Adult Sprague–Dawley rats and animals at 15–21 days postnatal development were used throughout the experiments. Animals were maintained in a 12 h light/dark cycle with food and water ad libitum. The handling of the animals was performed in agreement with the “Manual de Normas de Bioseguridad” (Comición Nacional de Ciencia y Tecnología, CONICYT), and the procedures were described in the publication entitled, “Guide for Care and Use of Laboratory Animals” (National Academy of Science, 2011; http://grants.nih.gov/grants/olaw/Guide-for-the-care-and-use-of-laboratory-animals.pdf). One month postnatal human brain tissue samples were obtained from archived samples previously fixed in 4% paraformaldehyde from the Department of Pathological Anatomy at Concepcion University. The samples were obtained in accordance with the accepted standards of the ethics committee on the use of human specimens and after informed consent was obtained from all patients.

Rat brain tissue samples were fixed in formalin at 10% v/v or in Bouin solution and embedded in paraffin after which 7-μm saggital sections were obtained. For the immunohistochemical analysis, the deparaffinized samples were incubated for 15 min in absolute methanol with 3% v/v H₂O₂. The sections were incubated with the following primary antibodies diluted in Tris-phosphate buffer and 1% bovine serum albumin: anti-PCNA (1:100 DAKO, Carpinteria, CA, USA); anti-Nestin (1:25 Amersham Pharmacia Bitech., Pittsburgh, PA, USA); anti-βIII-tubulin (1:500, Promega, Madison, WI, USA); anti-GFAP (1:200, DAKO); anti-PSA-NCAM (1:25 Hybridoma Bank, Iowa. IA, USA); anti-S100A (1-200, DAKO); and anti-SVCT2 (G19; 1:50, Santa Cruz Biotechnology, Sta. Cruz, CA, USA). The samples were then incubated with the appropriate secondary antibody conjugated to horse radish peroxidase (HRP), including HRP-conjugated goat anti-IgG, HRP-conjugated rat anti-IgG, and HRP-conjugated rabbit anti-IgG (ImmunoPure; PIERCE Biotechnology, Rockford, IL, USA). The enzymatic activity of the peroxidase was revealed with diaminobenzidine and H₂O₂. To perform inmunofluorescence analysis, secondary antibodies conjugated to different fluorophores, including Cy2-conjugated goat anti-IgG, Cy2- or Cy3-conjugated rat anti-IgG; and Cy3- or Cy5-conjugated rabbit anti-IgG (Jackson Immuno Research, Pennsylvania, USA), were used. The images (512 × 512 × 8 bits or 1024 × 1024 × 8 bits) were obtained using a confocal microscope.

A PCR product of 620 bp, which was obtained from pcDNA3-hSVCT2 that was subcloned into pCR-4-Blunt-TOPO (Clontech, Palo Alto, CA, USA), was used to generate sense and antisense digoxigenin-labeled riboprobes. RNA probes were labeled with digoxigenin-UTP by in vitro transcription with SP6 or T7 RNA polymerase following the manufacturer's instructions (Boehringer Mannheim, Mannheim, Germany). In situ hybridization was performed on brain sections mounted on poly-L-lysine-coated glass slides. The sections were baked at 60°C for 1 h, deparaffinized in xylene, and rehydrated in graded ethanol. Following proteinase K treatment (5 min at 37°C in PBS, 1 mg/ml), the tissue sections were fixed with 4% paraformaldehyde at 4°C for 5 min, washed in cold PBS, and then acetylated with 0.1 M triethanolamine-HCl (pH 8.0) and 0.25% acetic anhydride at room temperature for 10 min. After a brief wash, the sections were incubated in pre-hybridization solution (Boehringer Mannheim) at 37°C for 30 min, and then 25 μl of hybridization mix [50% formamide, 0.6 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM ethylenediaminetetraacetic acid (EDTA), 1 × Denhart's solution, 10% polyethylene glycol 8000, 10 mM DL-dithiothreitol (DTT), 500 mg yeast tRNA/ml, 50 mg/ml heparin, 5.0 mg/ml DNA carrier, and 1:20–1:100 dilutions of riboprobe) were added to each slide. The slides were covered with glass coverslips and placed in a humidified chamber at 42°C overnight. The slides were washed at 37°C for 30 min each in 2 × SSC, 1 × SSC, and 0.3 × SSC. Visualization of digoxigenin was performed by incubation with a monoclonal antibody coupled to alkaline phosphatase (anti-digoxigenin alkaline phosphatase Fab fragments diluted 1:500; Boehringer Mannheim) at room temperature for 2 h. Nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (Boehringer Mannheim) were used as substrates for the alkaline phosphatase. Controls included use of the sense riboprobe and omission of the probe.

Five intraperitonial injections of BrdU at a concentration of 40 mg/kg were administered to animals at 19 days postnatal development. Samples were obtained at 21 days postnatal development and fixed in Bouin, and the sections were obtained as previously described. Briefly, after denaturation of the DNA with 2N HCl for 30 min at 37°C, the sections were incubated with 5% BSA for 30 min and anti-BrdU (1:1000, Amersham Pharmacia Biotech) overnight. Detection was made by incubation with rat peroxidase-labeled anti-IgG or rat Cy3-labeled anti-IgG.

The embryo-derived teratocarcinoma cell line, P19 (McBurney, 1993), was cultured in Minimum Essential Medium Eagle (MEM) (Gibco BRL, Grand Island, NY, USA) supplemented with 5% fetal bovine serum (FBS), penicillin, and streptomycin. The neurospheres were generated in pretri dishes (10 cm in diameter) seeded with 1 × 10⁶ cells maintained in culture for 4 days in (1) MEM (control), (2) MEM supplemented with 200 or 400 μM AA or (3) cultured in neurobasal-B27 (Gibco-BRL).

For neurosphere preparation, adult Sprague–Dawley rats were sacrificed by cervical dislocation (n = 6 per preparation), and their brains were removed. The lateral walls of the lateral ventricle were dissected and collected in DMEM-F12 (GIBCO). The cells were dissociated using a Pasteur pipette in NeuroCult NS-A (Stem Cells Technologies Inc), and cells were collected by centrifugation at 100 × g for 5 min. The cell pellets were resuspended in NeuroCult NS-A, supplemented with 20 ng/ml EGF, 10 ng/ml bFGF, 2 μg/ml heparine and proliferation supplement (Stem Cells Technologies Inc). The cells were cultured at 40,000 cells per cm² on uncoated dishes in the same medium. To analyze the effects of vitamin C, neurospheres were cultured for 7 days and were treated with 200 or 400 μM AA the last 4 days. The same concentration of vitamin C was added to the cultured cells each day.

Total RNA was isolated using Trizol (Invitrogen, Rockville, MD, USA). For RT-PCR, 1 μg of RNA was incubated in 10 μl reaction volume containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgCl₂, 20 U RNase inhibitor, 1 mM dNTPs, 2.5 μM of oligo d(T) primers, and 50 units of MuLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) for 10 min at 23°C followed by 30 min at 42°C and 5 min at 94°C. Parallel reactions were performed in the absence of reverse transcriptase to control for the presence of contaminant DNA. For amplification, a cDNA aliquot in a volume of 12.5 μl containing 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.6 mM MgCl₂, 0.4 mM dNTPs, 0.04 units of Taq DNA polymerase (Gibco-BRL) and 0.4 mM primers was incubated at 95°C for 5 min, 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s for 35 cycles with a final extension at 72°C for 7 min. PCR products were separated by 1.2–1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide. The following set of primers was used to analyze the expression of SVCT2: sense: 5′TGTTTCAGGCCAGTGCTTT 3′ and antisense: 5′GAAAGGATGGACGGCATACA 3′ (expected product of 457 bp). Additionally, the following sets of primers were used to analyze the expression of nestin and βIII-tubulin: nestin sense, 5′GGAGTCTCGCTTAGAGGTGC 3′ and antisense, 5′ CAGCAGAGTCCTGTATGTAGCC 3′ (expected product 103 bp) and βIII-tubulin sense, 5′ TTTATCTTCGGTCAGAGTGG 3′ and antisense, 5′ GAGCAGCAGTAGAAGTATGT 3′ (expected product 1500 bp).

Membrane proteins from P19 cells or neurospheres were obtained by homogenizing the cells in 0.3 mM sucrose, 3 mM DTT, 1 mM EDTA, 1.0 mg/ml PMSF, 1 mg/ml pepstatin A, 2 mg/ml leupeptin, and 2 mg/ml aprotinin. Total membranes were collected by high-speed centrifugation. For immunoblotting, 50 mg of membrane protein was loaded in each lane and separated by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate, transferred to PVDF membranes (0.45 μm pore, Amersham Pharmacia Biotech., Piscataway, NJ, USA) and probed against an anti-SVCT2 (1:100) antibody or a preabsorbed antibody (1:500) (García et al., 2005). The secondary antibody was rabbit anti-goat IgG coupled to peroxidase (1:5000). The reaction was developed with enhanced chemiluminescence according to the manufacturer's instructions (Amersham Corporation, Arlington Heights, IL).

P19 cells were carefully selected under the microscope to ensure that only plates showing uniformly growing cells were used at 200,000 cells/well. Additionally, neurospheres isolated from rat brain were also used for vitamin C uptake. The cells were incubated in buffer containing 15 mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), 135 mM NaCl, 5 mM KCl, 1.8 mM CaCl2, 0.8 mM MgCl2 at room temperature for 30 min. Uptake assays were performed in 500 ml of incubation buffer containing 0.1–0.4 mCi of 1-¹⁴C-AA (Dupont NEN, Boston, MA, USA, specific activity 8.2 mCi/mmol) to a final concentration of 100 mM. Data represent means ± SD of three experiments with each analysis performed in duplicate. To analyze the effect of AA on SVCT2 expression and function, P19 cells were pre-incubated with 400 mM AA for 4 days. Initial velocity transport assays were performed after incubation with 100 mM AA with or without 135 μM sodium chloride (replaced by sodium choline) or 20 μM cytochalasin B.

For inhibition experiments, statistical comparisons between two or more groups of data were carried out using analysis of variance (ANOVA, followed by Bonferroni post-test). P < 0.05 was considered to be statistically significant. The statistical software, GraphPad Instat 3.0 (GraphPad Software, Inc., La Jolla, CA 92037 USA), was used for data analysis.

The ventricular neurogenic niche of postnatal brains at 15 days showed a similar cellular structure to that described in the adult brain (Doetsch et al., 1997; Alvarez-Buylla and Garcia-Verdugo, 2002; Alvarez-Buylla and Lim, 2004). The ependymal cells were differentiated in the ventricular wall, and the SVZ was formed by different cell types (Figure 1). The migration of cells to the olfactory bulb, the RMS, was also assessed (Figures 1A, insets 1–2 and B). At 15 days, a positive reaction with anti-PCNA in the SVZ was observed (Figures 1A, inset 1, C,G); the ependymal cells were also labeled with anti-S100A (Figures 1D,H). Type-B precursor cells (GFAP-positive) were also detected in the SVZ (Figures 1E,I). βIII-tubulin expression was observed in neuroblasts (Figures 1F,J,K, arrows) surrounded by B-type cells reactive to GFAP (Figures 1L,M). GFAP-positive cells presented radial morphology, and their processes extended to the subventricular region (Figures 1L,M).

Mitotically active cells were next detected by in vivo BrdU administration. All the BrdU-positive cells were observed in the subventricular region (Figure 1N), a result that was confirmed by analysis with anti-S100, an ependymal cell marker (Figures 1O,P). Approximately, ten percentage of the BrdU-positive cells were also GFAP-positive (Figures 1Q–S). BrdU-positive cells were also detected at the RMS (Figure 1 N,Q).

Using in situ hybridization, SVCT2 mRNA expression was observed in the anterior ventricular zone and RMS (Figure 2A). SVCT2 mRNA expression was also located in other areas of the brain, including neurons of the hippocampus (Figure 2B), cerebral cortex (Figure 2D), and the cerebellum (Figure 2E). As a negative control, the sense probe was employed; no reaction was observed in the different cerebral areas analyzed (Figure 2C). Furthermore, a positive reaction to astrocytes was not observed; however, ependymal cells presented an intense reaction in different regions of the ventricular wall (data not shown).

García et al. (2005) had demonstrated that SVCT2 mRNA expression did not directly correlate with its protein levels. Specifically, neurons presenting an intense in situ hybridization signal for SVCT2 showed a weak immunoreactivity with anti-SVCT2. Thus, SVCT2 protein expression was determined using immunofluorescence and confocal microscopy in the neurogenic niche, and intense immunoreactivity in the anterior ventricular area and RMS was detected (Figure 3A, insets). The positive signal was observed in the ependymal cells and different cells present in the SVZ (Figure 3A, inset and arrows). To determine whether SVCT2 was associated with proliferative cells, co-localization analysis was undertaken with BrdU-positive cells (Figure 3B, insets). Most of the BrdU-positive cells were also SVCT2-positive (Figure 3C, insets), and a high percentage of these cells were localized in the SVZ (Figures 3C, insets and D–F). The number of BrdU/SVCT2-positive cells was next quantified in two rat brains; of 494 BrdU-positive cells in the neurogenic niche, 95.1% were also SVCT2-positive.

To determine the cell types within the neurogenic niche that express SVCT2, immunofluorescence analysis with triple labeling was undertaken (Figure 4). At 21-days postnatal development, SVCT2 did not co-localize with βIII-tubulin (Figure 4A) or with GFAP (Figure 5B). High power imaging in different regions of the neurogenic niche and in the RMS confirmed these observations (Figures 4C–N). SVCT2 reactions were observed in ependymal cells and cells located in the SVZ, again without co-localizing with GFAP (Figures 4D,H) and with low co-localization with βIII-tubulin (Figures 4E,I). A similar result was found in the RMS (Figures 4K–N), suggesting that SVCT2 is present in highly proliferative intermediate progenitors (C type cell or nIPC).

Analysis of the ventricular wall of a human brain at 1 month postnatal development was next performed. The presence of βIII-tubulin-positive neuroblasts in the SVZ was observed (Figure 5). These cells had varying morphologies; some were spherical and closely located to ependymal cells while others were more elongated and positioned tangentially to the ependymal layer (Figures 5A–C, arrows). Analysis of GFAP identified the subventricular astrocyte band that was located immediately below the ependymal cells (Figure 5D). Some cells had processes inserted among the ependymal cells, directly contacting the CSF (Figures 5E,F, inset and arrows). SVCT2 expression was identified in the ependymal cells and in the SVZ. Whereas the immunoreaction of the ependymal cells was intense throughout the whole cell, the reaction to SVCT2 was concentrated in specific areas of the cells in the SVZ (Figures 5G,J). The signal for SVCT2 rarely co-localized with GFAP-positive or βIII-tubulin-positive cells (Figures 5I,L).

Because various factors can enhance neural differentiation (Dhara and Stice, 2008), the effect of vitamin C on neural differentiation was determined using P19 cells. P19 cells form neurospheres in vitro, which are immunoreactive to nestin, SVCT2 and βIII-tubulin (Figures 6A–C). The expression of these markers was also confirmed using RT-PCR (Figure 6D) and Western blot analyses (Figure 6E). Moreover, functional studies revealed that AA is incorporated at a velocity of 100 pmoles × 10⁶ cells/min in the P19 cells, an uptake that remained constant for up to two min of transport (Figure 6F). In the absence of sodium, AA uptake was inhibited by 70% (Figure 6G). To confirm that AA is not being transported by GLUTs, AA transport was determined in the presence of cytochalasin B, an inhibitor of GLUT transporters that incorporates DHA. The presence of this molecule did not inhibit AA transport (Figure 6G). Consequently, these results indicate that P19 cells express functional SVCT2.

To evaluate the effect of vitamin C on neurosphere formation by P19 cells, the culture were maintained with MEM (Figure 6H,K,O) or supplemented with 200 or 400 μM AA for four days (Figures 6I,L,P). As a positive control, the neurospheres were cultured in neurobasal/B27 medium to stimulate neural differentiation (Figures 6J,M,N,Q). After culture in MEM alone, the neurospheres had a lower number of βIII-tubulin-positive cells, even when the majority of the cells in the neurosphere were slightly positive for SVCT2 (Figure 6K). After treating the neurospheres with 400 μM AA vitamin C, an increase in neural differentiation was detected as observed by the presence of intensely βIII-tubulin-positive cells (Figure 6I). These cells were also highly immunoreactive to SVCT2 (Figures 6L,P). A similar response was observed with neurospheres cultured with neurobasal/B27 medium (Figures 6J,M,Q). Western blot analysis confirmed that AA as well as neurobasal/B27 medium increased the levels of βIII-tubulin by two-fold (Figures 6R,S). Finally, AA-treated P19 cells increased AA incorporation by approximately six-fold as compared to the control (Figure 6T).

Similar results were observed using primary neurospheres isolated from the lateral wall of the lateral ventricle of adult rats supplemented with 200 μM AA or 400 μM (data not shown) for four days. After 7 days in vitro (Figure 7A), the neurospheres cells showed positive immunostaining for anti-GFAP and anti-nestin (Figures 7B,C); however, low immunoreaction was observed with anti-βIII-tubulin (Figure 7D). In addition, uptake of AA was inhibited by choline and quercetin (Figure 7E). When the cells were treated with AA, decreased anti-GFAP immunoreaction was observed (Figures 7F,G); however, the reaction for βIII-tubulin increased (Figures 7H,I,L,M). Additionally, an increased immunoreaction for SVCT2 was observed by immunohistochemistry and Western blot analyses (Figures 7J,K,L,N).

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.