<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2025.1653725</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Urantide alleviates lipopolysaccharide/D-galactosamine-induced acute liver failure through upregulating carboxylesterase1f in mice</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Yang</surname><given-names>Wanhua</given-names></name>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3118972/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name><surname>Bian</surname><given-names>Shu</given-names></name>
<xref ref-type="author-notes" rid="fn003"><sup>&#x2020;</sup></xref>
<uri xlink:href="https://loop.frontiersin.org/people/3090665/overview"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing &#x2013; original draft</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Liu</surname><given-names>Liangming</given-names></name>
<xref ref-type="corresp" rid="c001"><sup>*</sup></xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-review-editing/">Writing &#x2013; review &amp; editing</role>
</contrib>
</contrib-group>
<aff id="aff1"><institution>Songjiang Hospital Affiliated to Shanghai Jiaotong University School of Medicine</institution>, <city>Shanghai</city>,&#xa0;<country country="cn">China</country></aff>
<author-notes>
<corresp id="c001"><label>*</label>Correspondence: Liangming Liu, <email xlink:href="mailto:liuliangming@shsmu.edu.cn">liuliangming@shsmu.edu.cn</email></corresp>
<fn fn-type="equal" id="fn003">
<label>&#x2020;</label>
<p>These author shave contributed equally to this work and share first authorship</p></fn>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-17">
<day>17</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>15</volume>
<elocation-id>1653725</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>08</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>17</day>
<month>11</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Yang, Bian and Liu.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Yang, Bian and Liu</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-17">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Aims</title>
<p>To investigate the effect of urotensin II(UII)/UII receptor(UT) on hepatic carboxylesterase1f(Ces1f) expression in acute liver failure(ALF) mice.</p>
</sec>
<sec>
<title>Methods</title>
<p>ALF was induced in male Balb/c mice using lipopolysaccharide (LPS)/D-galactosamine (D-GalN) i.p. after a tail vein injection of Urantide, a specific antagonist of UT receptor. Liver tissues were collected at 0-12h to detect <italic>UII</italic> and <italic>Ces1f</italic> mRNA levels in ALF mice. Mice were divided into four groups (n=6 each group): (A) Urantide(-), LPS/D-GalN(-), (B) Urantide(+), LPS/D-GalN(-), (C) Urantide(-), LPS/D-GalN(+), and (D) Urantide(+), LPS/D-GalN(+). Liver tissues were collected at 6 h after a challenge of LPS/D-GalN. Time-depended levels were observed of hepatic <italic>UII</italic> and <italic>Ces1f</italic> mRNA over a period of 12 hours after LPS/D-GalN challenge. Liver injury was evaluated via hematoxylin-eosin (HE) staining, serum alanine aminotransferase(ALT)/aspartate aminotransferase(AST), and the mRNA and protein expression levels of Ces1f and UII expression were determined by fluorescence <italic>in situ</italic> hybridization(FISH), quantitative real-time PCR (qPCR) and Western blotting (WB), respectively.</p>
</sec>
<sec>
<title>Results</title>
<p>After LPS/D-GalN injection, hepatic <italic>UII</italic> mRNA rose at 2 h (<italic>P</italic> &lt; 0.05 <italic>vs</italic> 0 h), reached the peaked level at 6 h, and the level began to degrade at 8 h, but remained higher than at 0 h (<italic>P</italic> &lt; 0.05, 10 h <italic>vs</italic> 0 h) till 12 h (<italic>P</italic>&gt;0.05, 12 h <italic>vs</italic> 0 h); while hepatic <italic>Ces1f</italic> mRNA decreased at 6 h (<italic>P</italic> &lt; 0.05 <italic>vs</italic> 0 h), reached the lowest level at 10 h, but began to rise at 12 h (<italic>P</italic>&gt;0.05, 12 h <italic>vs</italic> 10 h). In addition, urantide pretreatment inhibited the up-regulated expressions of hepatic <italic>UII</italic> mRNA and protein, whereas increases the down-regulated expressions of hepatic <italic>Ces1f</italic> mRNA and protein induced by LPS/D-GalN attack at 6 h.And serum ALT and AST levels were significantly decreased, whereas hepatic inflammatory injury improved via urantide injection in LPS/D-GalN-induced ALF mice.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>Ces1f maybe negatively regulated by UII/UT signal in LPS/D-GalN-induced ALF.</p>
</sec>
</abstract>
<kwd-group>
<kwd>acute liver failure</kwd>
<kwd>urotensin II</kwd>
<kwd>UII receptor</kwd>
<kwd>Ces1f</kwd>
<kwd>mouse</kwd>
</kwd-group>
<funding-group>
<funding-statement>The authors declared that financial support was received for work and/or its publication. The research was mainly funded by National Natural Science Foundation of China (No.81770612, 81070357) and Science and Technology Research of Songjiang District Science and Technology Commission in Shanghai (No.2023SJKJGG027).</funding-statement>
</funding-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="35"/>
<page-count count="10"/>
<word-count count="5465"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Clinical and Diagnostic Microbiology and Immunology</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Acute liver failure (ALF) is an acute onset condition characterized by severe liver damage caused by multiple factors, leading to significant impairment or decompensation of the liver&#x2019;s synthetic, detoxification, metabolic, and biotransformation functions. As the body&#x2019;s largest immune organ, hepatic damage involves immune-mediated inflammatory mechanisms exerted by hepatic non-parenchymal on parenchymal cells underlying the onset and progression of ALF (<xref ref-type="bibr" rid="B30">Wu et&#xa0;al., 2010</xref>). In the liver, Kupffer cells (KC), the liver&#x2019;s resident macrophages, are the most important non-parenchymal cells, playing a pivotal role in the innate immue. An innate activation is the most early event triggering hepatic inflammatory injury (<xref ref-type="bibr" rid="B27">Triantafyllou et&#xa0;al., 2018a</xref>, <xref ref-type="bibr" rid="B28">Triantafyllou et&#xa0;al., 2018b</xref>; <xref ref-type="bibr" rid="B1">Antoniades et&#xa0;al., 2014</xref>). Under the stimulation of liver injury factors (including lipopolysaccharide (LPS)), KCs are activated and undergo M1 polarization (inflammatory phenotype), releasing large amounts of pro-inflammatory cytokines (such as tumor necrosis factor &#x3b1;(TNF-&#x3b1;), interleukin 1&#x3b2; (IL-1&#x3b2;), interferon &#x3b3; (IFN-&#x3b3;), interleukin 6 (IL-6), etc.) and chemokines (e.g.,C-X-C motif chemokine ligand 1 (Cxcl1), C-C motif chemokine ligand (Ccl3), C-C motif chemokine receptor-like 2 (Ccrl2), etc.), working in concert with acquired immune cells to eliminate common pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) in the body (<xref ref-type="bibr" rid="B19">Parlar et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B10">Li et&#xa0;al., 2023</xref>).</p>
<p>In ALF mice, KCs express Urotensin II (UII) at high levels. UII is a cyclic polypeptide molecule containing 11 amino acids with neurohormone-like biological activity.It plays a significant role in various pathophysiological activities, such as regulating immune function and participating in the regulation of hypertension and renal fibrosis (<xref ref-type="bibr" rid="B25">Sun and Liu, 2019</xref>). The UII receptor (Urotensin receptor, UT) is a specific orphan G protein-coupled receptor that binds specifically to UII to mediate signal transduction. Cells expressing UII and UT include endothelial cells, hepatobiliary epithelial cells, and KCs in the liver (<xref ref-type="bibr" rid="B25">Sun and Liu, 2019</xref>). Research confirms that UII primarily mediates hepatic immune-inflammatory injury by activating the toll-like receptor 4 (TLR4) signaling pathway and releasing its downstream proinflammatory cytokines, including TNF&#x3b1; and IL-1&#x3b2; (<xref ref-type="bibr" rid="B12">Liang et&#xa0;al., 2013</xref>). The hepaticellular distribution patterns of UII and UT show remarkable consistency, suggesting potential regulation by autocrine and paracrine mechanisms. As the liver&#x2019;s innate immune cells, KCs have been identified as the primary cellular source of UII/UT and inflammatory cytokine expression. Urantide, a specific antagonist of UT, can effectively inhibit the UII/UT signal and the release of these inflammatory mediators (<xref ref-type="bibr" rid="B33">Yu et&#xa0;al., 2020</xref>).</p>
<p>During ALF, hepatic metabolism is significantly impaired, including drug metabolism and lipid metabolism. Carboxylesterase 1 (Ces1), as a primary metabolic enzyme in the liver, is synthesized and highly expressed in the liver (<xref ref-type="bibr" rid="B3">Collins et&#xa0;al., 2022</xref>). It promotes the metabolism of various environmental toxins, carcinogens, and drugs (e.g., clopidogrel, sacubitril/valsartan, oseltamivir) (<xref ref-type="bibr" rid="B13">Liu et&#xa0;al., 2024</xref>) and participates in the transport and metabolism of cholesterol esters and free fatty acids (<xref ref-type="bibr" rid="B23">Satoh et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B21">Sanghani et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B22">Satoh and Hosokawa, 1998</xref>). Ces1f, a subtype of carboxylesterase 1, exhibits hydrolytic activity toward triglycerides and retinol (RE) (<xref ref-type="bibr" rid="B7">He et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B4">Crow et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B18">Mangum et&#xa0;al., 2018</xref>). Study indicate Ces1f plays an important role in liver X receptor &#x3b1;(LXR&#x3b1;) protection of hepatic damage (<xref ref-type="bibr" rid="B2">Becares et&#xa0;al., 2019</xref>). Our reporter showed that KCs expressed Ces1f, and hepatic damage aggravated due to <italic>Ces1f</italic> gene knockdown in the liver. It suggests Ces1f has hepatic protection against immune infammation via KC activation. However, the effect of UII/UT on Ces1f remains unclear.</p>
</sec>
<sec id="s2">
<title>This study aims to investigate <italic>Ces1f</italic> gene expression in LPS/D-GalN-induced ALF mice model using UT antagonist urantide, thereby further elucidating the pathophysiological mechanisms through which the UII/UT system mediates ALF development.</title>
</sec>
<sec id="s3" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s3_1">
<label>2.1</label>
<title>Reagents</title>
<p>Lipopolysaccharide (LPS) and D-galactosamine (D-GalN) were purchased from Sigma-Aldrich (St. Louis, MO,USA). Urantide was obtained from Peptides International (Tokyo, Japan). The SYBR Green PCR Master Mix and reverse transcription kit were acquired from TaKaRa Bio Inc. (Tokyo, Japan). Trizol reagent was procured from Thermo Fisher Scientific (Shanghai, China). All PCR primers were commercially synthesized by Shanghai Bioengineering Co. Ltd.(Shanghai, China).</p>
</sec>
<sec id="s3_2">
<label>2.2</label>
<title>Animals experiments</title>
<p>Healthy male Balb/c mice, aged 6&#x2013;8 weeks, specific pathogen-free (SPF) grade, weighing 20&#x2013;22 g, were obtained from the Experimental Animal Center of Shanghai First People&#x2019;s Hospital Affiliated to Shanghai Jiao Tong University (License No.SCXK (Hu) 2018-0004). The mice were housed under controlled environmental conditions: temperature (20&#x2013;22 &#xb0;C), noise (&lt;50 dB), humidity (40&#x2013;80%), and a 12/12-hour light/dark cycle. They were provided with ad libitum access to food and water. Before the experiment, the mice were fasted for 12 hours with free access to water. Animal experimental protocols were approved by the Animal Welfare and Ethics Committee of Songjiang Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (Approval No. ACE-001-2024-R1).</p>
<p>A total of 42 healthy male Balb/c mice were intraperitoneally administered LPS (50 &#x3bc;g/kg) combined with D-GalN (800 mg/kg). Liver tissue samples were collected at specified time points (0, 2, 4, 6, 8, 10, and 12 h; n=6 per time point) for analysis of <italic>UII</italic> mRNA and <italic>Ces1f</italic> mRNA expression levels.An additional cohort of 24 healthy male Balb/c mice were randomly allocated into four experimental groups (n=6 per group): Group A: urantide(-) LPS/D-GalN(-); Group B: urantide(+) LPS/D-GalN(-); Group C: urantide(-) LPS/D-GalN(+); Group D: urantide(+) LPS/D-GalN(+). The ALF mice model was established according to established protocols (Sanghan et&#xa0;al.,2009) through intraperitoneal injection of LPS (50 &#x3bc;g/kg) and D-GalN (800 mg/kg) dissolved in 0.2 mL of 0.9% sodium chloride solution. Control animals received an equivalent volume (0.2 mL) of 0.9% sodium chloride solution alone. For pretreatment groups, urantide (0.6 mg/kg dissolved in 0.9% sodium chloride) was administered via tail vein injection 30 minutes prior to LPS/D-GalN or saline administration. Liver tissue specimens and serum samples were collected 6 hours post-treatment.</p>
</sec>
<sec id="s3_3">
<label>2.3</label>
<title>Biochemical assays</title>
<p>Frozen serum samples from each experimental group were retrieved from -80 &#xb0;C storage and thawed at room temperature. The serum was then diluted to an appropriate volume with 1&#xd7;&#xa0;phosphate-buffered saline (PBS). Subsequently, the samples were sent to the Clinical Laboratory of Songjiang District Central Hospital (Shanghai, China) for automated biochemical analysis. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using a fully automated biochemical analyzer. The obtained values were multiplied by the corresponding dilution factor to determine the actual serum ALT and AST concentrations.</p>
</sec>
<sec id="s3_4">
<label>2.4</label>
<title>Patholigical examination</title>
<p>The tissue microarray sections were sequentially immersed in xylene and graded ethanol solutions for deparaffinization and rehydration. Following antigen retrieval, immunohistochemical staining was performed using 3,3&#x2019;-diaminobenzidine (DAB) as the chromogen with hematoxylin counterstaining. The stained sections were then dehydrated through an ethanol gradient, cleared in xylene, and mounted with neutral balsam under cover slips. All histological assessments were conducted in a blinded manner by certified pathologists from our institution, who randomly selected 8&#x2013;10 high-power fields (&#xd7;400 magnification) for evaluation under light microscopy.</p>
</sec>
<sec id="s3_5">
<label>2.5</label>
<title>Reverse transcription quantitative polymerase chain reaction analysis</title>
<p>For RNA isolation, 50 mg of liver tissue was homogenized in 1 mL of Trizol reagent (Takara R036A) following the manufacturer&#x2019;s protocol, with all procedures performed on ice to prevent RNA degradation. The extracted total RNA was resuspended in 50 &#x3bc;L of RNase-free water, and its concentration and purity were spectrophotometrically determined. All samples exhibited A260/A280 ratios &gt;1.8, indicating high RNA purity. First-strand cDNA synthesis was performed using 500 ng of total RNA with 2 &#x3bc;L of 5&#xd7; PrimeScript RT Master Mix in a 10 &#x3bc;L reaction volume (adjusted with DEPC-treated water). The reverse transcription conditions were: 37 &#xb0;C for 90 s, 85 &#xb0;C for 5 s, followed by indefinite hold at 4 &#xb0;C. The resulting cDNA was stored at -20 &#xb0;C until use.Gene-specific primers (designed and synthesized by ShanghaiBioengineering Co.) with their corresponding sequences and product lengths are listed in <xref ref-type="table" rid="T1"><bold>Table&#xa0;1</bold></xref>. Quantitative real-time PCR was performed using the SYBR Green system(Takara RR420) in a laminar flow hood with reagents maintained on ice. The 20 &#x3bc;L reaction mixture contained:10 &#x3bc;L of TB Premix Ex Taq (2&#xd7;),0.4 &#x3bc;L each of forward and reverse primers,0.4 &#x3bc;L of ROX Reference Dye II (50&#xd7;),2 &#x3bc;L of cDNA template,RNase-free water to final volume.Amplification was conducted on an ABI7500 instrument using a two-step protocol:Initial denaturation: 95&#xb0;C for 15 min (1&#xa0;cycle);Amplification: 40 cycles of 94&#xb0;C for 20 s and 60&#xb0;C for 34 s.<italic>GAPDH</italic> served as the endogenous reference gene. Following amplification, CT values were obtained and relative mRNA expression levels were calculated using the 2<sup>-&#x394;&#x394;CT</sup> method.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequences used for real-time PCR analysis.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">Primer sequence (5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="left">Product (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" align="left"><italic>Ces1f</italic></td>
<td valign="middle" align="left">Forward: TGGAGAGTCAGCAGGAGGTTACAG</td>
<td valign="middle" align="center">290</td>
</tr>
<tr>
<td valign="middle" align="left"/>
<td valign="middle" align="left">Reverse: AGCACACTTGTCACGAACTGGTC</td>
<td valign="middle" align="center"/>
</tr>
<tr>
<td valign="middle" align="left"><italic>UII</italic></td>
<td valign="middle" align="left">Forward: CTTCTCGCCGCATCATGGACAG</td>
<td valign="middle" align="center">168</td>
</tr>
<tr>
<td valign="middle" align="left"/>
<td valign="middle" align="left">Reverse: TGACGGGAAGGGACAGCAGTG</td>
<td valign="middle" align="center"/>
</tr>
<tr>
<td valign="middle" align="left"><italic>GAPDH</italic></td>
<td valign="middle" align="left">Forward: GACATGCCGCCTGGAGAAAC</td>
<td valign="middle" align="center">244</td>
</tr>
<tr>
<td valign="middle" align="left"/>
<td valign="middle" align="left">Reverse: GTCCACCACCCTGTTGCTGTAG</td>
<td valign="middle" align="center"/>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_6">
<label>2.6</label>
<title>Fluorescence <italic>in situ</italic> hybridization</title>
<p>Fresh liver tissues were immersed in fixative solution for &#x2265;24 h at 4&#xb0;C,then dehydrated through a graded ethanol series (70% to 100%),cleared in xylene, and infiltrated with paraffin (58&#x2013;60&#xb0;C) using an automated tissue processor. Tissues were embedded in paraffin blocks. Briefly, molten paraffin was poured into molds, and tissues were oriented before cooling on a -20&#xb0;C freezing stage. Solidified blocks were trimmed for sectioning. Serial sections (5&#x3bc;m thickness) were dried at 60&#xb0;C for 45 min and then dewaxed in xylene (2&#xd7;10 min) and rehydrated through a graded ethanol series (100% to 70%).Slides were treated with 3% hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) in methanol for 10 min at room temperature (RT) to block peroxidase activity. Target mRNA was exposed by incubating sections in citrate buffer (pH 6.0) at 95&#xb0;C for 15 min. Sections were covered with prehybridization buffer and incubated at 37&#xb0;C for 4 h in a humidified chamber to reduce nonspecific binding. Digoxigenin (DIG)-labeled Ces1f probes (100 ng/&#x3bc;L in hybridization buffer) were applied, and slides were hybridized at 60&#xb0;C overnight (16&#x2013;18 h).Stringency washes: 2&#xd7; SSC (RT, 10 min) &#x2192; 0.5&#xd7; SSC (60&#xb0;C, 15 min).Blocking: 5% bovine serum albumin (BSA) in PBS for 1 h at RT. Probes were detected with biotinylated anti-DIG antibody (1:500, Roche) for 1 h at RT. Nuclei were counterstained with DAPI (5 &#x3bc;g/mL, 2 min).Slides were cover slipped with antifade mounting medium (Thermo Fisher) and imaged under a Zeiss LSM 880 confocal microscope (20&#xd7;/40&#xd7;objectives).</p>
</sec>
<sec id="s3_7">
<label>2.7</label>
<title>Western blotting</title>
<p>Approximately 20 mg of liver tissue was placed in a 1.5 mL tube. Added 1 mL of RIPA buffer supplemented with 50 &#x3bc;L of protease inhibitor cocktail (Roche). Tissue was mechanically disrupted using three 3-mm stainless steel beads in a tissue homogenizer (60 Hz, 2 min), followed by incubation on ice for 30 min to complete lysis. Lysates were centrifuged at 12,000 &#xd7; g, 4&#xb0;C for 10 min. Supernatants were collected and stored at &#x2212;80&#xb0;C until use. Protein concentration was determined using a BCA assay, following the manufacturer&#x2019;s protocol. Samples were mixed with 4&#xd7; Loading buffer and heated at 95&#xb0;C for 5 min. Equal amounts of protein (20&#x2013;30 &#x3bc;g/lane) were resolved on 12% polyacrylamide gels at 100 V for 90 min. Proteins were electrophoretically transferred to nitrocellulose membranes. Membranes were incubated in 5% non-fat milk in TBST for 1 h at RT. Rabbit monoclonal anti-Ces1f (1:1000, Abmart) and Rabbit monoclonal anti-UII (1:1000, Santa Cruz)Diluted in 5% BSA/TBST; incubated overnight at 4 &#xb0;C with gentle agitation. HRP-conjugated goat anti-rabbit IgG (1:2000, beyotime) in 5% milk/TBST, 1 h at RT. Membranes were incubated with SuperSignal&#x2122; West Pico PLUS Chemiluminescent Substrate (Thermo Fisher) for 1 min and imaged using a Bio-Rad ChemiDoc&#x2122; MP System. Antibodies were removed with stripping buffer at RT for 10 min. Reblocked and reprobed for &#x3b2;-actin (1:10000, beyotime) or GAPDH (1:10000, beyotime) as loading controls. Band intensities were quantified using ImageJ 1.4.3.67 (NIH).</p>
</sec>
<sec id="s3_8">
<label>2.8</label>
<title>Statistical analysis</title>
<p>Quantitative data were expressed as mean &#xb1; standard deviation (SD) and analyzed using SPSS 20.0 software (IBM Corp., USA). For comparisons between two groups, independent samples t-test was used for parametric data, while the Mann-Whitney U test was applied for non-parametric data. Multiple group comparisons were performed using one-way ANOVA followed by appropriate <italic>post hoc</italic> tests (Tukey&#x2019;s or LSD) when significance was detected; when the assumption of homogeneity of variance was violated (as assessed by Levene&#x2019;s test), the Kruskal-Wallis test was employed instead. The P-value &lt; 0.05 was considered statistically significant for all analyses.</p>
</sec>
</sec>
<sec id="s4" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s4_1">
<label>3.1</label>
<title>Time-dependent expression of hepatic <italic>UII</italic> mRNA in LPS/D-GalN-induced ALF mice</title>
<p>Following LPS/D-GalN administration, hepatic <italic>UII</italic> mRNA expression exhibited a time-dependent dynamic pattern, with relative expression levels of 1 (baseline), 2.62 &#xb1; 0.61, 4.09 &#xb1; 0.71, 10.38 &#xb1; 1.49, 9.15 &#xb1; 0.88, 2.56 &#xb1; 0.57, and 1.46 &#xb1; 0.52 at 0, 2, 4, 6, 8, 10, and 12 h post-treatment, respectively. Statistical analysis revealed a significant upregulation as early as 2 h (<italic>P</italic> &lt; 0.01 <italic>vs</italic> 0 h), peaking at 6 h (10.38 &#xb1; 1.49, <italic>P</italic> &lt; 0.01) and remaining elevated at 8 h. Expression levels subsequently declined, showing significant reduction at 10 h (<italic>P</italic> &lt; 0.05 <italic>vs</italic> 0 h) and returning to baseline by 12 h (<italic>P</italic> = 0.435 <italic>vs</italic> 0 h) (<xref ref-type="fig" rid="f1"><bold>Figure&#xa0;1</bold></xref>). This biphasic response suggests rapid activation and subsequent resolution of <italic>UII</italic> signaling following inflammatory challenge.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Hepatic <italic>UII</italic> mRNA Expression in LPS/D-GalN-Induced ALF Mice at Different Time Points. The vertical axis represents the relative expression level of <italic>UII</italic> 2<sup>-&#x25b3;&#x25b3;ct</sup>, *Compared to 0 h <italic>P</italic>&lt;0.05, #Compared to 8 h <italic>P</italic>&lt;0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g001.tif">
<alt-text content-type="machine-generated">Bar graph showing UII relative expression levels over time. Time points are 0h, 2h, 4h, 6h, 8h, 10h, and 12h. Expression peaks at 6h, with a significant decrease by 12h. Asterisks and hash marks denote statistical significance.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_2">
<label>3.2</label>
<title>Time-dependent expression of hepatic <italic>Ces1f</italic> mRNA in LPS/D-GalN-induced ALF mice</title>
<p>Following LPS/D-GalN challenge, hepatic <italic>Ces1f</italic> demonstrated a progressive downregulation, with relative expression levels measuring 1 (baseline), 0.85 &#xb1; 0.10, 0.92 &#xb1; 0.09, 0.58 &#xb1; 0.05, 0.43 &#xb1; 0.11, 0.26 &#xb1; 0.04, and 0.41 &#xb1; 0.04 at 0, 2, 4, 6, 8, 10, and 12 h post treatment, respectively. Statistical analysis revealed this suppression became statistically significant by 6 h (<italic>P</italic> &lt; 0.01 <italic>vs</italic> 0 h), reaching a nadir at 10 h (0.26 &#xb1; 0.04), remained during the observed time window (all <italic>P</italic> &lt; 0.05 <italic>vs</italic> baseline). Notably, the expression levels began to rise at 12 h (0.41 &#xb1; 0.04, <italic>P</italic> &lt; 0.05 <italic>vs</italic> 10 h). These findings demonstrate that <italic>Ces1f</italic> downregulation (1) initiates till 6 h, (2) correlates temporally with ALF progression, and (3) exhibits a statistically reversion at the end of the observed timeframe (<xref ref-type="fig" rid="f2"><bold>Figure&#xa0;2</bold></xref>), suggesting its expression kinetics may serve as an indicator of hepatic metabolic dysfunction or recovery during inflammatory injury.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Hepatic <italic>Ces1f</italic> mRNA Expression in LPS/D-GalN-Induced ALF Mice at Different Time Points. The vertical axis represents the relative expression level of <italic>Ces1f</italic><sup>2-&#x25b3;&#x25b3;ct</sup>, *<italic>P</italic> &lt; 0.05 <italic>vs</italic> 0 h, #<italic>P</italic> &lt; 0.05 <italic>vs</italic> 10 h.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g002.tif">
<alt-text content-type="machine-generated">Bar chart displaying Ces1f relative expression levels (2^-&#x394;&#x394;Ct) over time from zero to twelve hours. Expression peaks at zero hours and declines steeply, reaching the lowest point at ten hours, with slight recovery at twelve hours. The legend indicates color coding for each time point. Asterisks denote significant differences, and a hash mark indicates additional significance.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_3">
<label>3.3</label>
<title>Hepatic <italic>UII</italic> mRNA expression in mice challenged by LPS/D-GalN via urantide pretreatment</title>
<p>Quantitative analysis of hepatic <italic>UII</italic> mRNA expression revealed significant differences among experimental groups, with relative expression levels of 1.00 (Group A), 1.08 &#xb1; 0.33 (Group B), 9.62 &#xb1; 2.31 (Group C) and 5.61 &#xb1; 1.3 (Group D). Statistical evaluation demonstrated that: (i) LPS/D-GalN-challenged Group C exhibited a 9.6-fold upregulation compared to controls (<italic>P</italic> &lt; 0.01 <italic>vs</italic> Groups A/B); (ii) no significant difference existed between untreated controls (Group A <italic>vs</italic> B, <italic>P</italic> = 0.99); and (iii) urantide pretreatment in Group D significantly attenuated this drug induction by 41.7% versus Group C (<italic>P</italic> &lt; 0.05) (<xref ref-type="fig" rid="f3"><bold>Figure&#xa0;3</bold></xref>). These results establish that: (1) UII is robustly upregulated during ALF, (2) basal UII expression remains stable under physiological conditions, and (3) pharmacological UT receptor blockade partially reverses inflammation-induced UII overexpression, supporting the involvement of UII/UT signaling in ALF pathogenesis.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Expression of <italic>UII</italic> mRNA in liver tissue of mice treated with LPS/D-GalN at 6h. <bold>(A)</bold> Urantide(-)LPS/D-GalN(-); <bold>(B)</bold> Urantide(+)LPS/D-GalN(-); <bold>(C)</bold> Urantide(-)LPS/D-GalN(+); <bold>(D)</bold> Urantide(+)LPS/D-GalN(+); *<italic>P</italic> &lt; 0.01 <italic>vs</italic> group A; #<italic>P</italic> &lt; 0.05 <italic>vs</italic> group C;The vertical axis represents the relative expression levels of <italic>UII</italic> 2<sup>-&#x25b3;&#x25b3;ct</sup>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g003.tif">
<alt-text content-type="machine-generated">Bar graph illustrating UII relative expression (2^-&#x394;&#x394;Ct) across four groups labeled A, B, C, and D. Group C shows the highest expression, followed by D, while A and B have low values. Significant differences are indicated by asterisks for C and both asterisk and hash for D. A color legend is on the right.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_4">
<label>3.4</label>
<title>Hepatic <italic>Ces1f</italic> mRNA expression in mice challenged by LPS/D-GalN via urantide pretreatment</title>
<p>The relative expression of hepatic <italic>Ces1f</italic> mRNA exhibited significant variations across experimental groups (<xref ref-type="fig" rid="f4"><bold>Figure&#xa0;4</bold></xref>), with values of 1.00 (Group A), 0.91 &#xb1; 0.31 (Group B), 0.44 &#xb1; 0.12 (Group C), and 1.14 &#xb1; 0.40 (Group D). Key findings include: (1) Group C showed a 56% reduction in <italic>Ces1f</italic> expression compared to Group A (<italic>P</italic> &lt; 0.01), demonstrating LPS/D-GalN&#x2019;s potent suppressive effect; (2) No significant difference existed between control Groups A and B (<italic>P</italic> = 0.861), confirming urantide&#x2019;s neutral effect under physiological conditions; and (3) Group D exhibited a 2.6-fold higher expression than Group C (<italic>P</italic> &lt; 0.01), with levels similar to Group A (<italic>P</italic> = 0.372), indicating urantide&#x2019;s capacity to completely rescue <italic>Ces1f</italic> suppression during ALF. These results demonstrate that UII/UT system activation mediates <italic>Ces1f</italic> downregulation in ALF, while its pharmacological inhibition restores normal expression patterns, suggesting <italic>Ces1f</italic> as both a biomarker and potential therapeutic target in acute liver injury.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Expression of Ces1f mRNA in liver tissue of mice treated with LPS/D-GalN at 6h. <bold>(A)</bold> Urantide(-)LPS/D-GalN(-); <bold>(B)</bold> Urantide(+)LPS/D-GalN(-);<bold>(C)</bold> Urantide(-)LPS/D-GalN(+); <bold>(D)</bold>Urantide(+)LPS/D-GalN(+);*<italic>P</italic>&lt;0.01 vs group A; #<italic>P</italic>&lt;0.01 vs group C;The vertical axis represents the relative expression level of Ces1f 2<sup>-&#x25b3;&#x25b3;ct</sup>.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g004.tif">
<alt-text content-type="machine-generated">Bar chart showing Ces1f relative expression levels (2^&#x2212;&#x394;&#x394;Ct) across four groups: A, B, C, and D. Group C has the lowest expression, marked by an asterisk, and group D has the highest, marked with a hashtag. Error bars indicate variability.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_5">
<label>3.5</label>
<title>FISH Assay for the localization and expression levels of <italic>Ces1f</italic> mRNA in the liver</title>
<p>Fluorescence <italic>in situ</italic> hybridization (FISH) analysis demonstrated that <italic>Ces1f</italic> mRNA was predominantly localized in the cytoplasmic compartment with negligible nuclear staining across all experimental groups. Quantitative fluorescence intensity revealed striking differences in expression levels among groups: Group A (214,708.99 &#xb1; 34,817.92), Group B (209,717.48 &#xb1; 30,330.57), Group C (19,736.74 &#xb1; 3,059.74) and Group D (185,306.75 &#xb1; 18,052.25). Statistical analysis showed Group C exhibited significantly lower expression than Groups A, B and D (all <italic>P</italic> &lt; 0.01), while Group D demonstrated a remarkable 9.4-fold increase versus Group C (<italic>P</italic> &lt; 0.01), with no difference observed between Groups A and B (<italic>P</italic> = 0.755). These results clearly indicate that: (1) ALF induces profound suppression of cytoplasmic <italic>Ces1f</italic> expression; (2) Urantide pretreatment effectively restores <italic>Ces1f</italic> to near-physiological levels; and (3) The UII/UT system specifically modulates <italic>Ces1f</italic> expression under pathological conditions without affecting basal levels, suggesting its role as a stress-responsive regulatory mechanism in hepatocytes (<xref ref-type="fig" rid="f5"><bold>Figure&#xa0;5</bold></xref>). The subcellular localization pattern further supports Ces1f&#x2019;s functional role in cytoplasmic metabolic processes that are disrupted during acute liver injury.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>FISH Assay for the Localization and Expression Levels of <italic>Ces1f</italic> mRNA in the Liver. <bold>(A)</bold> Urantide(-)LPS/D-GalN(-); <bold>(B)</bold> Urantide(+),LPS/D-GalN(-); <bold>(C)</bold> Urantide(-),LPS/D-GalN(+); <bold>(D)</bold> Urantide(+),LPS/D-GalN(+);*<italic>P</italic> &lt; 0.01 <italic>vs</italic> group A; #<italic>P</italic> &lt; 0.01 <italic>vs</italic> group C.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g005.tif">
<alt-text content-type="machine-generated">Fluorescence microscopy images showing Ces1f expression with red signals, and a merged image with blue counterstaining, across four samples labeled A, B, C, and D. Below, a bar graph compares the FISH IOD sum. Sample C shows a significant decrease indicated by an asterisk, while sample D shows a notable increase indicated by a hash mark.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_6">
<label>3.6</label>
<title>Expression of hepatic UII and Ces1f proteins in mice challenged by LPS/D-GalN via urantide pretreatment</title>
<p>Western blot analysis revealed significant alterations of hepatic UII and Ces1f protein expression across experimental groups (<xref ref-type="fig" rid="f6"><bold>Figure&#xa0;6</bold></xref>). Statistical analysis shows the levels of UII protein in mouse liver among groups:Group A (0.8043 &#xb1; 0.1161), Group B (0.7231 &#xb1; 0.1061), Group C (1.046 &#xb1; 0.1817), and Group D (0.8043 &#xb1; 0.1233). The UII protein expression in Group C showed a marked increase compared to Group A (normal control) (<italic>P</italic> &lt; 0.05), while urantide pretreatment in Group D significantly attenuated this upregulation relative to Group C (<italic>P</italic> &lt; 0.05). Notably, no difference in UII expression was observed between Groups A and B (<italic>P</italic> = 0.7276). Statistical analysis shows the levels of Ces1f protein in mouse liver among groups:Group A (1.268 &#xb1; 0.1730), Group B (1.104 &#xb1; 0.34446), Group C (0.7813 &#xb1; 0.3829), and Group D (1.279 &#xb1; 0.2818). Ces1f protein expression demonstrated an inverse pattern, with Group C exhibiting significant downregulation versus Group A (<italic>P</italic> &lt; 0.05), and Group D showing restored expression levels compared to Group C (<italic>P</italic> &lt; 0.05). The similar Ces1f expression between Groups A and B (<italic>P</italic> = 0.6784) confirmed that urantide administration does not affect basal protein levels in normal hepatocytes. These protein-level findings corroborate our mRNA expression data, demonstrating that: (1) ALF induces coordinated upregulation of UII and downregulation of Ces1f; (2) Urantide effectively normalizes these pathological alterations; and (3) The UII/UT signal blocker specifically modulates Ces1f expression during inflammatory injury without influencing physiological homeostasis, highlighting its potential as a therapeutic target for acute liver failure.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Western blotting detection of UII and Ces1f protein expression in liver tissue. <bold>(A)</bold> Urantide(-),LPS/D-GalN(-); <bold>(B)</bold> Urantide(+),LPS/D-GalN(-); <bold>(C)</bold> Urantide(-),LPS/D-GalN(+); <bold>(D)</bold> Urantide(+),LPS/D-GalN(+);*<italic>P</italic> &lt; 0.05 <italic>vs</italic> group A; #<italic>P</italic> &lt; 0.05 <italic>vs</italic> group C.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g006.tif">
<alt-text content-type="machine-generated">Western blot results and bar graphs show the expression levels of UII and Ces1f proteins. UII is detected at 14 kDa with GAPDH as a 36 kDa loading control. Ces1f is detected at 61 kDa with &#x3b2;-actin as a 43 kDa loading control. Bar graphs to the right illustrate the UII/GAPDH and Ces1f/&#x3b2;-actin ratios for samples labeled A through D, showing variations in expression levels marked by an asterisk and hash symbol indicating statistical significance.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_7">
<label>3.7</label>
<title>The levels of serum ALT and AST in mice challenged by LPS/D-GalN via urantide pretreatment</title>
<p>Serum biochemical analysis revealed marked differences in hepatic injury markers across experimental groups. The ALT levels were 94.63 &#xb1; 10.08 U/L (Group A), 85.13 &#xb1; 9.72 U/L (Group B), 12510.75 &#xb1; 2064.49 U/L (Group C), and 5593 &#xb1; 1316.53 U/L (Group D), while corresponding AST levels measured 380 &#xb1; 39.70 U/L, 309 &#xb1; 32.90 U/L, 8495 &#xb1; 1308.42 U/L, and 3455.25 &#xb1; 535.98 U/L, respectively. Statistical comparisons demonstrated that both LPS/D-GalN-challenged groups (C and D) exhibited significantly elevated ALT and AST levels compared to control groups (A and B) (<italic>P</italic> &lt; 0.01). Notably, urantide pretreatment in Group D resulted in substantially attenuated transaminase elevations relative to untreated ALF mice (Group C), with reductions of 55.3% for ALT and 59.3% for AST (both <italic>P</italic> &lt; 0.01) (<xref ref-type="fig" rid="f7"><bold>Figure&#xa0;7</bold></xref>). These findings demonstrate that: (1) LPS/D-GalN successfully induced severe hepatocellular injury, and (2) UII/UT system blockade significantly ameliorates this damage, suggesting the therapeutic potential of urantide in acute liver failure.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>The levels of serum ALT and AST in LPS/D-GalN-Induced ALF Mice after urantide. *<italic>P</italic> &lt; 0.01 <italic>vs</italic> group A; #<italic>P</italic> &lt; 0.01 <italic>vs</italic> group C.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g007.tif">
<alt-text content-type="machine-generated">Bar graph comparing ALT and AST levels in IU/L across four categories labeled A, B, C, and D. Categories A and B show minimal enzyme levels. Category C shows a significant increase, with ALT reaching nearly 18,000 IU/L and AST around 12,000 IU/L. Category D shows reduced levels, with ALT and AST both under 10,000 IU/L. Asterisks and hashtags denote statistical significance. Black bars represent ALT, and gray bars represent AST.</alt-text>
</graphic></fig>
</sec>
<sec id="s4_8">
<label>3.8</label>
<title>Hepatic Histopathological changes in mice challenged by LPS/D-GalN via urantide pretreatment</title>
<p>Histopathological examination demonstrated distinct morphological changes across experimental groups (<xref ref-type="fig" rid="f8"><bold>Figure&#xa0;8</bold></xref>). Control groups (A and B) maintained normal hepatic architecture, with intact lobular structure and morphologically normal hepatocytes. In contrast, Group C (LPS/D-GalN-only) exhibited severe parenchymal destruction characterized by: (1) disrupted lobular architecture, (2) extensive necroinflammatory foci, (3) marked hepatocellular necrosis, (4) dense inflammatory infiltrates, and (5) pronounced sinusoidal congestion. Notably, urantide-pretreated Group D showed significant histological improvement compared to Group C, with attenuated sinusoidal congestion and reduced hepatocellular necrosis, indicating partial protection against LPS/D-GalN-induced injury through UII/UT system blockade. These findings correlate with the observed biochemical improvements and suggest that urantide modulates both inflammatory and cytotoxic components of ALF pathogenesis.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Histopathological changes in liver tissue of mice treated with LPS/D-GalN for 6 hours. <bold>(A)</bold> Urantide(-),LPS/D-GalN(-); <bold>(B)</bold> Urantide(+),LPS/D-GalN(-); <bold>(C)</bold> Urantide(-),LPS/D-GalN(+); <bold>(D)</bold> Urantide(+),LPS/D-GalN(+); (HE staining, x200).Scale bar=100 &#x3bc;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1653725-g008.tif">
<alt-text content-type="machine-generated">Microscopic images of liver tissue slices labeled A, B, C, and D. Each image shows varying degrees of liver cellulature and structure in pink and purple hues, with some circular and elongated white spaces indicating blood vessels or ducts. Scale bars indicate magnification level at 100 micrometers.</alt-text>
</graphic></fig>
</sec>
</sec>
<sec id="s5" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>UII, a neurohormone-like peptide primarily localized in KCs within the liver, has been identified as a key mediator in inflammatory diseases (<xref ref-type="bibr" rid="B25">Sun and Liu, 2019</xref>). Its biological effects are mediated through the UII/UT system, formed by binding to its specific receptor UT (<xref ref-type="bibr" rid="B24">Segain et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B26">Tomiyama et&#xa0;al., 2015</xref>). The uncontrolled release of proinflammatory cytokines from KCs leads to massive hepatocyte necrosis, constituting the primary pathophysiological mechanism of ALF (<xref ref-type="bibr" rid="B17">Maiwall et&#xa0;al., 2024</xref>).</p>
<p>Prior studies revealed that in ALF, both UII/UT levels and inflammatory cytokines (such as IL-6 and TNF-&#x3b1;) are significantly elevated (<xref ref-type="bibr" rid="B12">Liang et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B9">Leifeld et&#xa0;al., 2010</xref>). Mechanistically, UII/UT upregulation activates TLR4/p38-mitogen-activated protein kinase(p38-MAPK) and nuclear factor &#x3ba;B(NF-&#x3ba;B) signaling pathways, inducing excessive secretion of inflammatory mediators like IL-6 and TNF-&#x3b1; (<xref ref-type="bibr" rid="B14">Liu et&#xa0;al., 2015</xref>). Our studies further showed that serum UII secretion is an earlier event than TNF-&#x3b1; in ALF (<xref ref-type="bibr" rid="B14">Liu et&#xa0;al., 2015</xref>). It suggests that the UII/UT system induce hepatic injury by initiating the inflammatory cascade in ALF. Thus, the UII/UT system serves as a key trigger in LPS/D-GalN-induced ALF development. Previous reportor demonstrated that urantide protected against animals&#x2019; death and alleviated hepatic inflammatory injury by blocking UII/UT signaling in LPS/D-GalN-challenged ALF mice (<xref ref-type="bibr" rid="B12">Liang et&#xa0;al., 2013</xref>). In this experiment, hepatic inflammatory remission was again observed, including the decrease of serum ALT/AST and the improvement of hepatic tissue injury due to urantide pretreatment in ALF mice.</p>
<p>It is demonstred that during ALF, p38 MAPK/c-jun n-terminal kinase(JNK) remains persistently activated (<xref ref-type="bibr" rid="B6">Guan et&#xa0;al., 2025</xref>), and overactivated p38 MAPK and JNK phosphorylate peroxisome proliferator-activated receptor alpha (PPAR&#x3b1;), thereby suppressing the transcriptional activity of PPAR&#x3b1; bound to the Ces1f gene promoter region (<xref ref-type="bibr" rid="B5">Fang and Judd, 2018</xref>; <xref ref-type="bibr" rid="B34">Zhang et&#xa0;al., 2024</xref>; <xref ref-type="bibr" rid="B29">Wen et&#xa0;al., 2019</xref>). Furthermore, we found that hepatic Ces1f expression is significantly downregulated in ALF (<xref ref-type="bibr" rid="B35">Zhao et&#xa0;al., 2024</xref>). Ces1f, as a member of the carboxylesterase family (<xref ref-type="bibr" rid="B11">Lian et&#xa0;al., 2016</xref>), is known to mediate xenobiotic detoxification (<xref ref-type="bibr" rid="B20">Quiroga et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B31">Yang et&#xa0;al., 2009</xref>) and ester metabolism (<xref ref-type="bibr" rid="B8">Hosokawa et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B32">Yang et&#xa0;al., 2007</xref>). In previous experimental, we further observed that Ces1f was mainly expressed in KCs, and hepatic injury exacerbated upon knocking down KC <italic>Ces1f</italic> gene in LPS/D-GalN-attacked mice (<xref ref-type="bibr" rid="B35">Zhao et&#xa0;al., 2024</xref>). However, it is unclear whether there is an association between the UII/UT signal and Ces1f expression in ALF.</p>
<p>In order to learn about the relationship between the above two, we analysed the time-dependent expression of hepatic <italic>UII</italic> and <italic>Ces1f</italic> genes in LPS/D-GalN-induced ALF in this experiment. We found that after LPS/D-GalN attack, hepatic <italic>UII</italic> mRNA rose rapidly, reached the peak within 6 h, and returned to normal levels at 12 h; while the <italic>Ces1f</italic> declined progressively from 6 h, but began to rise at 12 h. Our previous study indicated that 6 h is an important time point of hepatic injury, at which serum ALT/AST began to rise and hepatocellular death, inflammatory infiltration and hemorrhage appeared after LPS/D-GalN attacked (<xref ref-type="bibr" rid="B16">Liu et&#xa0;al., 2008</xref>). Therefore, the marked hepatic damage may originate from both UII/UT activation and Ces1f down-regulation. In addition, it seems that it can be deduced to a regulating effect of UII on Ces1f because hepatic UII expression is a significant earlier event than Ces1f in ALF.</p>
<p>To further know whether hepatic UII/UT signal has an influence on Ces1f, we assayed hepatic Ces1f expression at 6 h after LPS/D-GalN challenge using urantide pretreatment. In this experimental, we observed that urantide pretreatment reversed hepatic UII upregulation and Ces1f downregulation induced by LPS/D-GalN challenge in ALF mice. It suggests that UII/UT system can regulate hepatic Ces1f in ALF.</p>
<p>Using our established LPS/D-GalN-induced ALF model (<xref ref-type="bibr" rid="B21">Sanghani et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B15">Liu et&#xa0;al., 2013</xref>), we found that: 1. During the acute liver failure (ALF) phase, the time-dependent expression levels of <italic>UII</italic> and <italic>Ces1f</italic> mRNA exhibited opposite trends: <italic>UII</italic> mRNA began to increase 2 hours after LPS/D-GalN stimulation, peaked at 6 hours, remained elevated at 8 hours, and decreased to near-normal levels by 12 hours; conversely, <italic>Ces1f</italic> mRNA showed a significant decrease starting at 6 hours post-stimulation, reached its lowest point at 10 hours, and began to rise again by 12 hours. 2. Compared to controls, 6 hours after LPS/D-GalN treatment, the ALF model group exhibited upregulation of <italic>UII</italic> mRNA and protein levels in the liver, while <italic>Ces1f</italic> mRNA and protein levels in the liver were downregulated. 3. Following urantide administration, compared to the model group, the pretreatment ALF group showed downregulation of <italic>UII</italic> mRNA and protein levels in the liver, while <italic>Ces1f</italic> mRNA and protein levels in the liver were upregulated. This suggests that the UII/UT signaling system may exacerbate ALF by suppressing the expression of hepatic metabolic enzymes such as Ces1f. However, several questions remain unresolved: the mechanism by which UII/UT influences Ces1f remains unclear and requires investigation using primary hepatocytes. Future studies will further explore the downstream signaling pathways of UII/UT and its regulatory mechanisms on the transcription of hepatic metabolic enzymes.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online&#xa0;repositories. The names of the repository/repositories and&#xa0;accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1"><bold>Supplementary Material</bold></xref>.</p></sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Animal Welfare and Ethics&#xa0;Committee of Songjiang Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. The study was&#xa0;conducted in accordance with the local legislation and institutional requirements.</p></sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>WY: Writing &#x2013; original draft. SB: Writing &#x2013; original draft. LL: Writing &#x2013; review &amp; editing.</p></sec>
<ack>
<title>Acknowledgments</title>
<p>We would like to thank the support from Songjiang Hospital Affiliated to Shanghai Jiao Tong University School of Medicine and Shanghai Songjiang Clinical Medical College of Nanjing Medical University, and funding from National Natural Science Foundation of China.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The authors declared that generative AI was not used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If&#xa0;you identify any issues, please contact us.</p></sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p></sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2025.1653725/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2025.1653725/full#supplementary-material</ext-link></p>
<supplementary-material xlink:href="Image1.tif" id="SM1" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image2.tif" id="SM2" mimetype="image/tiff"/>
<supplementary-material xlink:href="Image3.jpeg" id="SM3" mimetype="image/jpeg"/></sec>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Antoniades</surname> <given-names>C. G.</given-names></name>
<name><surname>Khamri</surname> <given-names>W.</given-names></name>
<name><surname>Abeles</surname> <given-names>R. D.</given-names></name>
<name><surname>Taams</surname> <given-names>L. S.</given-names></name>
<name><surname>Triantafyllou</surname> <given-names>E.</given-names></name>
<name><surname>Possamai</surname> <given-names>L. A.</given-names></name>
<etal/>
</person-group>. (<year>2014</year>). 
<article-title>Secretory leukocyte protease inhibitor: a pivotal mediator of anti-inflammatory responses in acetaminophen-induced acute liver failure</article-title>. <source>Hepatology.</source> <volume>59</volume>, <fpage>1564</fpage>&#x2013;<lpage>1576</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.26933</pub-id>, PMID: <pub-id pub-id-type="pmid">24282114</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Becares</surname> <given-names>N.</given-names></name>
<name><surname>Gage</surname> <given-names>M. C.</given-names></name>
<name><surname>Voisin</surname> <given-names>M.</given-names></name>
<name><surname>Shrestha</surname> <given-names>E.</given-names></name>
<name><surname>Martin-Gutierrez</surname> <given-names>L.</given-names></name>
<name><surname>Liang</surname> <given-names>N.</given-names></name>
<etal/>
</person-group>. (<year>2019</year>). 
<article-title>Impaired LXR&#x3b1; Phosphorylation attenuates progression of fatty liver disease</article-title>. <source>Cell Rep.</source> <volume>26</volume>, <fpage>984</fpage>&#x2013;<lpage>995.e6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.celrep.2018.12.094</pub-id>, PMID: <pub-id pub-id-type="pmid">30673619</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Collins</surname> <given-names>J. M.</given-names></name>
<name><surname>Lu</surname> <given-names>R.</given-names></name>
<name><surname>Wang</surname> <given-names>X.</given-names></name>
<name><surname>Zhu</surname> <given-names>H. J.</given-names></name>
<name><surname>Wang</surname> <given-names>D.</given-names></name>
</person-group> (<year>2022</year>). 
<article-title>Transcriptional regulation of carboxylesterase 1 in human liver: role of the nuclear receptor subfamily 1 group H member 3 and its splice isoforms</article-title>. <source>Drug Metab. Dispos.</source> <volume>50</volume>, <fpage>43</fpage>&#x2013;<lpage>48</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1124/dmd.121.000649</pub-id>, PMID: <pub-id pub-id-type="pmid">34697082</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Crow</surname> <given-names>J. A.</given-names></name>
<name><surname>Herring</surname> <given-names>K. L.</given-names></name>
<name><surname>Xie</surname> <given-names>S.</given-names></name>
<name><surname>Borazjani</surname> <given-names>A.</given-names></name>
<name><surname>Potter</surname> <given-names>P. M.</given-names></name>
<name><surname>Ross</surname> <given-names>M. K.</given-names></name>
</person-group> (<year>2010</year>). 
<article-title>Inhibition of carboxylesterase activity of THP1 monocytes/macrophages and recombinant human carboxylesterase 1 by oxysterols and fatty acids</article-title>. <source>Biochim. Biophys. Acta</source> <volume>1801</volume>, <fpage>31</fpage>&#x2013;<lpage>41</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbalip.2009.09.002</pub-id>, PMID: <pub-id pub-id-type="pmid">19761868</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Fang</surname> <given-names>H.</given-names></name>
<name><surname>Judd</surname> <given-names>R. L.</given-names></name>
</person-group> (<year>2018</year>). 
<article-title>Adiponectin regulation and function</article-title>. <source>Compr. Physiol.</source> <volume>8</volume>, <fpage>1031</fpage>&#x2013;<lpage>1063</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cphy.c170046</pub-id>, PMID: <pub-id pub-id-type="pmid">29978896</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Guan</surname> <given-names>J.</given-names></name>
<name><surname>Wu</surname> <given-names>F.</given-names></name>
<name><surname>Wu</surname> <given-names>S.</given-names></name>
<name><surname>Ren</surname> <given-names>Y.</given-names></name>
<name><surname>Wang</surname> <given-names>J.</given-names></name>
<name><surname>Zhu</surname> <given-names>H.</given-names></name>
</person-group> (<year>2025</year>). 
<article-title>FTY720 alleviates D-GalN/LPS-induced acute liver failure by regulating the JNK/MAPK pathway</article-title>. <source>Int. Immunopharmacol.</source> <volume>157</volume>, <elocation-id>114726</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2025.114726</pub-id>, PMID: <pub-id pub-id-type="pmid">40311319</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>He</surname> <given-names>Y.</given-names></name>
<name><surname>Zhong</surname> <given-names>H.</given-names></name>
<name><surname>Yang</surname> <given-names>X.</given-names></name>
<name><surname>Shi</surname> <given-names>Q. Q.</given-names></name>
<name><surname>Xu</surname> <given-names>G. R.</given-names></name>
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
</person-group> (<year>2019</year>). 
<article-title>An effect of urantide on hepatic p120-catenin expression in acute hepatic failure mice</article-title>. <source>J. Nanjing Med. University(Natural Sciences)(in Chinese)</source> <volume>39</volume>, <fpage>495</fpage>&#x2013;<lpage>498</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7655/NYDXBNS20190406</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hosokawa</surname> <given-names>M.</given-names></name>
<name><surname>Furihata</surname> <given-names>T.</given-names></name>
<name><surname>Yaginuma</surname> <given-names>Y.</given-names></name>
<name><surname>Yamamoto</surname> <given-names>N.</given-names></name>
<name><surname>Watanabe</surname> <given-names>N.</given-names></name>
<name><surname>Tsukada</surname> <given-names>E.</given-names></name>
<etal/>
</person-group>. (<year>2008</year>). 
<article-title>Structural organization and characterization of the regulatory element of the human carboxylesterase (CES1A1 and CES1A2) genes</article-title>. <source>Drug Metab. Pharmacokinet.</source> <volume>23</volume>, <fpage>73</fpage>&#x2013;<lpage>84</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2133/dmpk.23.73</pub-id>, PMID: <pub-id pub-id-type="pmid">18305377</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Leifeld</surname> <given-names>L.</given-names></name>
<name><surname>Clemens</surname> <given-names>C.</given-names></name>
<name><surname>Heller</surname> <given-names>J.</given-names></name>
<name><surname>Trebicka</surname> <given-names>J.</given-names></name>
<name><surname>Sauerbruch</surname> <given-names>T.</given-names></name>
<name><surname>Spengler</surname> <given-names>U.</given-names></name>
</person-group> (<year>2010</year>). 
<article-title>Expression of urotensin II and its receptor in human liver cirrhosis and fulminant hepatic failure</article-title>. <source>Digestive Dis. Sci.</source> <volume>55</volume>, <fpage>1458</fpage>&#x2013;<lpage>1464</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10620-009-0875-4</pub-id>, PMID: <pub-id pub-id-type="pmid">19582578</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Li</surname> <given-names>X.</given-names></name>
<name><surname>Zhi</surname> <given-names>Y.</given-names></name>
<name><surname>Li</surname> <given-names>J.</given-names></name>
<name><surname>Lei</surname> <given-names>X.</given-names></name>
<name><surname>Ju</surname> <given-names>Y.</given-names></name>
<name><surname>Zhang</surname> <given-names>Y.</given-names></name>
<etal/>
</person-group>. (<year>2023</year>). 
<article-title>Single-cell RNA sequencing to reveal non-parenchymal cell heterogeneity and immune network of acetaminophen-induced liver injury in mice</article-title>. <source>Arch. Toxic</source> <volume>97</volume>, <fpage>1979</fpage>&#x2013;<lpage>1995</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00204-023-03513-4</pub-id>, PMID: <pub-id pub-id-type="pmid">37202523</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lian</surname> <given-names>J.</given-names></name>
<name><surname>Wei</surname> <given-names>E.</given-names></name>
<name><surname>Groenendyk</surname> <given-names>J.</given-names></name>
<name><surname>Das</surname> <given-names>S. K.</given-names></name>
<name><surname>Hermansson</surname> <given-names>M.</given-names></name>
<name><surname>Li</surname> <given-names>L.</given-names></name>
<etal/>
</person-group>. (<year>2016</year>). 
<article-title>Ces3/TGH deficiency attenuates steatohepatitis</article-title>. <source>Sci. Rep.</source> <volume>6</volume>, <elocation-id>25747</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep25747</pub-id>, PMID: <pub-id pub-id-type="pmid">27181051</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liang</surname> <given-names>D. Y.</given-names></name>
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
<name><surname>Ye</surname> <given-names>C. G.</given-names></name>
<name><surname>Zhao</surname> <given-names>L.</given-names></name>
<name><surname>Yu</surname> <given-names>F. P.</given-names></name>
<name><surname>Gao</surname> <given-names>D. Y.</given-names></name>
<etal/>
</person-group>. (<year>2013</year>). 
<article-title>Inhibition of UII/UTR system relieves acute inflammation of liver through preventing activation of NF-&#x3ba;B pathway in ALF mice</article-title>. <source>PloS One</source> <volume>8</volume>, <fpage>e64895</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0064895</pub-id>, PMID: <pub-id pub-id-type="pmid">23755157</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>Y.</given-names></name>
<name><surname>Li</surname> <given-names>J.</given-names></name>
<name><surname>Zhu</surname> <given-names>H. J.</given-names></name>
</person-group> (<year>2024</year>). 
<article-title>Regulation of carboxylesterases and its impact on pharmacokinetics and pharmacodynamics: an up-to-date review</article-title>. <source>Expert Opin. Drug Metab. Toxicol.</source> <volume>20</volume>, <fpage>377</fpage>&#x2013;<lpage>397</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/17425255.2024.2348491</pub-id>, PMID: <pub-id pub-id-type="pmid">38706437</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
<name><surname>Liang</surname> <given-names>D. Y.</given-names></name>
<name><surname>Ye</surname> <given-names>C. G.</given-names></name>
<name><surname>Tu</surname> <given-names>W. J.</given-names></name>
<name><surname>Zhu</surname> <given-names>T.</given-names></name>
</person-group> (<year>2015</year>). 
<article-title>The UII/UT system mediates upregulation of proinflammatory cytokines through p38 MAPK and NF-&#x3ba;B pathways in LPS-stimulated Kupffer cells</article-title>. <source>PloS One</source> <volume>10</volume>, <fpage>e0121383</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0121383</pub-id>, PMID: <pub-id pub-id-type="pmid">25803040</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
<name><surname>Ye</surname> <given-names>C. G.</given-names></name>
<name><surname>Liang</surname> <given-names>D. Y.</given-names></name>
<name><surname>Yu</surname> <given-names>F. P.</given-names></name>
<name><surname>Zhao</surname> <given-names>L.</given-names></name>
<name><surname>Sun</surname> <given-names>S. L.</given-names></name>
<etal/>
</person-group>. (<year>2013</year>). 
<article-title>Effects of urantideas a UT receptor antagonist on the signal molecules of NF-&#x3ba;B pathway in mice with acute liver failure</article-title>. <source>Chin. Hepatol.</source> <volume>18</volume>, <fpage>88</fpage>&#x2013;<lpage>91</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3969/j.issn.1008-1704.2013.02.006</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
<name><surname>Zhang</surname> <given-names>J. X.</given-names></name>
<name><surname>Luo</surname> <given-names>J.</given-names></name>
<name><surname>Guo</surname> <given-names>H. X.</given-names></name>
<name><surname>Deng</surname> <given-names>H.</given-names></name>
<name><surname>Chen</surname> <given-names>J. Y.</given-names></name>
<etal/>
</person-group>. (<year>2008</year>). 
<article-title>A role of cell apoptosis in lipopolysaccharide (LPS)-induced nonlethal liver injury in D-galactosamine (D-GalN)-sensitized rats</article-title>. <source>Dig Dis. Sci.</source> <volume>53</volume>, <fpage>1316</fpage>&#x2013;<lpage>1324</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10620-007-9994-y</pub-id>, PMID: <pub-id pub-id-type="pmid">17934810</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Maiwall</surname> <given-names>R.</given-names></name>
<name><surname>Kulkarni</surname> <given-names>A. V.</given-names></name>
<name><surname>Arab</surname> <given-names>J. P.</given-names></name>
<name><surname>Piano</surname> <given-names>S.</given-names></name>
</person-group> (<year>2024</year>). 
<article-title>Acute liver failure</article-title>. <source>Lancet (London England)</source> <volume>404</volume>, <fpage>789</fpage>&#x2013;<lpage>802</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(24)00693-7</pub-id>, PMID: <pub-id pub-id-type="pmid">39098320</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Mangum</surname> <given-names>L. C.</given-names></name>
<name><surname>Hou</surname> <given-names>X.</given-names></name>
<name><surname>Borazjani</surname> <given-names>A.</given-names></name>
<name><surname>Lee</surname> <given-names>J. H.</given-names></name>
<name><surname>Ross</surname> <given-names>M. K.</given-names></name>
<name><surname>Crow</surname> <given-names>J. A.</given-names></name>
</person-group> (<year>2018</year>). 
<article-title>Silencing carboxylesterase 1 in human THP-1 macrophages perturbs genes regulated by PPAR&#x3b3;/RXR and RAR/RXR: down-regulation of CYP27A1-LXR&#x3b1; signaling</article-title>. <source>Biochem. J.</source> <volume>475</volume>, <fpage>621</fpage>&#x2013;<lpage>642</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1042/BCJ20180008</pub-id>, PMID: <pub-id pub-id-type="pmid">29321244</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Parlar</surname> <given-names>Y. E.</given-names></name>
<name><surname>Ayar</surname> <given-names>S. N.</given-names></name>
<name><surname>Cagdas</surname> <given-names>D.</given-names></name>
<name><surname>Balaban</surname> <given-names>Y. H.</given-names></name>
</person-group> (<year>2023</year>). 
<article-title>Liver immunity, autoimmunity, and inborn errors of immunity</article-title>. <source>World J. Hepatol.</source> <volume>15</volume>, <fpage>52</fpage>&#x2013;<lpage>67</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4254/wjh.v15.i1.52</pub-id>, PMID: <pub-id pub-id-type="pmid">36744162</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Quiroga</surname> <given-names>A. D.</given-names></name>
<name><surname>Li</surname> <given-names>L.</given-names></name>
<name><surname>Tr&#xf6;tzm&#xfc;ller</surname> <given-names>M.</given-names></name>
<name><surname>Nelson</surname> <given-names>R.</given-names></name>
<name><surname>Proctor</surname> <given-names>S. D.</given-names></name>
<name><surname>K&#xf6;feler</surname> <given-names>H.</given-names></name>
<etal/>
</person-group>. (<year>2012</year>). 
<article-title>Deficiency of carboxylesterase 1/esterase-x results in obesity, hepatic steatosis, and hyperlipidemia</article-title>. <source>Hepatol. (Baltimore Md.)</source> <volume>56</volume>, <fpage>2188</fpage>&#x2013;<lpage>2198</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/hep.25961</pub-id>, PMID: <pub-id pub-id-type="pmid">22806626</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sanghani</surname> <given-names>S. P.</given-names></name>
<name><surname>Sanghani</surname> <given-names>P. C.</given-names></name>
<name><surname>Schiel</surname> <given-names>M. A.</given-names></name>
<name><surname>Bosron</surname> <given-names>W. F.</given-names></name>
</person-group> (<year>2009</year>). 
<article-title>Human carboxylesterases: an update on CES1, CES2 and CES3</article-title>. <source>Protein Pept. Lett.</source> <volume>16</volume>, <fpage>1207</fpage>&#x2013;<lpage>1214</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/092986609789071324</pub-id>, PMID: <pub-id pub-id-type="pmid">19508181</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Satoh</surname> <given-names>T.</given-names></name>
<name><surname>Hosokawa</surname> <given-names>M.</given-names></name>
</person-group> (<year>1998</year>). 
<article-title>The mammalian carboxylesterases: from molecules to functions</article-title>. <source>Annu. Rev. Pharmacol. Toxicol.</source> <volume>38</volume>, <fpage>257</fpage>&#x2013;<lpage>288</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.pharmtox.38.1.257</pub-id>, PMID: <pub-id pub-id-type="pmid">9597156</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Satoh</surname> <given-names>T.</given-names></name>
<name><surname>Taylor</surname> <given-names>P.</given-names></name>
<name><surname>Bosron</surname> <given-names>W. F.</given-names></name>
<name><surname>Sanghani</surname> <given-names>S. P.</given-names></name>
<name><surname>Hosokawa</surname> <given-names>M.</given-names></name>
<name><surname>La Du</surname> <given-names>B. N.</given-names></name>
</person-group> (<year>2002</year>). 
<article-title>Current progress on esterases: from molecular structure to function</article-title>. <source>Drug Metab. disposition: Biol. fate chemicals</source> <volume>30</volume>, <fpage>488</fpage>&#x2013;<lpage>493</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1124/dmd.30.5.488</pub-id>, PMID: <pub-id pub-id-type="pmid">11950776</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Segain</surname> <given-names>J. P.</given-names></name>
<name><surname>Rolli-Derkinderen</surname> <given-names>M.</given-names></name>
<name><surname>Gervois</surname> <given-names>N.</given-names></name>
<name><surname>Raingeard de la Bl&#xe9;ti&#xe8;re</surname> <given-names>D.</given-names></name>
<name><surname>Loirand</surname> <given-names>G.</given-names></name>
<name><surname>Pacaud</surname> <given-names>P.</given-names></name>
</person-group> (<year>2007</year>). 
<article-title>Urotensin II is a new chemotactic factor for UT receptor-expressing monocytes</article-title>. <source>J. Immunol. (Baltimore Md.: 1950)</source> <volume>179</volume>, <fpage>901</fpage>&#x2013;<lpage>909</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.179.2.901</pub-id>, PMID: <pub-id pub-id-type="pmid">17617581</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sun</surname> <given-names>S. L.</given-names></name>
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
</person-group> (<year>2019</year>). 
<article-title>Urotensin II: an inflammatory cytokine</article-title>. <source>J. Endocrinol.</source> <volume>240</volume> (<issue>3</issue>), <fpage>R107</fpage>&#x2013;<lpage>R117</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1530/JOE-18-0505</pub-id>, PMID: <pub-id pub-id-type="pmid">30601760</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tomiyama</surname> <given-names>S.</given-names></name>
<name><surname>Nakamachi</surname> <given-names>T.</given-names></name>
<name><surname>Uchiyama</surname> <given-names>M.</given-names></name>
<name><surname>Matsuda</surname> <given-names>K.</given-names></name>
<name><surname>Konno</surname> <given-names>N.</given-names></name>
</person-group> (<year>2015</year>). 
<article-title>Urotensin II upregulates migration and cytokine gene expression in leukocytes of the African clawed frog, Xenopus laevis</article-title>. <source>Gen. Comp. Endocrinol.</source> <volume>216</volume>, <fpage>54</fpage>&#x2013;<lpage>63</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ygcen.2015.04.009</pub-id>, PMID: <pub-id pub-id-type="pmid">25907658</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Triantafyllou</surname> <given-names>E.</given-names></name>
<name><surname>Pop</surname> <given-names>O. T.</given-names></name>
<name><surname>Possamai</surname> <given-names>L. A.</given-names></name>
<name><surname>Wilhelm</surname> <given-names>A.</given-names></name>
<name><surname>Liaskou</surname> <given-names>E.</given-names></name>
<name><surname>Singanayagam</surname> <given-names>A.</given-names></name>
<etal/>
</person-group>. (<year>2018</year>a). 
<article-title>MerTK expressing hepatic macrophages promote the resolution of inflammation in acute liver failure</article-title>. <source>Gut.</source> <volume>67</volume>, <fpage>333</fpage>&#x2013;<lpage>347</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/gutjnl-2016-313615</pub-id>, PMID: <pub-id pub-id-type="pmid">28450389</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Triantafyllou</surname> <given-names>E.</given-names></name>
<name><surname>Woollard</surname> <given-names>K. J.</given-names></name>
<name><surname>McPhail</surname> <given-names>M. J. W.</given-names></name>
<name><surname>Antoniades</surname> <given-names>C. G.</given-names></name>
<name><surname>Possamai</surname> <given-names>L. A.</given-names></name>
</person-group> (<year>2018</year>b). 
<article-title>The role of monocytes and macrophages in acute and acute-on-chronic liver failure</article-title>. <source>Front. Immunol.</source> <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2018.02948</pub-id>, PMID: <pub-id pub-id-type="pmid">30619308</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wen</surname> <given-names>X.</given-names></name>
<name><surname>Baker</surname> <given-names>A. A.</given-names></name>
<name><surname>Klaassen</surname> <given-names>C. D.</given-names></name>
<name><surname>Corton</surname> <given-names>J. C.</given-names></name>
<name><surname>Richardson</surname> <given-names>J. R.</given-names></name>
<name><surname>Aleksunes</surname> <given-names>L. M.</given-names></name>
</person-group> (<year>2019</year>). 
<article-title>Hepatic carboxylesterases are differentially regulated in PPAR&#x3b1;-null mice treated with perfluorooctanoic acid</article-title>. <source>Toxicology.</source> <volume>416</volume>, <fpage>15</fpage>&#x2013;<lpage>22</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tox.2019.01.014</pub-id>, PMID: <pub-id pub-id-type="pmid">30685356</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wu</surname> <given-names>Z.</given-names></name>
<name><surname>Han</surname> <given-names>M.</given-names></name>
<name><surname>Chen</surname> <given-names>T.</given-names></name>
<name><surname>Yan</surname> <given-names>W.</given-names></name>
<name><surname>Ning</surname> <given-names>Q.</given-names></name>
</person-group> (<year>2010</year>). 
<article-title>Acute liver failure: mechanisms of immune-mediated liver injury</article-title>. <source>Liver Int.</source> <volume>30</volume> (<issue>6</issue>), <fpage>782</fpage>&#x2013;<lpage>794</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1478-3231.2010.02262.x</pub-id>, PMID: <pub-id pub-id-type="pmid">20492514</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yang</surname> <given-names>D.</given-names></name>
<name><surname>Pearce</surname> <given-names>R. E.</given-names></name>
<name><surname>Wang</surname> <given-names>X.</given-names></name>
<name><surname>Gaedigk</surname> <given-names>R.</given-names></name>
<name><surname>Wan</surname> <given-names>Y. J.</given-names></name>
<name><surname>Yan</surname> <given-names>B.</given-names></name>
</person-group> (<year>2009</year>). 
<article-title>Human carboxylesterases HCE1 and HCE2: ontogenic expression, inter-individual variability and differential hydrolysis of oseltamivir, aspirin, deltamethrin and permethrin</article-title>. <source>Biochem. Pharmacol.</source> <volume>77</volume>, <fpage>238</fpage>&#x2013;<lpage>247</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bcp.2008.10.005</pub-id>, PMID: <pub-id pub-id-type="pmid">18983829</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yang</surname> <given-names>J.</given-names></name>
<name><surname>Shi</surname> <given-names>D.</given-names></name>
<name><surname>Yang</surname> <given-names>D.</given-names></name>
<name><surname>Song</surname> <given-names>X.</given-names></name>
<name><surname>Yan</surname> <given-names>B.</given-names></name>
</person-group> (<year>2007</year>). 
<article-title>Interleukin-6 alters the cellular responsiveness to clopidogrel, irinotecan, and oseltamivir by suppressing the expression of carboxylesterases HCE1 and HCE2</article-title>. <source>Mol. Pharmacol.</source> <volume>72</volume>, <fpage>686</fpage>&#x2013;<lpage>694</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1124/mol.107.036889</pub-id>, PMID: <pub-id pub-id-type="pmid">17537833</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yu</surname> <given-names>Q. Q.</given-names></name>
<name><surname>Cheng</surname> <given-names>D. X.</given-names></name>
<name><surname>Xu</surname> <given-names>L. R.</given-names></name>
<name><surname>Li</surname> <given-names>Y. K.</given-names></name>
<name><surname>Zheng</surname> <given-names>X. Y.</given-names></name>
<name><surname>Liu</surname> <given-names>Y.</given-names></name>
<etal/>
</person-group>. (<year>2020</year>). 
<article-title>Urotensin II and urantide exert opposite effects on the cellular components of atherosclerotic plaque in hypercholesterolemic rabbits</article-title>. <source>Acta Pharmacol. Sin.</source> <volume>41</volume>, <fpage>546</fpage>&#x2013;<lpage>553</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41401-019-0315-8</pub-id>, PMID: <pub-id pub-id-type="pmid">31685976</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname> <given-names>Y.</given-names></name>
<name><surname>He</surname> <given-names>X.</given-names></name>
<name><surname>Gu</surname> <given-names>L.</given-names></name>
<name><surname>Li</surname> <given-names>S.</given-names></name>
<name><surname>Tang</surname> <given-names>J.</given-names></name>
<name><surname>Ma</surname> <given-names>R.</given-names></name>
<etal/>
</person-group>. (<year>2024</year>). 
<article-title>Mefunidone ameliorates acute liver failure in mice by inhibiting MKK4-JNK pathway</article-title>. <source>Biochem. Pharmacol.</source> <volume>225</volume>, <elocation-id>116267</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bcp.2024.116267</pub-id>, PMID: <pub-id pub-id-type="pmid">38723721</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhao</surname> <given-names>S.</given-names></name>
<name><surname>Yang</surname> <given-names>X.</given-names></name>
<name><surname>He</surname> <given-names>Y.</given-names></name>
<name><surname>Yu</surname> <given-names>Q.</given-names></name>
<name><surname>Liu</surname> <given-names>L. M.</given-names></name>
</person-group> (<year>2024</year>). 
<article-title>Kupffer-cell-targeted carboxylesterase 1f knockdown deteriorates lipopolysaccharide/D-galactosamine-induced acute liver failure through regulating cellular polarization in mice</article-title>. <source>Can. J. Gastroenterol. Hepatol.</source> <volume>2024</volume>, <elocation-id>6410484</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/cjgh/6410484</pub-id>, PMID: <pub-id pub-id-type="pmid">39734640</pub-id>
</mixed-citation>
</ref>
</ref-list>
<fn-group>
<fn id="n1" fn-type="custom" custom-type="edited-by">
<p>Edited by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1776926">Jake J Wen</ext-link>, University of Texas Medical Branch at Galveston, United States</p></fn>
<fn id="n2" fn-type="custom" custom-type="reviewed-by">
<p>Reviewed by: <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/624013">Hanwei Jiao</ext-link>, Southwest University, China</p>
<p><ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2581921">Shruti Ahlawat</ext-link>, Shree Guru Gobind Singh Tricentenary University, India</p></fn>
</fn-group>
</back>
</article>