fin or pulls of 3–5 dpf embryos) was dehydrated in pure ethanol, incubated at 80°C until complete dryness, soaked in 50–150 μl of TE 10-1 buffer [aqueous solution of 10 mM Tris (pH 8.0) and 1 mM ethylenediaminetetraacetic acid (pH 8.0)] and cooked for 10 min at 95°C. Thereafter, an equal volume of TE 10-1 with 20–60 μg proteinase K (10 mg/ml aqueous stock) was added to each sample. The samples were incubated for 1 h at 55°C. Proteinase K was then inactivated by heat (incubation for 15 min at 95°C). Samples were stored at −20°C before use.

For sequencing, the amplicon was amplified using PCR Mix Plus (catalog no. 2005–100P, A&A Biotechnology) and npc2_a_F1 5′-GCATATTCGCTGTCATGTGATT-3′ and npc2_b_R1 5′-GTAGGATTGTCCCTTGTGAAGC-3′ primers. The PCR conditions were preincubation at 95°C for 3 min and 35 amplification cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s, followed by 5 min of incubation at 72°C. The PCR products were purified using EPPiC Fast (catalog no. 1021–100F, A&A Biotechnology) according to the manufacture’s protocol.

The fish were anesthetized with an overdose of tricaine. RNA was isolated using TRI reagent (Sigma, catalog no. T9424) according to the manufacture’s instructions. The tissue was shredded in 1 ml of solution with a 23-gauge needle. After the addition of 0.2 ml of chloroform, the sample was vortexed and centrifuged at 13,000 rotations per minute (rpm) for 15 min in 4°C. The supernatant was transferred to a new tube, and RNA was precipitated with pure isopropanol overnight at −20°C. After centrifugation at 13,000 rpm for 30 min at 4°C, the pellet was washed with 70% ethanol, air-dried, and resuspended in 15–25 μl of sterile water.

Total RNA was extracted from 5 dpf larvae (n = 9/group from at least two independent cohorts), and various organs (brain, liver, heart, spleen, skeletal muscles, and gonads) were collected from 9-month-old male fish (n = 4 homozygotes and n = 4 wildtypes). Additionally, to test the influence of 2-hydroksypropylo-β-cyclodextrin (2HPβCD) treatment (a drug that is used for the treatment of Niemann-Pick disease) on the expression of selected genes, total RNA was extracted from two groups of treated and untreated zebrafish larvae (5 dpf) from two independent experiments. The RNA template (1,000 ng) was used for cDNA synthesis using the iScript cDNA Synthesis Kit (Bio-Rad).

The reaction mixture was composed of (i) 5 μl of LightCycler 480 High Resolution Melting Master mix (Roche), 1 μl of MgCl₂ (25 mM stock), 0.3 μl of each primer (10 μM stock), 0.5 μl of template, and water up to 10 μl or (ii) 5 μl of Precision Melt Supermix (Bio-Rad), 0.2 μl of each primer (10 μM stock), 1.0 μl of template, and water up to 10 μl. Two primer pairs were used. npc2a HRM F1 (5′-AACTCTAGTGTGTTGGTTCCTAAC-3′) and npc2a HRM R1 (5′-CAAGTGTACGCGAGAAAAGAAAGTA-3′) were used as controls, which amplified the region upstream of the target site. npc2b HRM F1 (5′-TAATTTCCACTTTCATCTTACAGGC-3′), and npc2b HRM R1 (5′-GGATTGTCCCTTGTGAAGCTTG-3′), which span the mutation site, were used to detect the mutation. HRM analysis was performed on either LightCycler 480 System PCR (Roche) or CFX96 (Bio-Rad), both according to the manufacturer’s protocol. For the Bio-Rad system, the conditions were preincubation at 95°C for 2 min, 35 amplification cycles of 95°C for 10 s and 60°C for 30 s, heteroduplex formation at 95°C for 30 s, followed by 60°C for 1 min, and HRM at 65–95°C with ramp at 0.2°C/10 s. Genotypes were automatically assigned by LightCycler 96 software’s HRM module for the Roche system or Precision Melt Analysis software for the Bio-Rad system and manually annotated as wildtype (black), heterozygous mutant (blue), and homozygous mutant (gray; Figure 1).

Gene expression levels were analyzed using the CFX Connect Real-time PCR (RT-PCR) Detection System (Bio-Rad, Hercules, CA, United States). RT-PCR was performed in duplicate using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, catalog no. 1725274). The data were analyzed using Bio-Rad CFX Maestro 1.0 software. The specificity of the reactions was determined based on dissociation curve analysis. Fold changes were calculated using the ΔΔCq method as described before (Majewski et al., 2019). Expression levels were compared between groups using analysis of variance (ANOVA) followed by Tukey’s Honestly Significant Difference (HSD) post hoc test. The 18S ribosomal gene was used as a reference. The sets of primers that were used in the analysis are shown in Table 1.

Nile blue (B&K, Bytom, Poland) was prepared as a 1% aqueous stock solution. Stock solution of Neutral red (Sigma N7005) was prepared as 2.5 mg/ml solution in water. LysoTracker Red DND-99 (Invitrogen, catalog no. L7528), Neutral red or Nile blue (each at 1:1000 dilution) was added directly into the plates with live 5-day-old zebrafish larvae. After 1 h of incubation at 28°C in the dark, the medium was exchanged to fresh E3 three times over a 15 min period.

The stock of filipin complex (Sigma, catalog no. F9765) was prepared by dissolving 25 mg filipin in 1 ml of dimethylsulfoxide. Aliquoted stocks were stored at −20°C. 5-day-old zebrafish larvae were fixed in 4% paraformaldehyde (Sigma, catalog no. 47608) in 1 × phosphate-buffered saline (PBS; Sigma, catalog no. D5652) for 1 h at room temperature and washed for 5 min three times with 1 × PBS with 1.5% glycine (Sigma, catalog no. G7126). Embryos were stained with Filipin solution (final Filipin concentration of 0.5 mg/ml) in 1 × PBS with 10% bovine calf serum (Sigma, catalog no. 12133C) in the dark for 2 h at room temperature.

Stained larvae were rinsed with 1 × PBS, immersed in 0.7 mM tricaine, transferred to a plate with 3% methylcellulose, and imaged in the ultraviolet channel (Filipin), RFP channel (Lysotracker), and bright field (Nile blue) under a Nikon SMZ25 fluorescent stereomicroscope. The genotype of the imaged fish was confirmed by HRM analysis.

The stock solutions were prepared by dissolving the powdered compound in Milli-Q water to a final concentration of 100 mM for (2-hydroxypropyl)-β-cyclodextrin (2HPβCD; Sigma, catalog no. C0926) and 10 mM for 3-β-[2-(diethylamino)ethoxy]androst-5-en-17-one (U18666A; Sigma, catalog no. 662015). Good-quality eggs were placed in 9 cm diameter Petri dishes filled with 25 ml of E3 medium and kept under static condition at 28 ± 0.5°C. At 3 dpf, the medium was changed to fresh E3 medium supplemented with U18666A (8 μM), 2HPβCD (2 mM), and U18666A (8 μM) together with 2HPβCD (2 mM). As a control, an equal volume of the solvent was used. Embryos were kept in static condition for 2 days. At 5 dpf, the fish were stained with Nile blue and collected for RNA extraction.

Adult zebrafish were fixed in neutral buffered 4% formaldehyde solution (Sigma, catalog no. 47608–250ML-F), dehydrated in ethylene, and embedded in paraffin. Longitudinal and transverse 5–6 μm sections were cut using a Leica microtome (RM2265, Leica, Bensheim, Germany) and stained with standard hematoxylin and eosin (H&E). For glycogen and lipofuscin inclusions, periodic acid-Schiff (PAS) reactions were performed according to the manufacturer’s instructions (Sigma-Aldrich, St. Louis, MO, United States). Perl Prussian blue staining to detect hemosiderin was performed according to Orchard (2019). Luxol Fast Blue (LFB), combined with H&E, was used to stain myelin sheaths. The immunohistochemical frequency of CD3 and proliferating cells in the intestinal epithelium and liver was determined in samples that were stained according to the manufacture’s protocol for anti-CD3 (Bond Ready-to-Use Primary Antibody CD3, LN10, Leica Newcastle, United Kingdom) and anti- proliferating cell nuclear antigen (PCNA; 1:400 dilution; clone PC10, DAKO, Poland) antibodies. The colorimetric detection of these cells was performed using DAB (Novolink Polymer Detection Kit, Novocastra, Leica, Newcastle, United Kingdom). The microscopic analysis was performed using NIS Elements software and Nikon Ni-E with NIS Elements software.

The behavioral studies of zebrafish larvae were performed as described previously (Wasilewska et al., 2020). Before the experiment, the larvae were kept in a Petri dish (∼50 larvae/dish) that was two-thirds filled with E3 medium in an HPP110 incubator (Memmert) that was set to 28.5°C under a 14 h/10 h light/dark cycle with 20% light intensity (cold/warm light, 1:1) and 60% humidity. The larvae (5 dpf) were transferred to 12-well plates and placed in a ZebraBox high-throughput monitoring system (ViewPoint Life Sciences, Lyon, France). The experiments were performed in a volume of 2 ml of E3 medium, and the light intensity was set to 70%. Locomotor activity was recorded for 15 min using ZebraBox. A total of 40 wildtype and 32 npc2^–/– larvae from two independent cohorts were used in the experiment.

The video files were further analyzed using EthoVision XT software (Noldus, Wageningen, Netherlands). The data were exported to Microsoft Excel files and further analyzed using Excel (Microsoft, Redmond, WA, United States) and R software (R Foundation for Statistical Computing, Vienna, Austria, R package version 3.6.2). The experiment was divided into three 5 min periods, and the mean total distance traveled (mm), mean velocity (mm/s), and mean movement duration were calculated and compared independently for these time bins. The Wilcoxon rank-sum test was used for comparisons between wildtype and npc2^–/– larvae.

Additionally, the area of the well was divided into borders and a central area. This allowed analyses of the level of thigmotaxis that was calculated according to the following formula: [duration of movement (in borders or center) + duration of no movement (in borders or center)]/[duration of movement (total) + duration of no movement (total)] × 100% (Wasilewska et al., 2020). The data are expressed as medians with first and third quartiles using boxplots, and dots represent data outliers. Heatmaps that represent average traces of wildtype and npc2^–/– larvae were generated using EthoVision XT software.

In quantitative PCR gene expression analysis, expression levels were compared between groups using ANOVA followed by Tukey’s HSD post hoc test. In the behavioral studies the Wilcoxon rank-sum test was used for comparisons between wildtype and npc2^–/– larvae.

The zebrafish npc2 gene (ENSDARG00000090912) maps to chromosome 17 and encodes a 149 amino acid protein that shares over 64% sequence identity with its human ortholog (Figure 1A). Expression of the npc2 gene could be found in each tested tissue (i.e., brain, heart, liver, muscles, skin, and reproductive organs; Figure 1B). Using CRISPR/Cas9 technology and gRNAs that targeted the npc2 gene, we generated F0 carriers of different mutations. After an initial screening by HRM analysis, six donor fish with the most distinct HRM patterns were bred, and their F2 offspring were analyzed by HRM and sequencing. A mutant line with a 1 bp deletion in the third exon of the npc2 gene (ENSDARG00000090912) that is predicted to introduce a premature stop codon was selected for further studies (Figure 1C). The deletion caused a characteristic shift in the melting temperature of the amplicon that was identified by HRM (Figure 1D). In the mutant, qPCR analysis confirmed a significantly lower level of npc2 transcripts (Figure 1E). At 5 dpf, the morphology and length of the hetero- and homozygousnpc2 mutants were indistinguishable from wildtype siblings (Figure 1F), similar to npc1 zebrafish knockouts (Lin et al., 2018; Tseng et al., 2018). Over time, the differences became more apparent. The 2-month-old npc2^–/– fish were smaller than their siblings, and the sex ratio of homozygotes was skewed toward males (data not shown). When separated from their siblings, the npc2^–/– fish did not need to compete for food and grew faster. From 4 months of age, their motor functions were clearly impaired (Supplementary Video 1) as compared to wildtype siblings (Supplementary Video 2). The malnutrition and progressive loss of motor skills continued to worsen, but not all npc2^–/– fish were equally affected. Some fish had to be euthanized at the age of 5 months because their eating and swimming skills were severely impaired, whereas others were fit and survived four more months. The length and weight of the 9-month-old npc2^–/– fish were significantly reduced (Figure 1G). The npc2^–/– fish bred normally, whereas inbreeding of the npc2^–/– fish was unsuccessful (data not shown). Interestingly, we could obtain offspring by crossing npc2^–/– males with either wildtype or npc2^± females.

Although, nowadays not recommended as a primary tool, the cholesterol-specific filipin staining for many years was used as a gold standard in NPC diagnostics (Geberhiwot et al., 2018). That is why we applied this stain to the mutant fish and confirmed the presence of blighter signals in the npc2^–/– mutant (Supplementary Figure 1). This finding indicates that as expected, un-esterified cholesterol accumulates in homozygous npc2 mutant.

Niemann-Pick type C disease is a lysosomal storage disease. We used the LysoTracker red probe to visualize acidic organelles in vivo to quickly identify the mutant. We observed increases in LysoTracker red staining in neuromasts in some npc2^–/– larvae (Supplementary Figure 2). However, using this staining, we failed to reliably distinguish wildtype from npc2^–/–.

We found that Nile blue staining allowed the robust and reliable detection of npc2^–/– larvae. When added to the water in the dish, Nile blue reversibly stained live larvae in a few minutes. At 5 dpf, strong staining in the peripheral olfactory organ was specific (certainty > 95%) to npc2^–/– fish, whereas staining in other parts of the body appeared random (Figure 2).

Nile blue stains lipids. It has been primarily used to detect melanin and lipofuscin (Lillie, 1958). Nile blue-based dyes were later discovered to localize in lysosomes. Their lysosomotropic photosensitizer properties could be used to target and kill tumor cells (Gattuso et al., 2016; Martinez and Henary, 2016). To verify the specificity of Nile blue staining, we applied it to larvae that were treated with 2HPβCD (a drug that is used in clinical trials to treat NPC patients) and U18666A (an inhibitor of cholesterol synthesis that is used to chemically model NPC disease). 2HPβCD treatment reduced the intensity of blue staining in the nose in npc2^–/– fish, whereas U18666A treatment increased this signal (Figure 3). The intensity of staining in wildtype fish and heterozygous npc2 mutant fish followed the same trend, in which staining was weaker in 2HPβCD-treated larvae and stronger in U18666A-treated larvae (data not shown).

To investigate the effect of npc2 mutant on behavior, locomotor activity in npc2^+/+ and npc2^–/– zebrafish larvae was analyzed. A significant reduction of mobility was observed in npc2^–/– larvae compared with their wildtype siblings (Figure 4A). Mutants traveled a shorter distance (Figure 4B), and they remained mobile for a shorter period of time (Figure 4C). The mean velocity during the first 5 min of the experiment was lower in npc2^–/– larvae compared with npc2^+/+ larvae (Figure 4D). During the initial 5 min of the experiment, mutant larvae exhibited a stronger tendency to stay in close proximity to the borders of the well (thigmotaxis; Figure 4E). This phenomenon is a typical anxiety-like response in zebrafish larvae (Lundegaard et al., 2015), suggesting a stronger anxiety-related response to a stressor in this group.

The histopathological analysis of adult npc2^–/– larvae revealed lesions in the spleen, liver, and pancreas. In the liver in npc2^–/– fish, numerous foam hepatocytes, hepatocytes that contained fat droplets, and cells with enlarged nuclei were observed (Figure 5A). An atypical interstitial group of foam cells was observed in the anterior part of the npc2^–/– kidney (Figure 5B). The structure of the pancreas was disturbed. Acinar cells in the pancreas in npc2^–/– larvae had no characteristic zymogen granules but had multiple circular cholesterol inclusions that were not observed in the control group (Figure 5C).

Morphological and histopathological changes were also observed in the brain in npc2^–/– fish (Supplementary Figure 3 and Figure 6). The myelination of axons in npc2^–/– fish was affected (Figure 6A), especially in the habenular commissure (Figures 6B,C). The habenula’s characteristic layered structure was affected. The fascicular retroflexus, interpeduncular nucleus, and raphe were vacuolated, and the myelination of axonal tracts decreased (Figures 6B,C). The two mechanoreceptive areas with well-differentiated axonal tracts (lateral and medial longitudinal fascicle) were observed only in wildtype fish compared with npc2^–/– fish (Figure 6C). In the cerebellum, Purkinje cells were more diffuse than in the control group, and the structure on these cells differed from control fish (Figures 6C, 7A). Purkinje cells had spheroid, highly non-condensed chromatin, enlarged nuclei, and a distended perikaryon (Figure 7A). In this region, no PCNA-positive cells were observed, although proliferation was detected in the parvocellular preoptic nucleus and caudal zone of the periventricular hypothalamus compared with the control group (Supplementary Figure 4A).

In the olfactory sensory epithelium, no histopathological changes were observed, although the olfactory nerve had some degenerative attributes, characterized by a shrunken cytoplasm of axons that were visible in transversal sections. Similar histopathological changes were observed in the telencephalon and rhombencephalon (Figure 6A). In the external and internal cellular layers of the olfactory bulb, multiple vacuolations were observed in intracellular matter, but no neural cytopathological changes were found. Widespread foamy vacuolation of the cytoplasm of neurons and glia and neuronal spheroids were present in the npc2^–/– telencephalon and optic tectum (mostly in the stratum fibroetgricialem). Similar changes were observed in the olfactory bulb and optic nerve (Figures 7B,C). CD3-positive cells were observed in npc2^–/– fish, whereas no signal was detected in the wildtype group (Supplementary Figure 4B).

We determined the level of gene expression in wildtype and npc2^–/– fish at two developmental stages. Homozygous larvae were preselected based on Nile blue staining. The genotype of both 5-day-old larvae and adult fish was confirmed by HRM analysis. In whole larvae, the mbp, cldn, and olig1 genes were down-regulated, whereas expression of the mpz, plp1, and sox10 genes was unchanged. In the npc2^–/– adult brain, a significant reduction of expression was detected only for the mbp and mpz genes (Figure 8). The downregulation of myelination markers was consistent with the decrease in LFB staining (Figure 6A).

The downregulation of mbp expression is associated with the upregulation of interleukin-1 signaling in npc1^–/– animal models (Mannie et al., 1987; Qiao et al., 2018). To determine whether npc2^–/– zebrafish exhibit hallmarks of inflammatory responses that are associated with NPC disease, we profiled the expression of selected genes in the brain and liver in 9-month-old fish. In the brain, the upregulation of il1, nfκβ, mpeg, and capn2a was detected (Figure 9). In the liver, il1 expression but not nfκβ, mpeg, or capn2a expression was also up-regulated. However, in contrast to the brain, mpx, apoE, and ppp3ca expression was up-regulated (Figure 9).

In addition, we stained zebrafish larvae with Neutral red, a dye which specifically labels microglia in the larval zebrafish brain. In 5 dpf npc2^–/– larvae, we found numerous red-labeled cells with dark red aggregates having typical appearance of over-activated micro-microglia, i.e., soma size was enlarged and cells had amoeboid shape (Supplementary Figure 5). Beclin-1 plays an important role autophagy during neurodegeneration. We found that npc2^–/– larvae show slightly increased expression level of becn1, which is in line with previous finding of Pacheco and colleagues who demonstrated that enhanced basal autophagy in NPC1 deficiency is mediated by increased expression of Beclin-1 (Pacheco et al., 2007). We did not detect significant changes in the expression level of markers of ubiquitin-dependent stress-induced autophagy (atg5, atg7, and p62; Supplementary Figure 6).

We also found that apoE, capn2a, lgals3a, mcu, mpeg, and ppp3ca expression were down-regulated in 5 dpf npc2^–/– larvae compared with wildtype fish (Figure 10A). The most striking difference was related to the level of mcu, with very high statistical significance. These changes appeared to be specific to NPC disease because 2HPβCD treatment rescued the levels of mcu and ppp3ca expression and the expression of genes that are associated with myelination (olig1, mbp, cldn, and plp1; Figures 8, 10B).