We amplified the E2 gene by PCR using the primers F: AGCTGCATCAAACGTCAGGATTA and R: GTGACGGTACATGGTCGCCG. Sequences of APPV from different countries were processed by the Clustal W method, and phylogenetic trees were constructed by the neighbor-joining method using MEGA 7 software. Bootstrap values were indicated for each node from 1000 replicates. Additionally, 48 reference strains were chosen from Genbank for inclusion in the phylogenetic analysis ( Supplementary Table S1).

According to the E2 sequences of APPV obtained from disease pigs infected APPV (Genbank: MW760398), the plasmid pET28a-APPV E2 was constructed, which contained 6 × His tag at the C terminus without endogenous transmembrane domain, and was maintained in our laboratory. The plasmid pET28a-APPV E2 was transformed into E. coli BL21 (Biobw, Beijing, China, bio- 82078) and identified by PCR and sequencing.

The E. coli BL21 containing plasmid pET28a-APPV E2 were harvested by centrifugation and then dissolved with the buffer (8M Urea, 50 mM Tris HCl, 300 mM NaCl, 0.1% Triton X-100, pH 8.0) and purified by Ni-NTA affinity chromatography. The purified protein was dialysis with the buffer (50mM Tris, 300mM NaCl, 0.1% SKL, pH8.0), then concentrated with PEG20000.The protein concentration was analyzed using BCA protein quantitative kits (Thermofisher). Then, protein was analyzed by Western blot. The Anti-His Tag(Abbkine, Wuhan, China, ABT2050)was used as the primary antibodies at a diluted dilution of 1:2000. And horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Boster Biological Technology, Wuhan, China) was used as the secondary antibody at a dilution of 1:150.

The purified APPV E2 protein was diluted to an appropriate concentration with sterile PBS, then was emulsified with ISA 201VG adjuvant (Seppic, Paris, France) at a ratio of 1:1 (w/w), IMS 1313VG adjuvant (Seppic, Paris, France) at a ratio of 1:1 (v/v), and Montanide GEL 02 adjuvant (Seppic, Paris, France) at a ratio of 95:5 (v/v), in accordance with the manufacturer’s instructions. Finally, the protein content of vaccine is 100 µg/ml.

All procedures were performed following the protocols approved by the animal ethics and welfare committee of Qingdao Agricultural University. The pigs, which were 3–4 weeks old and tested negative for the pathogens and antibodies of PCV2, PRRSV, PPV, HPS, and APPV, were obtained from a commercial pig farm. The pigs were divided into four groups, and five pigs were in each group. Group A, the negative control group, was intramuscular injected with 2 mL sterile PBS. Group B was intramuscularly vaccinated with 2 mL per serving (ISA 201VG adjuvant). Group C was intramuscularly vaccinated with 2 mL per serving (IMS 1313VG adjuvant). Group D was intramuscularly vaccinated with 2 mL per serving (Montanide GEL 02 adjuvant). All pigs were injected with the same vaccine dose at 21 days post-primary immunization (dpi). Serum samples were collected at 0, 7, 14, 21, 28, and 35 days post-primary vaccination, and stored at −20°C until use.

Anti-E2 detection in the serum samples obtained from vaccinated pigs, was performed using ELISA. Ninety-six-well flat-bottomed plates were coated with purified E2 protein (0.3125 μg/well), diluted in 0.05 mol/L carbonate buffer (pH 9.5), and placed at 4 °C overnight. The plate was washed three times and blocked with PBS containing 1% BSA (0.01 mol/L, pH 7.2). After washing with PBST three times, the serum samples diluted with PBST (1:200) were added to the wells and incubated at 37°C for 2 h. The plate was washed again and incubated with HRP-conjugated goat anti-pig IgG (1:8000) (Bethyl, USA) at 37 °C for 1h. TMB (3,3´,5,5´-tetramentylbenzidine) (Thermo Scientific) was added to the plate and incubated for 15 minutes at room temperature. The reaction was stopped by adding 2 M H2SO4 solution, and read at 450 nm in a µQuant micro-plate spectrophotometer (Tecan Austria GmbH). Each sample was repeated three times for the ELISA. Finally, total titers were determined by S/N (S/N=the OD450 value of samples/the OD450 value of negative control serum).

Whole blood, which was negative for the virus of CSFV, PCV2, PRRSV, and PPV and positive for the APPV virus, from an onset of pig from Guangzhou, was filtered (through 0.22 μm) and diluted 1:3 by sterile PBS (pH 7.2). The virus content was determined by RT-qPCR, CT = 19.17, then stored at -80°C. On the 14 days after the booster vaccination, the whole blood containing APPV was thawed and held on ice, all pigs in Group A (PBS control group) and B (ISA 201VG adjuvant vaccine group) were challenged by intramuscular with 3 mL/pig. After challenge, all pigs were monitored daily, and rectal temperatures were taken each day until 14 days. The animals were euthanized by administering pentobarbital sodium (150 mg/kg) via IV injection, blood and organs (heart, liver, spleen, lungs and kidneys, submandibular lymph nodes, inguinal lymph nodes, intestine, hip muscles and cerebellum) were collected from each pig on the 14th day.

A qRT-PCR targeting the NS3 region of the genome of APPV was used in this study (F:5’-ATTGGCTGTCTGAGGACTTCG -3’, R:5’-GAGTATCCCAAGCTTTA GTGTC-3’). One step TB Green^® PrimeScriptTM RT-PCR Kit II (Takara, Japan) was carried out in a 20µl reaction containing 2µl of RNA, 0.8 µl of each primer (10µM), 10 µl of 2X One step TB Green RT-PCR buffer, 0.8µl of PrimeScript 1 Step Enzyme Mix, 0.4 µl of ROX Reference Dye II, 5.2 µl of RNase Free dH2O. The reaction took place using American Applied Biosystems (ABI) 7500 real-time fluorescent quantitative PCR detection system under the following conditions: initial reverse transcription at 42°C for 5 min, followed by initial denaturation at 95°C for 10s, 40 cycles of denaturation at 95°C for 5 s and annealing and extension at 60°C for 34 s. The CT values were detected. A cut-off for positive samples was established at CT values lower than 36, according the previous research (Gatto et al., 2018).

Pathological tissue samples including inguinal lymph node, submandibular lymph node, spleen, liver, kidneys and cerebellum were obtained during necropsy from each animal. All the samples were cut into approximately 1.5 cm³ and fixed in 4% neutral paraformaldehyde phosphate buffer (pH 7.3) about 72h. After fixation, the tissue blocks are rinsed with running water, followed by dehydration using a graded alcohol series, and then embedded to prepare paraffin sections (5µm). Subsequently, the tissue sections were stained with hematoxylin and eosin (H&E; Sigma-Aldrich, USA) and examined under a light microscope (OLYMPUS, Japan) to evaluate their pathological changes.

All statistical analyses were performed using IBM SPSS (SPSS Inc, Chicago, IL, USA). The APPV E2-specific antibody among the study groups are expressed as the mean ± standard deviation (SD). Statistical significance was determined by using one-way ANOVA. A p-value < 0.05 was considered statistically significant.

Phylogenetic analysis was performed to determine the relationship of CH/GD/2019/12 with other APPV strains. Phylogenetic analysis based on the E2 ORF sequences indicated CH/GD/2019/12 is in a branch with other strains found in Jiangxi, Henan, Shanxi, Hebei, and other provinces in China (Figure 1).

The construction diagram of pET28a-APPV E2 is presented in Figure 2A. The APPV E2 protein induced by IPTG was purified using Ni-NTA chromatography and analyzed by Western blot (Figure 2B), showed that APPV E2 protein was successfully expressed, the size of the protein was approximately 28 kDa.

As displayed in Figure 3, the serum titers of pigs immunized with three vaccines were significantly higher than those of the PBS control group (p < 0.05). The levels of APPV E2-specific antibody for Groups B (E2- IMS 201VG), and D (E2-GEL 02VG) displayed higher titers at 35 dpi (mean of S/N values were 49.00 and 44.61, respectively), the level of APPV E2-specific antibody for Group C (E2-IMS 1313VG) displayed lower titer at 35 dpi (mean of S/N value was 16.38). From 7 to 35 days after immunization, the pigs from E2- ISA 201VG group had the highest antibodies level, however, the antibody titers of pigs in control group were always negative (S/N < 2.5).

From 0 ~ 14 dpi, the body temperature of all the challenged pigs, including the immune group and the control group, was normal (38.7 °C ~ 39.4 °C) and had no significant difference clinical symptoms.

From Figure 4, we see that in all organs from the PBS group, the CT values were all positive, which indicated that organs had higher viral titer (CT < 29, 21.80 ~ 28.62). In this, the APPV in lymph nodes (inguinal lymph nodes and submandibular lymph nodes) were the highest (CT = 21.80 and CT = 22.53, respectively), followed by that of the cerebellum (CT = 23.31), spleen (CT = 24.17), and heart (CT = 24.21). From the E2-ISA 201VG group results, the CT values were all negative, the APPV of all the organs had no virus (CT > 36, 36.87~38.11).

The histopathological results showed that, compared with the vaccine group, the inguinal lymph nodes, submandibular lymph nodes, spleen, liver, kidneys and cerebellum in the control group, which infected with APPV showed serious histopathological damage (Figures 5, 6, Supplementary Figures 1-3). Microscopic examination revealed connective tissue hyperplasia and thickening of the trabeculae within the inguinal and submandibular lymph nodes, with destruction of the original architecture of the lymphatic follicles. Lymphoid tissue exhibits severe edema and vacuolation, where lymphocytes have disappeared and been replaced by reticular tissue, indicating chronic connective tissue hyperplasia. The spleen exhibited a marked reduction of white pulp and thinning of the periarterial lymphatic sheath, accompanied by prominent connective tissue hyperplasia in the red pulp and a significant decrease in lymphocyte density. The liver showed severe vacuolar degeneration involving most of the parenchyma and poorly defined hepatic lobules. Most of the lining epithelial cells of the renal tubules have atrophied and undergone simplification, causing dilation of the tubular lumina. Significant lesions were also observed in the control group’s cerebellum, with loosened architecture and mild edema in both cortex and medulla. The Purkinje cells lost their distinctive architecture. It should be noted that no significant inflammatory cell infiltration or extensive hemorrhage was detected throughout all samples examined.