Experiments were carried out as previously described (Moftah et al., 2008). In brief, 25 urodele amphibians (Pleurodeles waltlii) were obtained from Blades Biological Ltd (Kent, UK) and kept in aquaria at 19°C. Surgical procedures, handling and housing of the animals were in accordance with protocols approved by the INSERM Ethics Committee and conformed to NIH guidelines.

Surgery was performed in aseptic conditions under general anesthesia as previously described (Moftah et al., 2008). In short, anesthetized animals were operated by completely cutting the spinal cord between segments 12 and 13. The wound was sutured and wound healing was complete 8–10 day post-operative. Sham-operated animals were exposed to laminectomy but not spinal cord transection.

All animal groups were anesthetized and treated for in situ hybridization as previously described (Moftah et al., 2008). In summary, spinal cords were exposed by laminectomy then divided into two segments (anterior and posterior) corresponding respectively to the pre- and post-lesional parts of the cord (in spinalized animals). Specimens were immediately but separately frozen by immersion in −50°C isopentane (Merck) without fixation. All samples were stored in embedding medium (Tissue Tek, Sakura) to be sectioned and processed later on.

Spinal cord sections (265 section/region/animal/experiment) were 14 μm thick and processed as described earlier (Landry et al., 2000). Briefly, sections were incubated at 42°C with 0.5 ng of each of the radioactively labeled probes. After hybridization, they were rinsed for four times at 55°C followed by 30 min at room temperature. Radioactivity was revealed by dipping sections into Ilford K5 nuclear emulsion (Ilford, Mobberly, Cheshire, UK), diluted with distilled water in a 1:1 ratio. They were then developed in the Kodak D19 developing solution and fixed in the Kodak 3000 fixative. Sections were then counterstained with 0.25% cresyl violet acetate (pH 4) (Sigma) and mounted in glycerol.

For in situ detection of FGF-2 and FGFR2 mRNA, we used the following four fifty-mer oligonucleotide probes (Eurogentech, Seraing, Belgium) based on previously published gene sequences (Zhang et al., 2000; Moftah et al., 2002) respectively.

FGF-2:

5^′GTTGATCCGCAGAAAGAAGCCCCCGTTCTTGCAGTACAGCCTCTTGGGTC3^′

FGFR2:

5^′GGAAATGGACCAGGAACTTACTCTAAAAAGATGGTCAGCTGGGATTCGGG3^′

Probes were chosen from regions presenting few homologies with related mRNA sequences and were checked against the GenBank database.

As previously described (Landry et al., 2000), oligonucleotides were labeled in cobalt containing buffer with ³⁵S-dATP (Amersham) to a specific activity of 1–4 × 10⁹ cpm/μg and purified by ethanol precipitation.

The presence of FGF2 protein was determined by western blot analysis. All animal groups were anesthetized and treated as previously described (Moftah et al., 2012). In summary, spinal cords were exposed by laminectomy then divided into two segments (anterior and posterior) corresponding respectively to the pre- and post-lesional parts of the cord (in spinalized animals). Specimens were immediately frozen by immersion in –50°C isopentane (Merck) without fixation.

Previously removed and frozen spinal cord portions (n = 5) were treated as previously described (Moftah et al., 2012). In short, specimens were separately homogenized in ice cold buffer. Homogenates were centrifuged and 1% Triton X-100 (Sigma) was added. The supernatants were centrifuged for 1 h at 4°C. Protein content was determined using Bradford assay (Bio-Rad, Hercules, CA, USA). Western blots were performed with 40 μg of proteins and repeated five times. Samples were resuspended in Laemmli Buffer (Laemmli, 1970), fractionated by SDS-PAGE using a 10% acrylamide gel and then transferred to PVDF membrane (Bio-Rad). Membranes were washed several times in blocking buffer and incubated overnight at 4°C with rabbit anti-FGF-2 (Chemicon, Temecula, CA, USA) primary antibody (1:200 in blocking buffer: BIORAD, Marnes-la-Coquette, France). Immunoreactivity was detected using anti-rabbit horseradish peroxidase (HRP)-conjugated secondary antibody (Dako) and visualized using enhanced chemiluminescence (ECL) detection system (Cell Signaling, Beverly, MA, USA). Anti-beta-actin was used as control.

Anesthetized animals (n = 5/experiment) were perfusion-fixed via the ascending aorta. Spinal cord was dissected out and treated as described earlier (Moftah et al., 2012). In summary, blocked sections were incubated (1:1000 in 2,4,6-trinitrotoluene, TNT/bovine serum albumin, BSA) with rabbit anti-nestin (Abcam, Paris, France) and mouse anti-pan neural NF (Sternberger Monoclonals Incorp., Lutherville, MD, USA) primary antibodies. After rinsing in TNT, they were incubated with anti-rabbit Alexa fluor 488-conjugated and anti-mouse Alexa fluor 568-conjugated (Invitrogen, Cergy Pontoise, France) secondary antibodies (1:500 in 1,3,5-Trinitrobenzene, TNB). Slides were then rinsed and mounted.

Slides were examined; bright field light microscopy micrographs were taken using a Zeiss Axiophot 2 microscope (Zeiss, Jena, Germany). Immunostainings were analyzed with a Leica DMR PCS SP2 AOBS confocal microscope (Leica, Heidelberg, Germany) using a 20×, 40× or 63× oil-immersion lens. In all cases, scans were carried out sequentially with the 488 nm and 568 nm lines of the laser. Digital images were optimized for image resolution (300 dpi final resolution), brightness and contrast using Adobe Photoshop 6.0 (Adobe System, San Jose, CA, USA).

Comparisons between groups (five animals each) were made on sections treated together on the same slides under identical conditions. The number of labeled cells and the labeling intensity were quantified as previously described (Landry et al., 2000). Cellular profiles containing three times more grains than mean background grain densities were considered labeled. Cell profiles were manually outlined as previously described (Moftah et al., 2008). Delineation was based exclusively on staining and not on shape, size or other measurable quantities. The number of silver grains per cresyl violet counterstained cell was counted semi automatically using MetaMorph Offline 6.1 software (Universal Imaging Corporation). Data were expressed as grain density per μm² ± SEM in calibrated photomicrographs. Transmitted light photomicrographs were taken for at least 500 fields (700 μm² each), in each experiment.

Data were imported into a spreadsheet program (Sigma Plot software, Jandel Scientific) that calculated and graphed the density of FGF-2 and FGFR2 mRNA expression. Data were compared using one way ANOVA tests and processed using standard statistical analysis techniques (Sigma Stat software, Jandel Scientific). Differences were considered to be significant when p ≤ 0.05.

Using nestin as a marker for intermediate filaments and thus neurogenesis, we investigated spinal cord regeneration after complete transection in the mid-trunk region. At 1 week after transection, spinal cord was separated into two stumps, a rostral (R) and a caudal (C) one (Figure 1A). Nestin was expressed mainly in the rostral stump around the central canal. This implies that regeneration started in the anterior portion of the spinal cord (Ant SC: the pre-lesional stump) right after transection thus preceding the posterior portion (Post SC), in which nestin is still faint at 1 week after the operation. Starting at 2 weeks post-operatively, a gap replacement is starting to appear, i.e., the gap between the two stumps started to be filled with neuronal progenitors as seen by the equally distributed nestin expression in both parts of the central canal and at the lesion site (Figure 1B). Fifteen weeks after transection; when animals recover their locomotor activity; spinal cord (as seen in Figure 1C) became continuous, completed gap replacement, due to the prominent expression of nestin at the lesion site. After 24 weeks of spinal cord transection, animals recovered both locomotor activities, i.e., stepping and swimming. On the cellular level, we noticed that spinal cord was normal in shape. Nevertheless, few traces of nestin are still obvious (Figure 1D).

In an attempt to get a closer look to the cellular level, we examined the distribution of nestin and NF during spinal cord regeneration. At 1 week after transection, when the animal is completely paralyzed and the spinal cord is separated into a rostral and a caudal stump, we found that nestin expression in the rostral part is prominent next to the lesion site (Figure 2A). The labeling orientation implies a possibility of neuronal progenitor migration from the upper part of the rostral stump to the lesion site in an attempt to replace the missing tissue. Meanwhile, adult neurons have been lost due to transection and the remaining cells disintegrated. We show here that NF, the neuronal marker, is almost absent 1 week post-operatively; a unique neurone is seen near the lesion site (Figure 2B). No colocalization is noticed between NF and nestin (Figure 2D), which implies that nestin is not expressed by neurons but instead is expressed by neuroglial cells as shown in our previous study (Fahmy and Moftah, 2010).

In the caudal stump, however, we found that nestin expression is prominent not only next to the lesion site but also in the deep layers of the lesioned spinal cord (Figure 2E). The labeling orientation implies the same possibility of migration seen in the rostral stump although in a lesser organization. Meanwhile, adult neurons have not been completely lost from the caudal stump after transection. Using NF, we showed that, 1 week after injury, neurons are still abundant in the deep layers of the transected spinal cord (Figure 2F). Although their presence in masses, there still is no colocalization between NF and nestin (Figure 2H), implying the de novo formation of neural cells after differentiation of the neural progenitors expressing nestin. When nestin, the marker of neuronal progenitors is more abundant in the rostral stump, NF; the marker of adult neurons is more abundant in the caudal one. This could suggest that the regeneration process follows a rostro-caudal direction.

Six weeks after spinal cord transection, when the animal started to recover some of its locomotor activity, the expression of nestin on the cellular level increased dramatically. Cells become more organized and both stumps of the lesioned spinal cord get connected at the transection site; replacing thus the gap created by the operation (Figures 3A–D). Meanwhile, new, very rare adult neurons start appearing next to the central canal as shown in Figures 3E,F.

A more obvious view of nestin expression in cells lining the central canal is seen in a transverse section of the neural axis at the lesion site, 6 weeks after transection (Figure 3G).

At the end of the process of spinal cord regeneration, when the animal completely recovered its locomotor activity after 24 weeks of the operation, sections taken in the lesion site showed the disappearance of the big amount of nestin leaving behind instead a faint labeling (Figure 4A). In the same location, we saw a stronger labeling of NF (Figure 4B), which implies that the newly formed neurons are finally differentiated expressing only NF. This is confirmed by the absence of colocalization between nestin remnants and the neurofilament marker NF as shown in (Figure 4D).

In previous studies (Moftah et al., 2008, 2012), we correlated the recovery of locomotor activity with FGF-2 and FGFR2 mRNAs expression. To investigate the relation between the transcriptional activity of this growth factor and its receptor with neurogenesis, we studied the distribution of FGF-2 and FGFR2 mRNA in the same regions we used for nestin immunohistochemistry, by using in situ hybridization (Figure 5). Analysis of grain density showed that lesioned animals, 15 weeks after the operation, express high levels of FGF-2 (Figure 5B) and FGFR2 (Figure 5E) mRNA compared to sham-operated animals (Figures 5A,D). FGF-2 mRNA was mainly seen in a ventrolateral position as shown in Figures 5A,B. However, grains demarking FGFR2 mRNA were more prominent in the cells lining the central canal, namely the ependymal cells, as shown in Figures 5D,E. mRNAs grain density quantification showed that FGF-2 significantly increased in lesioned animals 15 weeks post-operatively (p = 0.005) compared to the shams (Figure 5C). This increase is consistent as to FGFR2 mRNA but has a smaller magnitude (p = 0.03) than its ligand (Figure 5F).

In intact animals, western blot assays showed significantly less FGF-2 protein in the anterior part of the spinal cord (Ant SC: corresponding to the pre-lesional portion in transected animals) than in the posterior portion of trunk spinal cord (Post SC; Figure 6A; upper left panel; p = 0.01). This was even more evident but inversed in the case of spinally-transected and sham-operated animals where the Ant SC showed more FGF-2 protein expression than Post SC (Figure 6A; upper middle and right panels). Although there was no spinal cord transection in shams, the fact that the skin, muscles and bones were lesioned caused the increase of FGF-2 in the anterior part of the neural axis. Figure 6B shows that the intensity of FGF-2 band of spinally-transected animals is significantly stronger than that of the sham-operated ones 15 weeks post-operatively (p = 0.008). This is probably due to spinal cord transection that is absent in shams. Compared to the beta-actin bands, the Ant SC of sham-operated animals was the closest, thus normalized to 100% of intensity. All other bands were compared to it. Figure 6C shows that the intensity of FGF-2 band of spinally-transected animals is slightly but not significantly stronger than that of the intact and the sham-operated ones 15 weeks post-operatively (p = 0.01). This implies that FGF-2 protein expression follows a rostrocaudal gradient after complete spinal transection.