<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2025.1662902</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Coinfection of <italic>Chlamydia psittaci</italic> and <italic>Enterococcus faecalis</italic> exacerbated respiratory distress in patients: from isolation to mouse model</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Zhang</surname>
<given-names>Xuedi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3102387/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Yihui</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Yuhan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Cui</surname>
<given-names>Yuehui</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3137602/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Huimin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Zongyang</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Luo</surname>
<given-names>Lin</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tang</surname>
<given-names>Linlin</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3048314/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Jianlin</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1467795/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>He</surname>
<given-names>Cheng</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/242750/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>National Key Laboratory of Veterinary Public Healthy Security, College of Veterinary Medicine, China Agricultural University</institution>, <addr-line>Beijing</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Critical Care Medicine, The Second People&#x2019;s Hospital</institution>, <addr-line>Changde, Hunan</addr-line>,&#xa0;<country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Reproductive Medicine Centre, Department of Obstetrics and Gynecology, The Second Xiangya Hospital, Central South University</institution>, <addr-line>Changsha, Hunan</addr-line>,&#xa0;<country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2062950/overview">Mohamed A. Abouelkhair</ext-link>, Rowan University, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/77282/overview">Lihua Song</ext-link>, Beijing University of Chemical Technology, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1556964/overview">Chuan Wang</ext-link>, University of South China, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Cheng He, <email xlink:href="mailto:hecheng@cau.edu.cn">hecheng@cau.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>10</day>
<month>10</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>15</volume>
<elocation-id>1662902</elocation-id>
<history>
<date date-type="received">
<day>09</day>
<month>07</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>22</day>
<month>09</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Zhang, Wang, Wang, Cui, Wang, Huang, Luo, Tang, Chen and He.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Zhang, Wang, Wang, Cui, Wang, Huang, Luo, Tang, Chen and He</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Background</title>
<p>This study aimed to isolate and identify <italic>Chlamydia psittaci</italic> (<italic>C. psittaci</italic>) and <italic>Enterococcus faecalis</italic> (<italic>E. faecalis</italic>) from a patient suspected of community-acquired pneumonia.</p>
</sec>
<sec>
<title>Methods</title>
<p>The samples from the patient (lung lavage and throat swab) and his son (throat swab) were tested to determine antibodies against COVID-19 and <italic>C. psittaci</italic>-specific IgG. Afterward, 40 female mice were inoculated intranasally with coinfection of <italic>C. psittaci</italic> and <italic>E. faecalis</italic> and primary infection of <italic>C. psittaci</italic> followed by <italic>E. faecalis</italic>. Meanwhile, eight mice with <italic>C. psittaci</italic> and <italic>E. faecalis</italic> infection alone served as the control group. Clinical signs, lung lesions, and pathogen loads were monitored.</p>
</sec>
<sec>
<title>Results</title>
<p>Positive <italic>C. psittaci</italic> genomics were detected in both the patient&#x2019;s lung lavage and his son&#x2019;s swabs, while <italic>C. psittaci</italic> and <italic>E. faecalis</italic> were isolated and identified from the patient&#x2019;s lung lavage samples. Moreover, positive <italic>C. psittaci</italic>-specific IgG and negative COVID-19 antibodies were determined. The patient recovered after 10-day doxycycline treatment. Mice showed weight loss, breathing difficulties, and diffuse alveolar damage after inoculation with <italic>C. psittaci</italic> followed by <italic>E. faecalis</italic>.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Our experiment demonstrated that coinfection, particularly sequential infection with <italic>C. psittaci</italic> followed by <italic>E. faecalis</italic>, can duplicate severe respiratory distress and typical pathological lesions.</p>
</sec>
</abstract>
<kwd-group>
<kwd>
<italic>Chlamydia psittaci</italic>
</kwd>
<kwd>
<italic>Enterococcus faecalis</italic>
</kwd>
<kwd>respiratory distress</kwd>
<kwd>coinfection</kwd>
<kwd>patient</kwd>
</kwd-group>
<contract-num rid="cn001">2022YFC2304000</contract-num>
<contract-sponsor id="cn001">Ministry of Science and Technology of the People's Republic of China<named-content content-type="fundref-id">10.13039/501100002855</named-content>
</contract-sponsor>
<counts>
<fig-count count="9"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="27"/>
<page-count count="11"/>
<word-count count="5127"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Veterinary and Zoonotic Infection</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Since December 8, 2019, several cases of unknown respiratory disease have been reported in Wuhan, Hubei Province, China. Subsequently, Changde, Beijing, Shanghai, Japan, and Korea reported severe febrile respiratory illness that spread to household members and healthcare workers (<xref ref-type="bibr" rid="B6">Ciotti et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B10">Islam et&#xa0;al., 2022</xref>). Clinically, it was difficult to differentiate between novel coronavirus and <italic>Chlamydia psittaci</italic> infection, with similar symptoms including high fever, sore throat, and dry cough (<xref ref-type="bibr" rid="B5">Cianfarani, 2019</xref>; <xref ref-type="bibr" rid="B11">Jin et&#xa0;al., 2021</xref>). Moreover, <italic>C. psittaci</italic> infection is similar to other types of community-acquired pneumonia, including <italic>Chlamydia pneumoniae</italic>, <italic>Legionella pneumophila</italic>, <italic>Mycoplasma pneumoniae</italic>, and human metapneumovirus (<xref ref-type="bibr" rid="B19">Qin et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B16">Liu et&#xa0;al., 2023</xref>). In 2020, four medical workers were diagnosed with <italic>C. psittaci</italic> pneumonia during routine COVID-19 screening in the Second Xiangya Hospital, Hunan, China (<xref ref-type="bibr" rid="B13">Lei et&#xa0;al., 2021</xref>).</p>
<p>A 50-year-old farmer who was a patient at the time also experienced severe breathing difficulties with a high fever. The patient had an initial medical history of heart disease and diabetes for up to 7 years. Following his sickness, he was admitted to the Second People&#x2019;s Hospital of Changde, Hunan, China, on December 13, 2019, and was suspected of having avian influenza, as he was raising 50 yellow-feather broilers in his backyard. After hospital admission, he received antivirals for 5 days, and his high fever persisted for an additional week with respiratory distress, including headache, asthma, and chest pains. Five days later, qPCR revealed that he was negative for avian influenza virus and COVID-19. However, positive <italic>C. psittaci</italic> was detected in lung lavage samples using qPCR assay and whole-genome sequencing. Based on the diagnosis, the sick farmer and his son received 10 mg/kg of doxycycline via injection for 10 days and recovered in the hospital. The patient, his son, and his spouse had positive <italic>C. psittaci</italic>-specific IgG antibodies after hospitalization. Meanwhile, <italic>C. psittaci</italic> and <italic>Enterococcus faecalis</italic> were isolated and identified from the patient&#x2019;s lung lavage samples.</p>
<p>
<italic>C. psittaci</italic> is an important zoonotic agent with a wide host spectrum, and it causes systemic infection. Its unique biphasic developmental cycle and persistent state assist in the survival and immune escape of host cells. Acute pneumonia (psittacosis) caused by <italic>C. psittaci</italic> infection is frequently misdiagnosed and poses significant challenges in treatment (<xref ref-type="bibr" rid="B21">Wang et&#xa0;al., 2024</xref>). Infected hosts (both animal and human) show a diversity of clinical signs, from asymptomatic disease for a large portion of infected organisms to multiple organ failure, sepsis, and death. In 2018, 13 workers were reported to be infected in a U.S. poultry slaughterhouse, indicating a high risk of zoonotic transmission of psittacosis (<xref ref-type="bibr" rid="B20">Shaw et&#xa0;al., 2019</xref>). In recent years, human psittacosis has increased gradually due to the commercial application of whole-genome sequencing and increasing patient survival after therapy (<xref ref-type="bibr" rid="B22">Wu et&#xa0;al., 2021</xref>). In December 2020, six employees from a duck meat processing plant and two unemployed people were diagnosed with community-acquired pneumonia and tested positive for <italic>C. psittaci</italic> using nested PCR and qPCR, indicating human-to-human transmission of <italic>C. psittaci</italic> in China and an emergent risk (<xref ref-type="bibr" rid="B27">Zhao et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B26">Zhang et&#xa0;al., 2022</xref>).</p>
<p>However, the pathogenesis between prolonged severe respiratory distress and coinfection of <italic>C. psittaci</italic> and <italic>E. faecalis</italic> is unknown. The purpose of this study was to illustrate the potential contribution of a combination of <italic>C. psittaci</italic> and <italic>E. faecalis</italic> in driving critical respiratory distress.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Temperature curve and clinical samples</title>
<p>A patient with community-acquired pneumonia was admitted to a designated hospital in Changde, Hunan, China, on December 13, 2019, and an alert was triggered twice due to two waves of high fever on December 20 and December 25&#x2013;30, 2019. One week later, while caring for his father, the patient&#x2019;s 30-year-old son also had a high fever. After treatment with doxycycline for 11 days, both his high fever and breathing difficulty were under control (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S1</bold>
</xref>). Finally, he was discharged from the local hospital before the COVID-19 outbreak in Wuhan, approximately 260 km away from his hometown. During his hospital admission, samples were collected with his family&#x2019;s consent (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>). Moreover, swabs, sera, and an alveolar wash were collected from his relatives and close contacts (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>). Before collecting any clinical samples, signed informed consent was sought from possible participants, including family members, the attending physician, and the nurses. Also, the study was approved by the institutional review board (IRB) of China Agricultural University. The collected throat swabs were kept in sucrose-phosphate-glutamate (SPG) solution at 4&#xb0;C, while the sera were stored at &#x2212;20&#xb0;C for further testing.</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>COVID-19 and <italic>Chlamydia</italic> tests</title>
<p>All serum samples were detected using a commercial antibody kit (Lizhu Biotech Co., Ltd., Shenzhen, China), and RNA samples were analyzed in accordance with the qPCR protocol recommended by the WHO (<xref ref-type="bibr" rid="B7">Corman et&#xa0;al., 2020</xref>) using COVID-19 primers (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S3</bold>
</xref>).</p>
<p>Genomic sequences were amplified for <italic>Chlamydia</italic> tests using specific primers (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>). The <italic>Chlamydia</italic> genus was determined using the following: 2&#xd7; super mix 12.5 &#xb5;L, 10 &#xb5;M <italic>Chlamydia</italic> forward primer 1.5 &#xb5;L, 10 &#xb5;M reverse primer 1.5 &#xb5;L, and 0.5&#x2013;1 &#xb5;g DNA. The PCR conditions were conducted as follows: 95&#xb0;C, 5 min, denaturing at 95&#xb0;C for 30 s, annealing at 56&#xb0;C for 30 s, and extending at 72&#xb0;C for 30 s. The cycle was repeated 30 times, and the final reaction was incubated at 72&#xb0;C for 10 min. Whole-genome sequencing was performed by a commercial institute (Beijing Genomics Institution, BGI, Beijing, China). For <italic>C. psittaci</italic> detection, the <italic>ompA</italic> gene was determined using qPCR (Applied Biosystems&#x2122; 7500, Thermo Fisher, Beijing, China) as described previously (<xref ref-type="bibr" rid="B9">Fang et&#xa0;al., 2021</xref>). The qPCR reagents included 5 &#xb5;L SYBR Reaction Mix (2&#xd7;) (TransGen Biotech, Beijing, China), 1 &#xb5;L forward primer (2.5 &#x3bc;M), 1 &#xb5;L reverse primer (2.5 &#x3bc;M), 1 &#xb5;L template DNA, and 2 &#xb5;L ddH<sub>2</sub>O. qPCR was performed as follows: 50&#xb0;C for 10 min, 95&#xb0;C for 5 min, 95&#xb0;C for 10 s, 60&#xb0;C for 30 s, 45 cycles of 95&#xb0;C for 1 min, 55&#xb0;C for 1 min, and 55&#xb0;C&#x2013;95&#xb0;C (0.5&#xb0;C increment) for 10 s. The <italic>ompA</italic> gene of <italic>C. psittaci</italic>, approximately 1,209 bp, was amplified as described previously (<xref ref-type="bibr" rid="B9">Fang et&#xa0;al., 2021</xref>). It was subjected to electrophoresis in a 1% (w/v) agarose gel. The PCR product was sequenced by a commercial company (Tsingke Biotechnology Co., Ltd., Beijing, China).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers of sequences used for the detection of <italic>Chlamydia</italic> species.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">S/N</th>
<th valign="middle" align="center">Primers</th>
<th valign="middle" align="center">Sequence (5&#x2032;&#x2013;3&#x2032;)</th>
<th valign="middle" align="center">Specificity and amplicon length</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="3" align="center">1</td>
<td valign="middle" align="center">Ch23S-F</td>
<td valign="middle" align="center">CTGAAACCAGTAGCTTATAAGCGGT (25 nt)</td>
<td valign="middle" rowspan="3" align="center">Chlamydiaceae<break/>(111 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">Ch23S-R</td>
<td valign="middle" align="center">ACCTCGCCGTTTAACTTAACTCC (23 nt)</td>
</tr>
<tr>
<td valign="middle" align="center">Ch23S-p</td>
<td valign="middle" align="center">FAM-CTCATCATGCAAAAGGCACGCCG-TAM</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">2</td>
<td valign="middle" align="center">Cp.ps.OMP1-F</td>
<td valign="middle" align="center">CACTATGTGGGAAGGTGCTTCA</td>
<td valign="middle" rowspan="3" align="center">
<italic>Chlamydia psittaci</italic>
<break/>(76 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">Cp.ps.OMP1-R</td>
<td valign="middle" align="center">CTGCGCGGATGCTAATGG</td>
</tr>
<tr>
<td valign="middle" align="center">Cp.ps.OMP1-S</td>
<td valign="middle" align="center">FAM-CGCTACTTGGTGTGAC-BHQ1 (MGB-Sonde)</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">3</td>
<td valign="middle" align="center">F1-incA-Cpsi</td>
<td valign="middle" align="center">GCCATCATGCTTGTTTCGTTT</td>
<td valign="middle" rowspan="3" align="center">
<italic>C. psittaci</italic>
<break/>(74 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">R1-incA-Cpsi</td>
<td valign="middle" align="center">CGGCGTGCCACTTGAGA</td>
</tr>
<tr>
<td valign="middle" align="center">S-Cpsi-incA-NM</td>
<td valign="middle" align="center">FAM-TCATTGTCATTATGGTGATTCAGGA-MGBNFQ</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">4</td>
<td valign="middle" align="center">CpaOMP1-F</td>
<td valign="middle" align="center">GCAACTGACACTAAGTCGGCTACA</td>
<td valign="middle" rowspan="3" align="center">
<italic>Chlamydia abortus</italic>
<break/>(82 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">CpaOMP1-R</td>
<td valign="middle" align="center">ACAAGCATGTTCAATCGATAAGAGA</td>
</tr>
<tr>
<td valign="middle" align="center">CpaOMP1-S</td>
<td valign="middle" align="center">FAM-TAAATACCACGAATGGCAAGTTGGTTTAGCG-TAM</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">5</td>
<td valign="middle" align="center">CppecOMP1-F</td>
<td valign="middle" align="center">CCATGTGATCCTTGCGCTACT</td>
<td valign="middle" rowspan="3" align="center">
<italic>Chlamydia pecorum</italic>
<break/>(76 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">CppecOMP1-R</td>
<td valign="middle" align="center">TGTCGAAAACATAATCTCCGTAAAAT</td>
</tr>
<tr>
<td valign="middle" align="center">CppecOMP1-S</td>
<td valign="middle" align="center">FAM-TGCGACGCGATTAGCTTACGCGTAG-TAM</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">6</td>
<td valign="middle" align="center">Csuis23S-F</td>
<td valign="middle" align="center">CCTGCCGAACTGAAACATCTTA</td>
<td valign="middle" rowspan="3" align="center">
<italic>Chlamydia suis</italic>
<break/>(118 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">Csuis23S-R</td>
<td valign="middle" align="center">CCCTACAACCCCTCGCTTCT</td>
</tr>
<tr>
<td valign="middle" align="center">Csuis23S-S</td>
<td valign="middle" align="center">FAM-CGAGCGAAAGGGGAAGAGCCTAAACC-TAM</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="center">7</td>
<td valign="middle" align="center">enoA_08-1274_F15</td>
<td valign="middle" align="center">CAATGGCCTACAATTCCAAGAGT (23 nt)</td>
<td valign="middle" rowspan="3" align="center">
<italic>Chlamydia gallinacea</italic>
<break/>(72 bp)</td>
</tr>
<tr>
<td valign="middle" align="center">enoA_08-1274_R87</td>
<td valign="middle" align="center">CATGCGTACAGCTTCCGTAAAC (22 nt)</td>
</tr>
<tr>
<td valign="middle" align="center">enoA_08-1274_P</td>
<td valign="middle" align="center">CY5-ATTCGCCCTACGGGAGCCCCTT-BHQ2</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>The throat swabs collected from the patient and his relatives were mixed in 900 &#x3bc;L phosphate buffered saline (PBS) containing 2,000 IU/mL gentamicin and 2,000 IU/mL streptomycin (Solarbio Science &amp; Technology Co., Ltd., Beijing, China). After incubation for 30 min at 37&#xb0;C and centrifugation at 500 &#xd7; <italic>g</italic> for 5 min at 4&#xb0;C, the supernatant (0.4 mL) was collected and injected into 7-day-old specific pathogen free (SPF) embryonated chicken eggs at 0.2 mL per egg. Afterward, the embryonated chicken eggs were incubated at 37&#xb0;C for 1 week, and the embryonated chicken eggs were monitored twice per day. The second passage was carried out to observe the pathogenicity using the yolk membranes (<xref ref-type="bibr" rid="B25">Zhang et&#xa0;al., 2009</xref>). The typical inclusion bodies were monitored using the IMAGEN&#x2122; <italic>Chlamydia</italic> kit (Thermo Scientific, Beijing, China), and specific species of <italic>C. psittaci</italic> was verified using the aforementioned qPCR. For antibody detection, <italic>C. psittaci</italic>-specific human antibodies were detected using SeroFIA&#x2122; <italic>C. psittaci</italic> immunofluorescence detection assay (Savyon Diagnostics Ltd., Ashdod, Israel) following the manufacturer&#x2019;s instructions (<xref ref-type="bibr" rid="B15">Ling et&#xa0;al., 2015</xref>).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Identification and propagation of <italic>E. faecalis</italic>
</title>
<p>DNA samples were extracted from the positive <italic>E. faecalis</italic> isolates using the DNeasy Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer&#x2019;s instructions. The following specific primers were used in the study. The forward primer was 5&#x2032;-GTACAGTTGCTTCAGGACGTATC-3&#x2032;, and the reverse primer was 5&#x2032;-ACGTTCGATTTCATCACGTTG-3&#x2032;. A 197-bp fragment of the <italic>tuf</italic> gene was amplified and subjected to electrophoresis in a 1% (w/v) agarose gel. The PCR procedure comprised an initial incubation for 4 min at 95&#xb0;C, 35 cycles for 60 s each at 95&#xb0;C, annealing for 60 s at 59&#xb0;C, and extension for 60 s at 72&#xb0;C, with a final extension for 5 min at 72&#xb0;C (<xref ref-type="bibr" rid="B18">Pan et&#xa0;al., 2012</xref>). The PCR product was sequenced, and then NCBI blast was used.</p>
<p>All throat swabs were grown on standard I nutrient agar (Merck, Darmstadt, Germany) with 5% sheep blood and incubated at 37&#xb0;C for 24 h. The positive colonies were transferred into the Baird&#x2013;Parker medium (Qingdao Hope Bio-Technology Co., Ltd., Shandong, China). Afterward, the typical colonies were identified using Gram staining and biochemical assays (Sigma-Aldrich, Beijing, China). The biochemical tests assayed for glucose, fructose, sucrose, maltose, lactose, galactose, mannose, mannitol, sorbitol, arabinose, inulin, urease, lysine decarboxylase, nitrate, gelatinase, motility, indole, 0.1% methylene blue milk, and growth on MacConkey agar in bouillon medium at pH 9.6, sodium hippurate medium, and 6.5% NaCl bouillon medium. Bacterial colony forming unit (CFU) was quantified on nutrient agar containing 5% sheep blood (<xref ref-type="bibr" rid="B18">Pan et&#xa0;al., 2012</xref>).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Mice inoculated with <italic>C. psittaci</italic> and <italic>E. faecalis</italic>
</title>
<p>The animal test was designed in accordance with guidelines issued by the Institutional Animal Care and Use Committee (IACUC) and followed humane protocols to minimize animal pain. It was approved by the Ethics Review Committee of China Agricultural University (approval code: IACUC20191222). Forty C57BL/6 mice weighing 20&#x2013;22 g were randomly assigned to five groups with eight animals per group (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S4</bold>
</xref>) and maintained in negative isolators in biosafety level 2 facilities. In the current study, Group 1 mice were infected intranasally with 0.1 mL of 1.0 &#xd7; 10<sup>5</sup> inclusion forming unit (IFU) of <italic>C. psittaci</italic> isolate alone. Group 2 mice were inoculated intranasally with 0.1 mL of 1.0 &#xd7; 10<sup>7</sup> CFU of <italic>E. faecalis</italic> isolate alone. Group 3 mice received intranasally 1.0 &#xd7; 10<sup>7</sup> CFU of <italic>E. faecalis</italic> and 0.1 mL of 1.0 &#xd7; 10<sup>5</sup> IFU of <italic>C. psittaci</italic> at the same time. Group 4 mice were first inoculated intranasally with 1.0 &#xd7; 10<sup>5</sup> IFU of <italic>C. psittaci</italic> isolate and then inoculated with 0.1 mL of 1.0 &#xd7; 10<sup>7</sup> CFU of <italic>E. faecalis</italic> through the same route after 3 days. This infection model was used to identify whether primary <italic>C. psittaci</italic> infection would aggravate <italic>E. faecalis</italic>-mediated respiratory distress. Group 5 mice received sterile 0.1 mL of PBS via the same route, serving as the healthy control. Mouse body weights were monitored weekly until the end of the experiment. After 14 days, the mice were anesthetized by intraperitoneal injection into the right lower quadrant of the abdomen with 2&#x2009;mg ketamine and 0.2&#x2009;mg xylazine (Jianglei Biotech Co., Ltd., Shanghai, China).</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Evaluation of lung pathological lesions</title>
<p>Lungs were harvested from each group of euthanized mice, examined for pathological lesions, and scored. Lung lesions were determined according to a previous description (<xref ref-type="bibr" rid="B14">Li et&#xa0;al., 2022</xref>). Briefly, for lungs, the grades were as follows: grade 0, lines normal; grade 1, 30% of the lung surface area showed hemorrhage, degeneration, or necrosis; grade 2, 60% of the lung surface area showed hemorrhage, degeneration, or necrosis; and grade 3, the entire lung surface showed hemorrhage, degeneration, or necrosis. For lung sections, the grades were as follows: grade 0, none; grade 1, slight edema of the alveolar walls; grade 2, moderate edematous thickening of alveolar walls with occasional alveoli containing coagulated edema fluid; and grade 3, extensive occurrence of alveolar and interstitial edema.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Pathogen loads</title>
<p>The mouse lungs were aseptically removed on day 14. Briefly, sterile lung tissues of eight mice from each group were taken and then minced, and 50 mg of lung tissues from each mouse and supernatant lung homogenates were obtained. The homogenates were stored at 4&#xb0;C for 40 min and then centrifuged at 2,000 rpm/min for 5 min. The supernatant was used to determine the concentration of <italic>C. psittaci</italic> by qPCR (<xref ref-type="bibr" rid="B9">Fang et&#xa0;al., 2021</xref>). For <italic>E. faecalis</italic> determination, the samples from the lungs were inoculated on standard I nutrient agar (Merck, Germany) with 5% sheep blood and incubated at 37&#xb0;C for 24&#x2013;48 h. Finally, the number of bacterial colonies was measured.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Statistical analysis</title>
<p>Statistical significance was analyzed using one-way ANOVA with the least significant difference (LSD) <italic>post-hoc</italic> test. Data were expressed as the mean &#xb1; standard deviation. All data were calculated and analyzed using SPSS v26.0 (SPSS Inc., Chicago, IL, USA). Graphs were generated using the GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA). Statistically significant differences were judged as <italic>p</italic> &lt; 0.05.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Detection of <italic>C. psittaci</italic> and specific antibodies from the patient and his close contacts</title>
<p>After the patient&#x2019;s hospital admission, his chest X-ray revealed bilateral pneumonia and ground-glass opacity, and he was prescribed oxygen therapy and doxycycline. Afterward, lesions with ground-glass opacity were reduced, but pulmonary consolidation was still observed in the lungs (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S2</bold>
</xref>). Based on 23S rDNA amplification, a positive 172-bp band of <italic>C. psittaci</italic> was detected in the patient&#x2019;s alveolar wash, while his tracheal mucosa and throat swabs were negative (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Other family members, the nurses, the attending physician, and the house chickens were negative for <italic>C. psittaci</italic> (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Afterward, qPCR results showed that the patient&#x2019;s alveolar wash was positive for <italic>C. psittaci</italic>. Subsequently, positive <italic>C. psittaci</italic> was identified in the patient&#x2019;s alveolar wash and throat swab, and his sons&#x2019; throat swab. However, a negative reaction was found in his tracheal mucosa and other close contacts&#x2019; samples (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). The <italic>ompA</italic> gene sequence of the <italic>C. psittaci</italic> strain was determined and submitted to GenBank (accession number: OR616243). After inoculation into SPF embryonated eggs, typical intracellular inclusions were observed using immunofluorescence staining (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Detection of <italic>Chlamydia psittaci</italic> from patient&#x2019;s samples and his close contacts using 23S rDNA PCR. <bold>(A)</bold> Positive <italic>C</italic>. <italic>psittaci</italic> was detected in the patient&#x2019;s alveolar lavage (M, marker; 1, alveolar lavage; 2, throat swabs; 3, tracheal mucosa; 4, <italic>C</italic>. <italic>psittaci</italic> 6BC control; 5, negative control). <bold>(B)</bold> Negative samples of patient&#x2019;s close contacts (M, marker; 1&#x2013;7, patient&#x2019;s relatives; 8, doctor; 9, nurse; C1&#x2013;C10, chicken samples; N, negative control; P, positive control).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g001.tif">
<alt-text content-type="machine-generated">Gel electrophoresis results show two panels labeled A and B. Panel A has lanes M, 1 to 5 with bands visible at 172 base pairs. Panel B includes lanes M, 1 to 9, C1 to C10, N, and P, also showing bands at 172 base pairs. Lanes M in both panels represent the molecular marker with bands indicating base pair sizes.</alt-text>
</graphic>
</fig>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Detection of <italic>Chlamydia psittaci</italic> using qPCR assay. <bold>(A)</bold> Positive <italic>C</italic>. <italic>psittaci</italic> was detected in patient&#x2019;s alveolar lavage and throat swab, while negative reaction was detected in tracheal mucosa. A, B: Tracheal mucosa, C, D: throat swabs, E, F: alveolar lavage, and G, H: <italic>C</italic>. <italic>psittaci</italic>. <bold>(B)</bold> Positive reaction was identified in his son&#x2019;s throat swabs (D), and negative reaction was identified in his close contact&#x2019;s samples: tracheal mucosa (A&#x2013;C, E&#x2013;H).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g002.tif">
<alt-text content-type="machine-generated">Two line graphs labeled A and B depict amplification plots. Graph A shows multiple colored lines representing different reactions with fluorescence increasing significantly after cycle 20. Graph B shows more variability with an increase observed after cycle 25. The x-axis is labeled &#x201c;Cycle&#x201d; and the y-axis is labeled &#x201c;&#x394;Rn&#x201d;. A color legend is provided at the bottom, indicating colors associated with samples A through H.</alt-text>
</graphic>
</fig>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Positive <italic>Chlamydia psittaci</italic> strain was isolated from patient&#x2019;s throat swab samples using immunofluorescence staining. Blue, 4',6-diamidino-2-phenylindole (DAPI)-stained host cells. Green, fluorescein isothiocyanate (FITC)-labeled lipopolysaccharide (LPS) antibody against <italic>Chlamydia</italic>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g003.tif">
<alt-text content-type="machine-generated">Microscopic view showing blue and green fluorescent cells against a dark background. Red arrows point to specific green-stained cells, indicating areas of interest.</alt-text>
</graphic>
</fig>
<p>For <italic>C. psittaci</italic>-specific antibodies, IgG antibody titers were arranged from 1:64 dilution on December 25 and increased to 1:128 dilution on December 27, 2019, in a time-course manner (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). Compared to the patient&#x2019;s sera, IgG titers were from 1:32 to 1:64 to 1:128, and the serum samples from other close contacts were negative in the test. Meanwhile, antibodies against COVID-19 were negative (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>). Serum samples from the patient were also tested for antibodies against common respiratory pathogens, including influenza A/B virus, respiratory syncytial virus, <italic>C. pneumoniae</italic>, and <italic>M. pneumoniae</italic>. All results were negative.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Specific antibodies against <italic>Chlamydia psittaci</italic> during patient&#x2019;s hospital admission. <bold>(A)</bold> Positive antibody to <italic>C</italic>. <italic>psittaci</italic> was observed on December 25, 2019. <bold>(B)</bold> Highly intensive <italic>C</italic>. <italic>psittaci</italic>-specific antibodies were observed in a time-course manner on December 27, 2019.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g004.tif">
<alt-text content-type="machine-generated">Two fluorescence microscopy images labeled A and B. Image A shows scattered green fluorescent spots on a black background, with one spot indicated by a red arrow. Image B displays more numerous green spots, with two highlighted by red arrows, suggesting higher density or activity compared to image A.</alt-text>
</graphic>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Detection of <italic>Chlamydia psittaci</italic>-specific IgG and COVID-19 antibodies in the sera of the patient and his close contacts.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="center">Code</th>
<th valign="middle" align="center">Patient and his relatives</th>
<th valign="middle" align="center">Gender</th>
<th valign="middle" align="center">Age</th>
<th valign="middle" align="center">
<italic>C. psittaci</italic> antibody</th>
<th valign="middle" align="center">COVID-19 antibody</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="center">1</td>
<td valign="middle" align="center">Duan (patient)</td>
<td valign="middle" align="center">Male</td>
<td valign="middle" align="center">66</td>
<td valign="middle" align="center">1:32; 1:64; 1:128 positive</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">2</td>
<td valign="middle" align="center">Spouse</td>
<td valign="middle" align="center">Female</td>
<td valign="middle" align="center">63</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">3</td>
<td valign="middle" align="center">Son</td>
<td valign="middle" align="center">Male</td>
<td valign="middle" align="center">35</td>
<td valign="middle" align="center">1:32; 1:64; 1:128 positive</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">4</td>
<td valign="middle" align="center">Older granddaughter</td>
<td valign="middle" align="center">Female</td>
<td valign="middle" align="center">9</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">5</td>
<td valign="middle" align="center">Little granddaughter</td>
<td valign="middle" align="center">Female</td>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">6</td>
<td valign="middle" align="center">Daughter-in-law</td>
<td valign="middle" align="center">Female</td>
<td valign="middle" align="center">35</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">7</td>
<td valign="middle" align="center">Nurse</td>
<td valign="middle" align="center">Female</td>
<td valign="middle" align="center">27</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
<tr>
<td valign="middle" align="center">8</td>
<td valign="middle" align="center">Doctor</td>
<td valign="middle" align="center">Male</td>
<td valign="middle" align="center">29</td>
<td valign="middle" align="center">Negative</td>
<td valign="middle" align="center">Negative</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Isolation and characterization of <italic>E. faecalis</italic>
</title>
<p>
<italic>E. faecalis</italic> was successfully isolated in the alveolar lavage and throat swab using single-colony purification. Subsequently, the isolate was classified using biochemical assays and conventional PCR, and <italic>E. faecalis</italic> isolates were found to be Gram-positive, chain-forming, coccus-shaped organisms upon microscopic inspection (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>). The isolated strains were determined as <italic>E. faecalis</italic> using PCR. The DNA extracted from the typical colony produced the expected 197-bp PCR product of the target gene (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>); the sequence of the <italic>tuf</italic> gene was submitted to GenBank (accession number: SUB15618628), and NCBI blast was used. A sequence analysis of the <italic>tuf</italic> segment showed that the sequence from this isolate was 98%&#x2013;100% homologous to the <italic>E. faecalis</italic> reference strains (GenBank # EU156939 and AY266992).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>
<italic>Enterococcus faecalis</italic> was isolated and identified from patient&#x2019;s alveolar lavage and throat swabs. <bold>(A)</bold> Typical colonies of <italic>E. faecalis</italic> grew on Columbia Blood Agar Base Medium. <bold>(B)</bold> The isolate generated 197-bp PCR product. 1, marker; 2, positive control; 3, negative control; 4, patient&#x2019;s alveolar lavage; 5, patient&#x2019;s throat swab.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g005.tif">
<alt-text content-type="machine-generated">Panel A shows bacterial colonies on a red agar plate, indicating successful growth. Panel B displays a gel electrophoresis result with lanes showing DNA bands of varying lengths, with a prominent 197 base pair band highlighted in lane five.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Pathogenicity of coinfection with <italic>C. psittaci</italic> and <italic>E. faecalis</italic>
</title>
<p>Clinically, mice infected primarily with <italic>C. psittaci</italic>, followed by <italic>E. faecalis</italic> (<italic>C. psittaci</italic>/<italic>E. faecalis</italic>) inoculation or <italic>C. psittaci</italic> infection alone, showed ruffled feathers, inactivity, poor appetite, and low weight; especially severe signs were found in female mice compared to male mice. For body weights, those of the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group, <italic>C. psittaci</italic> alone group, and <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group were lower 1 week later. More importantly, mouse body weights declined during the observation in the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group (<italic>p</italic> &lt; 0.01). However, no decrease was found in the <italic>E. faecalis</italic> alone group and the control group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Body weight after inoculation with coinfection with <italic>Chlamydia psittaci</italic> or <italic>Enterococcus faecalis</italic> in mice. Two weeks post-infection, the body weight levels of the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group were lower than those of the other three groups (<italic>p</italic> &lt; 0.01). No statistical difference was found in the <italic>E. faecalis</italic> alone group and the control group. The differences were analyzed using ANOVA (<italic>p</italic> &lt; 0.05, <italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g006.tif">
<alt-text content-type="machine-generated">Line graph showing body weight changes over four weeks for different groups: C. psittaci (pink), C. psittaci plus E. faecalis (green), E. faecalis (blue), C. psittaci/E. faecalis (orange), and blank (black). The y-axis represents body weight in grams, ranging from 18 to 22 grams, and the x-axis represents time in weeks. Initially, all groups start at similar weights, with the blank group gradually increasing, while others fluctuate or decrease.</alt-text>
</graphic>
</fig>
<p>Postmortem, diffuse hemorrhagic lungs were observed in the mice with <italic>C. psittaci</italic> infection alone, while enlarged lung size was evident in the mice with <italic>E. faecalis</italic> infection (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>). For <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group and the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group, atrophy, viscous exudation, and diffuse hemorrhage characterized severe lesions, while fibrinous consolidation developed in the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Lung lesions after coinfection with <italic>Chlamydia psittaci</italic> and <italic>Enterococcus faecalis</italic> in mice. <bold>(A)</bold> Control group, <bold>(B)</bold> <italic>C</italic>. <italic>psittaci</italic> alone group, <bold>(C)</bold> <italic>E. faecalis</italic> alone group, <bold>(D)</bold> <italic>C</italic>. <italic>psittaci</italic>+<italic>E. faecalis</italic> group, and <bold>(E)</bold> <italic>C</italic>. <italic>psittaci</italic>/<italic>E. faecalis</italic> group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g007.tif">
<alt-text content-type="machine-generated">Five images labeled A to E show excised lung tissues. Each set displays variations in color and texture, indicating differing conditions or treatments. The tissues exhibit differences in redness and structure, which may suggest varying levels of health or disease states.</alt-text>
</graphic>
</fig>
<p>Under microscopic observation, severe consolidation lesions were observed in the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group and <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group, diffuse hemorrhagic inflammation was evident in the lungs of the <italic>C. psittaci</italic> alone group, and no obvious lesions were found in the <italic>E. faecalis</italic> alone group (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>).</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Lung lesions after coinfection with <italic>Chlamydia psittaci</italic> and <italic>Enterococcus faecalis</italic> in mice under microscopic observation. <bold>(A)</bold> Control group, <bold>(B)</bold> <italic>C</italic>. <italic>psittaci</italic> alone group, <bold>(C)</bold> <italic>E. faecalis</italic> alone group, <bold>(D)</bold> <italic>C</italic>. <italic>psittaci</italic>+<italic>E. faecalis</italic> group, and <bold>(E)</bold> <italic>C</italic>. <italic>psittaci</italic>/<italic>E. faecalis</italic> group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g008.tif">
<alt-text content-type="machine-generated">Histological images labeled A to E show lung tissue sections. Image A displays normal lung architecture. Images B to E depict varying degrees of tissue damage and inflammation, with highlighted areas marked by red arrows indicating focal inflammation or cellular infiltration.</alt-text>
</graphic>
</fig>
<p>Regarding bacterial loads, high chlamydial loads were determined in the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group compared to the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group or <italic>C. psittaci</italic> alone group (<italic>p</italic> &lt; 0.05) (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). On the contrary, no significant difference in <italic>E. faecalis</italic> clearance was found between the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group and the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9b</bold>
</xref>).</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Determination of bacterial loads in the mouse lungs after coinfection with <italic>Chlamydia psittaci</italic> or <italic>Enterococcus faecalis</italic>. <bold>(A)</bold> <italic>C</italic>. <italic>psittaci</italic> loads in lungs on day 14 post-challenge. The symbol * indicates a statistically significant difference (p &lt; 0.05). <bold>(B)</bold> <italic>E. faecalis</italic> loads in lungs on day 14 post-challenge. No significant difference in <italic>E. faecalis</italic> clearance was found between the <italic>C</italic>. <italic>psittaci</italic>/<italic>E. faecalis</italic> group and the <italic>C</italic>. <italic>psittaci</italic>+<italic>E. faecalis</italic> group <bold>(B)</bold>. The differences were analyzed using ANOVA (<italic>p</italic> &lt; 0.05, <italic>p</italic> &lt; 0.01).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1662902-g009.tif">
<alt-text content-type="machine-generated">Bar charts comparing gene copies per milliliter and CFU per milliliter across four groups: *C. psittaci*, *E. faecalis*, *C. psittaci* + *E. faecalis*, and blank. The left chart shows *C. psittaci* and *E. faecalis* with increased gene copies. The right chart shows higher CFU values for combined groups compared to *C. psittaci* alone.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In the present study, positive genomics, <italic>C. psittaci</italic> isolate, and seropositive sera were determined in the patient&#x2019;s samples, and <italic>E. faecalis</italic> was also recovered from his alveolar lavage and throat swabs. After therapy with doxycycline for 11 days, both high fever and respiratory distress were alleviated gradually, and the patient survived before the COVID-19 outbreak and quarantine in Wuhan. In the evidence-based animal study, both <italic>C. psittaci</italic>+<italic>E. faecalis</italic> and <italic>C. psittaci</italic>/<italic>E. faecalis</italic> infections aggravated mouse respiratory distress, characterized as diffuse hemorrhage, exudation, and fibrinous consolidation in mouse lungs, which were consistent with the white-like lungs of the patient after hospital admission. Therefore, primary infection with <italic>C. psittaci</italic> and secondary infection with <italic>E. faecalis</italic> may be associated with the patient&#x2019;s respiratory distress.</p>
<p>Naturally, human <italic>C. psittaci</italic> infection is a typical zoonosis transmitted via inhalation of aerosolized particles from infected birds (<xref ref-type="bibr" rid="B21">Wang et&#xa0;al., 2024</xref>). The clinical manifestations range from asymptomatic illness to life-threatening pneumonia. <italic>E. faecalis</italic>, as a common commensal bacterium in the human gastrointestinal tract, is an opportunistic pathogen. It most often causes endogenous infections, such as urinary tract infections and bacteremia, when host immunity is compromised. One report implied that <italic>E. faecalis</italic> could cause pneumonia and lung abscesses in immunocompromised individuals (<xref ref-type="bibr" rid="B17">Mendes et&#xa0;al., 2020</xref>). However, coinfection of <italic>C. psittaci</italic> and <italic>E. faecalis</italic> remains elusive.</p>
<p>In our study, both <italic>C. psittaci</italic> and <italic>E. faecalis</italic> were identified in the patient with high fever. However, the definitive contribution of each pathogen to the severe pneumonia remained elusive. To our knowledge, human psittacosis can manifest as an asymptomatic syndrome with silent infection. Some employees from duck meat plants were reported to present flu-like symptoms or pneumonia after <italic>C. psittaci</italic> infection and recovered without treatment (<xref ref-type="bibr" rid="B26">Zhang et&#xa0;al., 2022</xref>). Severe symptoms in the patient may be associated with immunosuppression due to the presence of heart disease and type 2 diabetes for up to 7 years. The simultaneous onset of type 2 diabetes mellitus and heart disease significantly reduces the body&#x2019;s immune response (<xref ref-type="bibr" rid="B23">Yap et&#xa0;al., 2019</xref>). The patient&#x2019;s chronic disease may have contributed to his two-time high fever in the hospital. Recent analysis showed that immunocompromised patients overall had a 44% higher risk of death in hospital than patients with normal immune systems over the course of the COVID-19 pandemic. However, highly pathogenic <italic>C. psittaci</italic> infection could induce an immunocompromised state and aggravate H9N2 infection (<xref ref-type="bibr" rid="B4">Chu et&#xa0;al., 2016</xref>). In this study, the patient suffered from <italic>C. psittaci</italic>-elicited immunosuppression and chronic disease with low immunity and was sensitive to viral or bacterial infection. In the mouse model, <italic>C. psittaci</italic> infection caused hemorrhagic inflammation in the lungs, and a primary infection with <italic>C. psittaci</italic> followed by <italic>E. faecalis</italic> inoculation not only caused mice to develop more severe breathing difficulties than <italic>C. psittaci</italic> infection alone, but also caused a high number of lesions in the lungs of the <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group. The above facts confirm our hypothesis that a primary infection with <italic>C. psittaci</italic> establishes a compromised lung environment that is severely exacerbated by secondary <italic>E. faecalis</italic> inoculation.</p>
<p>The potential role of <italic>E. faecalis</italic> is unclear over the patient&#x2019;s disease course. Enterococci are rarely considered pulmonary pathogens, and they are considered colonizers of the airway. One patient was diagnosed with <italic>E. faecalis</italic>-associated acute primary lung abscess, highlighting <italic>E. faecalis</italic> as an etiologic agent in cases of non-resolving or complicated cases of pneumonia (<xref ref-type="bibr" rid="B17">Mendes et&#xa0;al., 2020</xref>). Moreover, epidemiological investigation confirmed a correlation between <italic>E. faecalis</italic> clones isolated from food-producing animals and human urinary tract infections caused by <italic>E. faecalis</italic> in France in 2016 (<xref ref-type="bibr" rid="B1">Abat et&#xa0;al., 2016</xref>). In slaughter animals, <italic>E. faecalis</italic> from human milk is claimed to be avirulent and antibiotic sensitive and does not breach the gut barrier (<xref ref-type="bibr" rid="B2">Anjum et&#xa0;al., 2022</xref>). However, some reports showed that <italic>E. faecalis</italic> harboring antibiotic resistance genes may contribute to bovine mastitis and act as a reservoir for the transmission of virulence factors to humans (<xref ref-type="bibr" rid="B12">Kim et&#xa0;al., 2022</xref>). In the present study, the <italic>E. faecalis</italic> isolate from the patient and his son may have originated from backyard chickens due to daily feeding activities. After inoculation into mice, hemorrhagic inflammation of the lungs was evident in both the <italic>C. psittaci</italic>+<italic>E. faecalis</italic> group and <italic>C. psittaci</italic>/<italic>E. faecalis</italic> group, but no typical lesion was found in the lungs infected with <italic>E. faecalis</italic> alone. Our animal model provided strong evidence that <italic>E. faecalis</italic>, which originated from animal-based food, may be an opportunistic human pathogen that worsens <italic>C. psittaci</italic> injury by increasing the burden of <italic>C. psittaci</italic> in the lungs. Moreover, it may be a real zoonotic pathogen with a potentially highly significant impact on human health.</p>
<p>The initial clinical and radiological presentation of the patient, characterized by high fever, bilateral ground-glass opacities, and hemorrhagic lesions, posed a significant diagnostic challenge, as it closely mimicked severe COVID-19 pneumonia and avian influenza (<xref ref-type="bibr" rid="B27">Zhao et&#xa0;al., 2021</xref>). This overlap in features, including the progression to &#x201c;white lung&#x201d; in severe cases (<xref ref-type="bibr" rid="B8">Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020</xref>; <xref ref-type="bibr" rid="B3">Attaway et&#xa0;al., 2021</xref>), underscores the critical importance of differential diagnosis in the context of a pandemic. Notably, the diffuse hemorrhagic inflammation observed in our coinfection mouse model differed from the typical fibrotic consolidation seen in advanced COVID-19 (<xref ref-type="bibr" rid="B24">Yin and Wunderink, 2018</xref>), suggesting distinct pathogenic mechanisms. In view of the rapid identification of human psittacosis from community-acquired pneumonia, RT-PCR and metagenomic next-generation sequencing are recommended for clinical diagnosis.</p>
<p>In conclusion, positive <italic>C. psittaci</italic> genomics and seroprevalence were identified in the patient. Subsequently, both <italic>C. psittaci</italic> and <italic>E. faecalis</italic> were isolated from the patient&#x2019;s samples. After treatment with doxycycline, the patient recovered and was discharged from the hospital, suggesting that <italic>C. psittaci</italic> infection may have aggravated respiratory distress by aggravating his weak immunity. Our experimental data further demonstrate that secondary infection with <italic>E. faecalis</italic> can exacerbate respiratory distress and produce pathological lesions reminiscent of COVID-19. Various strategies must be urgently implemented to highlight this public health threat, in particular through the development and implementation of large surveillance systems based on animal and human health data to enable us to detect the prevalence of <italic>C. psittaci</italic> and <italic>E. faecalis</italic>.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies involving humans were approved by Human Ethical Committee of China Agricultural University (Beijing, China). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The animal study was approved by Laboratory Animal Ethical Committee of China Agricultural University (Beijing, China). The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>XZ: Writing &#x2013; original draft, Formal Analysis. YiW: Writing &#x2013; original draft, Conceptualization, Methodology. YuW: Data curation, Writing &#x2013; original draft. YC: Writing &#x2013; original draft, Software. HW: Writing &#x2013; original draft, Formal Analysis. ZH: Writing &#x2013; original draft, Investigation. LL: Conceptualization, Writing &#x2013; original draft. LT: Writing &#x2013; original draft, Investigation. JC: Writing &#x2013; original draft, Supervision. CH: Methodology, Conceptualization, Supervision, Writing &#x2013; review &amp; editing, Funding acquisition.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research and/or publication of this article. This work was supported by the Ministry of Science and Technology of China (Grant No. 2022YFC2304000).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We want to express our gratitude to everyone who offered advice and help in this work.</p>
</ack>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s12" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2025.1662902/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2025.1662902/full#supplementary-material</ext-link>.</p>
<supplementary-material xlink:href="Table1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abat</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Huart</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Garcia</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Dubourg</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>
<italic>Enterococcus faecalis</italic> urinary-tract infections: Do they have a zoonotic origin</article-title>? <source>J. Infect.</source> <volume>73</volume>, <fpage>305</fpage>&#x2013;<lpage>313</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jinf.2016.07.012</pub-id>, PMID: <pub-id pub-id-type="pmid">27475787</pub-id></citation></ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Anjum</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zaidi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Barrett</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Tariq</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>A potentially probiotic strain of <italic>Enterococcus faecalis</italic> from human milk that is avirulent, antibiotic sensitive, and nonbreaching of the gut barrier</article-title>. <source>Arch. Microbiol.</source> <volume>204</volume>, <fpage>158</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00203-022-02754-8</pub-id>, PMID: <pub-id pub-id-type="pmid">35107663</pub-id></citation></ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Attaway</surname> <given-names>A. H.</given-names>
</name>
<name>
<surname>Scheraga</surname> <given-names>R. G.</given-names>
</name>
<name>
<surname>Bhimraj</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Biehl</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Hatipo&#x11f;lu</surname> <given-names>U.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Severe COVID-19 pneumonia: pathogenesis and clinical management</article-title>. <source>Bmj</source> <volume>372</volume>, <elocation-id>n436</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/bmj.n436</pub-id>, PMID: <pub-id pub-id-type="pmid">33692022</pub-id></citation></ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Khan</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>
<italic>Chlamydia psittaci</italic> infection increases mortality of avian influenza virus H9N2 by suppressing host immune response</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <elocation-id>29421</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep29421</pub-id>, PMID: <pub-id pub-id-type="pmid">27405059</pub-id></citation></ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cianfarani</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Pediatric endocrinology in the time of the COVID-19 pandemic</article-title>. <source>Horm. Res. Paediatr.</source> <volume>92</volume>, <fpage>345</fpage>&#x2013;<lpage>346</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1159/000507703</pub-id>, PMID: <pub-id pub-id-type="pmid">32272473</pub-id></citation></ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ciotti</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Angeletti</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Minieri</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Giovannetti</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Benvenuto</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Pascarella</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>COVID-19 outbreak: an overview</article-title>. <source>Chemotherapy</source> <volume>64</volume>, <fpage>215</fpage>&#x2013;<lpage>223</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1159/000507423</pub-id>, PMID: <pub-id pub-id-type="pmid">32259829</pub-id></citation></ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corman</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Landt</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Kaiser</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Molenkamp</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Meijer</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>D. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR</article-title>. <source>Euro Surveill</source> <volume>25</volume>, <page-range>2000045</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.2807/1560-7917.ES.2020.25.3.2000045</pub-id>, PMID: <pub-id pub-id-type="pmid">31992387</pub-id></citation></ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<collab>Coronaviridae Study Group of the International Committee on Taxonomy of Viruses</collab>
</person-group> (<year>2020</year>). <article-title>The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2</article-title>. <source>Nat. Microbiol.</source> <volume>5</volume>, <fpage>536</fpage>&#x2013;<lpage>544</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41564-020-0695-z</pub-id>, PMID: <pub-id pub-id-type="pmid">32123347</pub-id></citation></ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Quan</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Co-Infection of <italic>Escherichia coli</italic>, <italic>Enterococcus faecalis</italic> and <italic>Chlamydia psittaci</italic> Contributes to Salpingitis of Laying Layers and Breeder Ducks</article-title>. <source>Pathogens</source> <volume>10</volume>, <page-range>755</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/pathogens10060755</pub-id>, PMID: <pub-id pub-id-type="pmid">34203970</pub-id></citation></ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Islam</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Haque</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Rahman</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Hossen</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Reza</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Barua</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>A review on measures to rejuvenate immune system: natural mode of protection against coronavirus infection</article-title>. <source>Front. Immunol.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2022.837290</pub-id>, PMID: <pub-id pub-id-type="pmid">35371007</pub-id></citation></ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Hou</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>mRNA vaccine: how to meet the challenge of SARS-coV-2</article-title>. <source>Front. Immunol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2021.821538</pub-id>, PMID: <pub-id pub-id-type="pmid">35126377</pub-id></citation></ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Youn</surname> <given-names>H. Y.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Moon</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Jang</surname> <given-names>Y. S.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>K. Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Prevalence and Virulence Characteristics of <italic>Enterococcus faecalis</italic> and <italic>Enterococcus faecium</italic> in Bovine Mastitis Milk Compared to Bovine Normal Raw Milk in South Korea</article-title>. <source>Anim. (Basel)</source> <volume>12</volume>, <page-range>1407</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ani12111407</pub-id>, PMID: <pub-id pub-id-type="pmid">35681873</pub-id></citation></ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lei</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Y. F.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Z. H.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Clustering cases of <italic>chlamydia psittaci</italic> pneumonia in coronavirus disease 2019 screening ward staff</article-title>. <source>Clin. Infect. Dis.</source> <volume>73</volume>, <fpage>e3261</fpage>&#x2013;<lpage>e3265</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/cid/ciaa1681</pub-id>, PMID: <pub-id pub-id-type="pmid">33150367</pub-id></citation></ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>He</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>A novel intranasal vaccine with pmpGs + MOMP induces robust protections both in respiratory tract and genital system posting <italic>chlamydia psittaci</italic> infection</article-title>. <source>Front. Vet. Sci.</source> <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fvets.2022.855447</pub-id>, PMID: <pub-id pub-id-type="pmid">35529835</pub-id></citation></ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ling</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bavoil</surname> <given-names>P. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Epidemiology of <italic>chlamydia psittaci</italic> infection in racing pigeons and pigeon fanciers in beijing, China</article-title>. <source>Zoonoses Public Health</source> <volume>62</volume>, <fpage>401</fpage>&#x2013;<lpage>406</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/zph.12161</pub-id>, PMID: <pub-id pub-id-type="pmid">25244602</pub-id></citation></ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>Y. N.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y. F.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Q. B.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Infection and co-infection patterns of community-acquired pneumonia in patients of different ages in China from 2009 to 2020: A national surveillance study</article-title>. <source>Lancet Microbe</source> <volume>4</volume>, <fpage>e330</fpage>&#x2013;<lpage>e339</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s2666-5247(23)00031-9</pub-id>, PMID: <pub-id pub-id-type="pmid">37001538</pub-id></citation></ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mendes</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Costa</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ferreira</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Ferreira</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>
<italic>Enterococcus faecalis</italic>-associated lung abscess in a male adolescent- a case report</article-title>. <source>BMC Pediatr.</source> <volume>20</volume>, <fpage>98</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12887-020-2003-8</pub-id>, PMID: <pub-id pub-id-type="pmid">32122323</pub-id></citation></ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pan</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>He</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Co-infection of <italic>Ornithobacterium rhinotracheale</italic> with Streptococcus zooepidemicus in chickens</article-title>. <source>Avian Dis.</source> <volume>56</volume>, <fpage>680</fpage>&#x2013;<lpage>684</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1637/10109-030112-Reg.1</pub-id>, PMID: <pub-id pub-id-type="pmid">23397838</pub-id></citation></ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qin</surname> <given-names>X. C.</given-names>
</name>
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Gong</surname> <given-names>E.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Severe Community-acquired Pneumonia caused by <italic>Chlamydia psittaci</italic> Genotype E/B Strain Circulating Among Geese in Lishui City, Zhejiang Province, China</article-title>. <source>Emerg. Microbes Infect.</source> <volume>11</volume>, <fpage>2715</fpage>&#x2013;<lpage>2723</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/22221751.2022.2140606</pub-id>, PMID: <pub-id pub-id-type="pmid">36287125</pub-id></citation></ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shaw</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Szablewski</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Kellner</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kornegay</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Bair</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Brennan</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Psittacosis Outbreak among Workers at Chicken Slaughter Plants, Virginia and Georgia, US</article-title>. <source>Emerg. Infect. Dis.</source> <volume>25</volume>, <fpage>2143</fpage>&#x2013;<lpage>2145</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3201/eid2511.190703</pub-id>, PMID: <pub-id pub-id-type="pmid">31625859</pub-id></citation></ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>
<italic>Chlamydia psittaci</italic>: A zoonotic pathogen causing avian chlamydiosis and psittacosis</article-title>. <source>Virulence</source> <volume>15</volume>, <elocation-id>2428411</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21505594.2024.2428411</pub-id>, PMID: <pub-id pub-id-type="pmid">39541409</pub-id></citation></ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>H. H.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>L. F.</given-names>
</name>
<name>
<surname>Fang</surname> <given-names>S. Y.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Application of metagenomic next-generation sequencing in the diagnosis of severe pneumonia caused by <italic>Chlamydia psittaci</italic>
</article-title>. <source>BMC Pulm Med.</source> <volume>21</volume>, <fpage>300</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12890-021-01673-6</pub-id>, PMID: <pub-id pub-id-type="pmid">34556069</pub-id></citation></ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yap</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Tay</surname> <given-names>W. T.</given-names>
</name>
<name>
<surname>Teng</surname> <given-names>T. K.</given-names>
</name>
<name>
<surname>Anand</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Richards</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Ling</surname> <given-names>L. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Association of diabetes mellitus on cardiac remodeling, quality of life, and clinical outcomes in heart failure with reduced and preserved ejection fraction</article-title>. <source>J. Am. Heart Assoc.</source> <volume>8</volume>, <elocation-id>e013114</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1161/jaha.119.013114</pub-id>, PMID: <pub-id pub-id-type="pmid">31431116</pub-id></citation></ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wunderink</surname> <given-names>R. G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>MERS, SARS and other coronaviruses as causes of pneumonia</article-title>. <source>Respirology</source> <volume>23</volume>, <fpage>130</fpage>&#x2013;<lpage>137</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/resp.13196</pub-id>, PMID: <pub-id pub-id-type="pmid">29052924</pub-id></citation></ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>He</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Induction of a protective immune response against swine Chlamydophila abortus infection in mice following co-vaccination of omp-1 DNA with recombinant MOMP</article-title>. <source>Zoonoses Public Health</source> <volume>56</volume>, <fpage>71</fpage>&#x2013;<lpage>76</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1863-2378.2008.01160.x</pub-id>, PMID: <pub-id pub-id-type="pmid">18721226</pub-id></citation></ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Ji</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Human-to-human transmission of <italic>Chlamydia psittaci</italic> in China 2020: an epidemiological and aetiological investigation</article-title>. <source>Lancet Microbe</source> <volume>3</volume>, <fpage>e512</fpage>&#x2013;<lpage>e520</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/s2666-5247(22)00064-7</pub-id>, PMID: <pub-id pub-id-type="pmid">35617977</pub-id></citation></ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>He</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>X. Z.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Tong</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>S. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Clustering cases of <italic>Chlamydia psittaci</italic> pneumonia mimicking COVID-19 pneumonia</article-title>. <source>World J. Clin. cases</source> <volume>9</volume>, <fpage>11237</fpage>&#x2013;<lpage>11247</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.12998/wjcc.v9.i36.11237</pub-id>, PMID: <pub-id pub-id-type="pmid">35071554</pub-id></citation></ref>
</ref-list>
</back>
</article>