To investigate the role of SKP2 in the host cell response to S. aureus, we first examined whether SKP2 abundance is modulated upon bacterial infection. We selected A549 cells, a human alveolar epithelial cell line that is commonly used as an in vitro model for respiratory infections, because of their relevance in studying host-pathogen interactions including intracellular pathogens (Surmann et al., 2015; Huo et al., 2025). For infection, we used S. aureus USA300 a major methicillin-resistant S. aureus (MRSA) clone of high clinical relevance, which is known for its ability to invade or persist within host cells (Rollin et al., 2017; Tranchemontagne et al., 2015). To eliminate extracellular bacteria while preserving those that had successfully invaded the host cells, lysostaphin was applied after one hour of infection.

Immunoblot analysis of the infected cells showed an increase of SKP2 levels 2 h, 3 h and 5 h post infection (Figures 1A, B). Infection also led to rapid reduction of IκBα within the first hours, with protein levels gradually restored over time, indicating that the NF-κB pathway was activated (Figures 1A, C). To further confirm NF-κB activation translocation of p65 into the nucleus was assessed and observed at 5 h post infection (Figure 1D). Cytokine determination in cell culture supernatants of infected cells showed increased concentrations of IL-6, significant at 5 h post infection, while IL-8 secretion increased progressively throughout the infection time course (Figures 1E, F). Lactate dehydrogenase (LDH) was also elevated, confirming infection-induced cytotoxicity (Figure 1G).

To confirm that the accumulation of SKP2 was not specific to A549 cells, we also infected primary small airway epithelial cells (SAECs), which represent naive airway epithelium and macrophage-like THP-1 cells, which serve as model for professional phagocytes involved in innate immune responses. A similar accumulation of SKP2 at 2 h, 3 h and 5 h post infection was observed in SAEC cells (Supplementary Figures 1A, B) and THP-1 cells (Supplementary Figures 2A, B). However, there were subtle differences between the cell lines in their reaction to S. aureus infection. NF-κB activation as reflected by reduced IκBα levels was prolonged in THP-1 cells when compared to A549 cells and SAEC (Supplementary Figures 1A, C, 2A, C). SAECs had high basal IL-6 secretion and secreted more IL-6 upon infection than A549 cells. They were also more resistant to cell death. However, high basal cytokine secretion in non-infected SAECs may reflect a cell type–specific effect, potentially influenced by the growth conditions under which the cells were cultivated (Supplementary Figures 1D-F). In THP-1 cells a strong IL-1β release indicated pyroptosis induction, which was also reflected in higher cell death shown by increased LDH release (Supplementary Figures 2D, E). These results indicate that the increase in SKP2 is a general process observed in different cell types upon infection with S. aureus.

Subsequent analysis of skp2 expression in the context of S. aureus infection revealed a disconnection between SKP2 mRNA and protein levels. While SKP2 protein levels were elevated in infected epithelial cells, the corresponding mRNA levels decreased slightly (Figure 2A). These results indicated that the SKP2 protein might be stabilized by post-translational modifications in response to S. aureus infection.

Because acetylation of SKP2 prevents its proteasomal degradation in cancer cells (Kitagawa et al., 2008; Gao et al., 2009; Bashir et al., 2010; Inuzuka et al., 2012; Geng et al., 2017), we examined whether a similar effect occurs in response to S. aureus infection. Following immunoprecipitation of SKP2 from infected A549 and THP-1 cells, we detected lysine acetylation by immunoblotting (Figure 2B; Supplementary Figure 3A). Furthermore, acetylation of SKP2 at lysine residues K68 and K71 has been shown to be mediated by the histone acetyltransferase p300 (Inuzuka et al., 2012). Consistent with this finding, treatment of S. aureus infected cells with the p300-specific inhibitor C646 resulted in reduced SKP2 levels (Figure 2C). To exclude significant toxic effects of the inhibitor during infection, we monitored cell death by assessing poly (ADP-ribose) polymerase (PARP) cleavage, which exhibited a modest increase following inhibitor treatment (Figure 2C). These results suggest that acetylation-mediated stabilization of SKP2 contributes to its increased abundance during infection.

Next, SKP2 acetylation was assessed by immunoprecipitation from nuclear and cytoplasmic fractions following S. aureus infection. Here, acetylated SKP2 was detected in both fractions (Figure 2D), suggesting a potential change in SKP2 subcellular distribution upon infection, since p300 has been shown to be predominantly nuclear (Shi et al., 2009). Under non-infected conditions, SKP2 displayed dual localization in the cytoplasm and nucleus, with the majority in the nucleus (Asmamaw et al., 2023). However, upon infection-induced acetylation, a translocation of SKP2 from the nucleus to the cytoplasm was observed, as evidenced by both subcellular fractionation with immunoblotting and immunofluorescence microscopy (Figures 2E, F). Together, these observations provide strong evidence for an increase in acetylated SKP2 diffusing into the cytoplasm upon S. aureus infection, suggesting a potential impact on its cellular function.

Next, we addressed the question what triggers SKP2 stabilization during S. aureus infection. To this end, A549 cells were treated with different concentrations of recombinant S. aureus protein A (SpA), a multi-functional virulence factor expressed by the pathogen (Gómez et al., 2004). Treatment with SpA from 1 h to 6 h revealed a rapid increase in SKP2 abundance similar to that observed upon infection with S. aureus suggesting a role of SpA in modulating SKP2 protein levels (Figures 3A, B). To confirm this, we infected the cells with a USA300Δspa strain that is deficient in SpA and compared SKP2 levels to cells infected with the wild-type USA300 strain. As expected, the wild-type strain induced a significantly higher abundance of SKP2 in host cells after 5 h infection than USA300Δspa (Figures 3C, D).

To investigate the role of SKP2 in regulating cellular processes, siRNA-mediated knockdown of SKP2 was performed in A549 cells. The high virulence of S. aureus USA300 complicated the analysis because the bacteria induced substantial host cell death upon SKP2 knockdown. Therefore, we utilized the S. aureus strain HG001, which was less cytotoxic, enabling a thorough investigation of the effects of SKP2 knockdown on bacterial survival. There was a substantial increase in intracellular bacterial colony-forming units (CFUs) upon SKP2 knockdown compared to the infected non-targeting control (NTC) cells 5 h post infection (Figure 4A). Despite the stabilization of residual SKP2 in the siRNA-treated cells following infection, a substantial accumulation of the SKP2 substrate protein, cell cycle inhibitor p27, could be observed, indicating a substantial decrease in SKP2 activity within these cells (Figures 4B-D).

A similar increase in intracellular CFUs could be obtained by treating the cells with the SKP2-specific inhibitor SZL-P141 (Supplementary Figure 3B). Moreover, co-application of the inhibitor to siRNA-treated cells further amplified the intracellular CFU counts (Supplementary Figure 3B). However, the increase in the number of intracellular live S. aureus had no effect on secretion of the cytokines IL-6 and IL-8 by the infected host cells (Supplementary Figures 3C, D).

To explain the observed increase in intracellular bacteria upon SKP2 knockdown, we aimed to ascertain the precise function of SKP2 during the infection process. SKP2 plays an important role during cell cycle progression. A previous study suggested that S. aureus invasion slows down host cell proliferation due to a specific delay in the G2/M phase transition, which benefits intracellular bacterial survival (Alekseeva et al., 2013). We therefore investigated if a similar cell cycle delay upon SKP2 inhibition was causing a higher intracellular bacterial load. However, single or combined SKP2-knockdown and inhibition had no effect on cell cycle progression in S. aureus-infected cells especially on the cells of the G2 phase (Supplementary Figure 3E).

Given the translocation of SKP2 to the cytoplasm following infection, we next investigated the impact of SKP2 knockdown on selective autophagy. The protein LC3 serves as a key marker of autophagy, with LC3-II specifically indicating the formation of autophagosomes (Muñoz-Sánchez et al., 2020). Upon siRNA-mediated downregulation of SKP2, we observed an increase in LC3-II formation, indicating an upregulation of autophagy (Figures 4B, E). This suggests that SKP2 may interfere with autophagy during infection.

To further confirm this, we generated an expression vector with SKP2 carrying the K145R and K228R point mutations (pcDNA3.1 SKP2^{K145R K228R}) to prevent ubiquitination and subsequent degradation by proteasomes. The mutated amino acid residues correspond to ubiquitination sites of SKP2 according to mUbiSiDa, a comprehensive database for mammalian protein ubiquitination sites (Chen et al., 2014). Overexpression of SKP2 in A549 cells did not result in a robust increase on protein level (data not shown). However, we observed a consistent higher abundance of SKP2^{K145R K228R} compared to SKP2 wildtype and transfected controls in HeLa cells (Supplementary Figure 4A). Therefore, we had to focus our subsequent experiments on HeLa cells, to investigate the impact of SKP2 overexpression on autophagy and intracellular S. aureus survival. As S. aureus is known to elicit cell-type-specific responses we first tested whether HeLa cells exhibit a comparable increase in SKP2 levels upon infection. To this end, we infected HeLa cells with S. aureus HG001 (MOI 10 and 20) for 2 h, 3 h and 5 h and observed a similar increase in SKP2 to that seen in A549 cells (Supplementary Figures 4B, C). To determine whether SKP2 overexpression modulates autophagy during bacterial infection, HeLa cells were transfected with the pcDNA3.1 SKP2^{K145R K228R} vector and subsequently infected with S. aureus HG001. The number of viable S. aureus was significantly reduced in cells overexpressing SKP2 ^{K145R K228R} in comparison with the controls, confirming SKP2’s contribution to the elimination of intracellular bacteria (Figure 5A). SKP2 overexpression also markedly reduced LC3-II accumulation upon infection, confirming that high levels of SKP2 suppress S. aureus-induced autophagy (Figures 5B-D). To further investigate whether high levels of SKP2 inhibit autophagy under non-infectious conditions as well, we assessed the formation of LC3-II upon treatment with rapamycin alone or in combination with bafilomycin A1 (Mauvezin and Neufeld, 2015). Rapamycin, an mTOR inhibitor, induces autophagy by promoting autophagosome formation, whereas bafilomycin A1 blocks autophagosome-lysosome fusion, preventing autophagic degradation and leading to autophagosome accumulation. Rapamycin treatment alone increased LC3-II lipidation in HeLa cells, indicating enhanced autophagosome formation, which was even increased upon addition of bafilomycin indicating a high autophagic flux (Figures 5E, F). Although the overexpression of SKP2^{K145R K228R} had no effect on basal levels of LC3-II, the induction of autophagy using rapamycin resulted in a reduction in LC3-II lipidation in these cells compared to the control cells. When treated with a combination of rapamycin and bafilomycin the transfection with the SKP2^{K145R K228R} mutant reduced the levels of LC3-II compared with transfection with the empty vector. This clearly shows that SKP2 downregulates autophagy (Figures 5E, F).

In summary, these results indicate a prominent role of SKP2 in regulating autophagy, enabling the elimination of intracellular S. aureus while preventing excessive autophagy to be exploited by S. aureus.

The human alveolar epithelial cell line A549 (Lieber et al., 1976) and the cervical cancer cell line HeLa (ATCC #CCL-2) were cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (FCS; Capricorn). Small Airway Epithelial Cells (SAEC; Lonza) were cultured according to the manufacturer’s instructions using SAGM™ BulletKit™ medium (Lonza). THP-1 monocytes (ATCC #TIB-202) were cultured in RPMI 1640 medium (Gibco) with 10% FCS (Capricorn), stimulated with 100 ng/mL phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich) for 24 h to induce differentiation, and subsequently rested for 48 h prior to further use.

Staphylococcal protein A (SpA, Sigma), rapamycin (Sigma), bafilomycin A1 (Selleckchem), C646 (MedChemExpress) and SZL-P141 (Selleckchem) were used for cell treatment throughout the study at the indicated concentrations and time points described below.

S. aureus USA300, derived from strain JE2, is a community-associated methicillin-resistant S. aureus (CA-MRSA) strain (Fey et al., 2013). S. aureus USA300Δspa, a kind gift of Jan Marten van Dijl, is a transposon mutant of JE2, with a deletion of the spa gene, which encodes protein A (Bae et al., 2008). S. aureus HG001 strain derived from the widely studied S. aureus strain NCTC8325 (Herbert et al., 2010, p. 832). All strains were maintained in tryptic soy broth (TSB, Roth) 37°C and 220 rpm or on blood agar plates (BD Biosciences) at 37°C. For cellular internalization assays, S. aureus was initially grown in TSB as a pre-culture for 2 h until reaching an optical density (OD₆₀₀) of 0.8. Subsequently, the bacteria were inoculated and cultured into RPMI medium supplemented with 10% fetal calf serum (FCS) or SAGM™ BulletKit™ medium and grown until an OD₆₀₀ of 0.35 was achieved. All S. aureus experiments were conducted in a BSL-2 laboratory approved by the regulatory authority of Mecklenburg–Western Pomerania (LAGuS 3021-07/17).

The infection protocol was adapted from a protocol described before to meet the criteria of the present study (Palma Medina et al., 2019; Pförtner et al., 2013; Plöhn et al., 2025). Cells were infected with S. aureus at a multiplicity of infection (MOI) of 10. For S. aureus internalization, an infection master mix was prepared by combining the respective strain of S. aureus (in RPMI with 10% FCS) with 2.9 μl of 7.5% NaHCO₃ per ml of bacterial culture. This mixture was added to the cells, with a determined cell number and the co-incubation was carried out at 37°C with 5% CO₂ for 1 h to allow bacterial internalization. During this incubation, 100 μl of the infection master mix were diluted in PBS without Mg²⁺ or Ca²⁺ and plated on blood agar to determine the bacterial count, which was later used to calculate the precise MOI achieved. Following the 1-hour incubation, the infection master mix was removed, and pre-warmed RPMI containing lysostaphin (Amibion) (final concentration: 10 μg/ml) was added. Cell cultures were then incubated again at 37°C and 5% CO₂. At different time points post lysostaphin treatment the culture medium was removed, and the cells were washed with PBS. Cells were collected in 500 µl of TRIzol™ reagent (Thermo Fisher Scientific) for subsequent immunoblotting.

Cells were lysed at indicated time-points post infection through hypotonic lysis using bidistilled water (Aqua bidest.) for 30 min. Serial dilutions from 10^-3 – 10–⁵ of the released bacteria in Aqua bidest. were plated on blood agar plates. CFU counts were determined after 24 h incubation at 37°C and the mean CFU numbers were calculated from all dilutions. For normalization, a technical replicate of the infected cells was harvested using 1% trypsin (Capricorn Scientific) and subsequently counted using trypan blue staining to exclude dead cells in a counting chamber (Neubauer). Finally, CFUs were normalized to 1 x 10⁵ viable cells.

Proteins were extracted using TRIzol™ reagent following the manufacturer’s guidelines and quantified via Bradford assay. For immunoblotting, proteins were resolved by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with primary antibodies against SKP2 (#2652, LOT:5), IκBα (#4814, LOT:21), LC3 (#12741, LOT:5), p27 (#3686, LOT:8), β-actin (#3700, LOT:21), lamin A (#86846, LOT:3), MEK1/2 (#4694, LOT:2; all from Cell Signaling Technology), anti-acetyl lysine antibody (#ab21623, LOT: 1010926-6; Abcam) and subsequently detected using species-specific HRP conjugated secondary antibodies (Dianova). For the densitometric analysis of SKP2, both bands were considered, referring to the possible existence of SKP2 isoforms (Radke et al., 2005). Membranes were visualized using chemiluminescence with SignalFire™ ECL Reagent (Cell Signaling Technology) and analyzed with the ImageQuant 800 system (Cytiva).

Cell lysates (100–200 µg total protein) were prepared using radioimmunoprecipitation assay (RIPA) lysis buffer supplemented with protease inhibitors. For immunoprecipitation (IP), 1 µL (1 µg) of SKP2 antibody (#32-3300, LOT: ZL407327; Invitrogen) was added to each lysate and incubated overnight at 4°C on a rotator. Magnetic beads (100 µL of 10 mg/mL Sure Beads Protein G, BioRad for IPs with A549 cell lysates and 100 µL of 10 mg/mL Protein G Magnetic Beads, Hycultec for IPs with THP-1 cell lysates) were equilibrated and washed three times with PBS containing 0.1% Tween, then incubated with the antibody-lysate mixture for 4 h at 4°C. After incubation, beads were separated using a magnetic rack and subsequently washed three times with lysis buffer to remove unbound material. For sample preparation, beads were resuspended in SDS sample buffer, heated at 95°C for 5 min and centrifuged at 14,000–16,000 g for 1 min. The prepared samples were further analyzed via immunoblotting.

Cell viability was assessed by measuring the LDH content in cell supernatants using the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega) following the manufacturer’s instructions. Briefly, 50 µL of supernatant were incubated with 50 µL of substrate solution for 10 min. The reaction was then halted by adding 25 µL of Stop solution. Supernatants from non-infected cells treated for 10 minutes at 37°C with 10% TritonX 100 (AppliChem) were used as a positive control to represent 100% cell death. Samples were read at 590 nm using a plate reader (Tecan).

ELISA for IL-6, IL-8 and IL-1β (all BioLegend) was performed according to manufacturer’s instructions. In brief, plates were coated with the included capture antibody and incubated for 16–18 h at 4°C. After washing (3 times, PBS + 0.5% Tween-20). Plates were blocked for 1 h at 500 rpm, washed, and incubated with standards or samples for 2 h with shaking. After washing, plates were treated with biotinylated detection antibody (1 h), avidin-HRP (30 min), and TMB substrate (15 min, dark), followed by stop solution (2 N H₂SO₄) and absorbance measurement at 450 nm.

Nuclear and cytoplasmic protein fractions were isolated using freshly prepared buffers A-M: 15 mM potassium chloride (KCl), 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2 mM magnesium chloride (MgCl₂), 0.1 mM ethylenediaminetetraacetic acid (EDTA); supplemented with protease inhibitors, 10 µl dithiothreitol (DTT), and 0.1% Nonidet P-40 (NP-40); and C-M: 0.42 M sodium chloride (NaCl), 20 mM HEPES, 25% glycerol, 0.2 mM EDTA; supplemented with protease inhibitors, 5 µl DTT, and 0.1% NP-40. Cells were washed with ice-cold PBS, scraped into PBS containing cOmplete™ EDTA-free protease inhibitor cocktail (Sigma-Aldrich), and pelleted by centrifugation. The pellet was resuspended in Buffer A-M and incubated on ice, followed by NP-40 treatment. After centrifugation 10,000 × g for 10 minutes at 4°C, the supernatant containing cytoplasmic proteins was collected. The remaining nuclear pellet was washed with ice-cold PBS, resuspended in Buffer C-M, and incubated on a thermoshaker at 4°C for 15 min to release nuclear proteins, which were recovered after centrifugation. Protein concentrations were determined via the Bradford assay, and samples were denatured in 4× sample buffer at 95°C. For cytoplasmic extracts, proteins were precipitated with trichloroacetic acid (TCA), washed with ice-cold acetone, air-dried, and resuspended SDS sample buffer. Samples were homogenized for 1 h, heated at 95°C for 5 minutes analyzed via immunoblotting.

Cells were seeded in 12-well cell culture plates containing autoclaved glass cover slips. Infection with S. aureus (MOI10) was carried out as described above. At 4 h post lysostaphin treatment cells were washed with PBS. Samples were fixed with 2% paraformaldehyde (PFA) in PBS for 10 min at room temperature, rinsed twice in PBS (5 min each), and permeabilized with 0.1% Triton X-100 in PBS for 15 min. After two additional PBS washes, samples were blocked in 2% bovine serum albumin (BSA) in PBS for 1 h at room temperature. Cells were incubated overnight at 4°C with mouse anti-SKP2 primary antibody (Invitrogen), followed by three PBS washes. The secondary antibody (Alexa Fluor-conjugated anti-mouse goat IgG, 1:400 in 0.2% BSA/PBS) was applied for 2 h at room temperature in the dark. After three further PBS washes, nuclei were stained with DAPI (Thermo Fisher Scientific), rinsed in PBS, and mounted using fluorescence mounting medium (DAKO).

Cells were treated with the SKP2 inhibitor SZL P141 (20 µM) or transfected with SKP2-targeting siRNA as described above, followed by infection with S. aureus according to the previously described protocol. After the indicated incubation period, cell cycle analysis was performed using Vybrant™ DyeCycle Violet Stain following the manufacturer’s instructions. Data acquisition was carried out on a MACSQuant Analyzer 10 flow cytometer (Miltenyi Biotec), and analysis was performed using FlowJo™ v10.6.0 software.

For overexpression experiments the SKP2 construct was cloned into the mammalian overexpression vector pcDNA3.1Myc/His (Thermo Fisher Scientific) using the pOTB7-SKP2 vector provided by the mammalian gene collection (Dharmacon) as template. Mutations for lysine to arginine at position 145 and 228 were introduced using the Q5^® Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s description using the following mutagenesis primers K145R_fwd 5´- cctcacaggtcgcaatctgcacc – 3´ and K145R_rev 5´- tctaaggtctgccatag - 3´; K228R_fwd 5´- tactctcgcacgcaactcaaatttagtgc -3´ and K228R_rev 5´- ttgacaatgggatccg - 3´. The obtained pcDNA3.1 SKP2^{K145R K228R} constructs were transformed into chemically competent E. coli and verified by Sanger sequencing (Eurofins Genomics).

Cells were seeded 24 h prior to transfection at a density of 2 × 10⁵ cells per well in 6-well plates. The following day, cells were transfected with either plasmid DNA for overexpression pcDNA3.1 myc/his SKP2 (pcDNA SKP2), pcDNA3.1 myc/his SKP2^{K145R K228R} (pcDNA SKP2mut) or empty vector control pcDNA3.1 myc/his; 5 µg per well or with siRNA for knockdown (SKP2-siRNA or non-targeting control siRNA, Dharmacon) using ScreenFect^® A (ScreenFect GmbH) according to the manufacturer’s instructions. DNA/siRNA and ScreenFect A were diluted in ScreenFect buffer, mixed, and incubated for 20 min at room temperature to allow complex formation. Complexes were then added dropwise to cells cultured in RPMI medium without serum. After 4 h, the medium was supplemented with RPMI containing 10% FCS, and cells were incubated under standard conditions. HeLa cells were infected 24 h post-transfection, whereas A549 cells were allowed to rest for 48 h before infection.

Densitometric analysis of the immunoblot results was performed using ImageJ software (version 1.54g; National Institutes of Health, USA). Experiments were presented as means +/- SD and Student’s t-test was used to compare differences between analyzed samples. All statistical analyses were performed using GraphPad Prism software, version 9, and were considered significant at *P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.