This study was approved by the Clinical Research Ethics Committee of the Southern Medical University and was conducted following the principles of the Declaration of Helsinki. A family with three patients was enrolled in this study. We obtained written informed consent from the individuals or their guardians prior to sample collection and publication of photographs.

Skin tissues obtained from the left forearm and right upper arm of I-1 were formalin-fixed and paraffin-embedded (FFPE). Genomic DNA was extracted from sectioned FFPE (10 μm thickness) using the QIAamp DNA FFPE Tissue kit (56404, QIAGEN, Germany) according to the manufacturer’s instructions. For pathogen detection, extracted DNA served as the template in real-time PCR conducted with specific primers and probes targeting a group of Mycobacterium (including Mycobacterium tuberculosis and nontuberculous mycobacteria) and 14 common Mycobacterium species. Details were described previously (Song et al., 2022; Xiao et al., 2024).

Whole-exome sequencing (WES) was carried out using genomic DNA extracted from peripheral blood samples of II-2 at MyGenostics (Beijing, China) as described previously (Wang et al., 2020). Sanger sequencing was performed on three patients and their unaffected family members to verify the WES results and co-segregation using primers for exon 23 of STAT1 (forwards: GGCTAAGCTGTCTAGAAACAG and reverse: CTCAACAAGTTCAGCTGTGA).

Skin tissue obtained from the left thigh of I-1 and the chest of II-2 were fixed with 4% paraformaldehyde, embedded in paraffin, and sectioned (3μm thickness). The slides were subjected to hematoxylin-eosin (HE) staining for general morphology, acid-fast staining for Mycobacterium detection, and immunofluorescence using anti-p-STAT1 antibody (Cell Signaling Technology, Cat# 9167, RRID: AB_561284).

Predicted 3D models of the wild-type and the STAT1-Ile707Thr variant were acquired by AlphaFold3 online service and visualized using PyMOL software. The crystal structures (PDB code 1BF5 for the phosphorylated dimer, and PDB code 6TLC for the unphosphorylated dimer) were employed as templates. The analysis was conducted using Python 3.7 with Biopython, the associated code is publicly available in the GitHub repository at https://github.com/MDhewei/Bioinforbricklayer (He, 2023).

Full-length STAT1 (GenBank: NM_007315.4) open reading frame was amplified and cloned into pCMV-MCS-3XFlag-SV40 vector containing a C-terminal FLAG tag. Mut Express II Fast Mutagenesis Kit (C214, Vazyme, China) was used to create the plasmids expressing the STAT1-Ile707Thr variant, with appropriate primers (forwards: CTGAGTTGACTTCTGTGTCTGAAGTTCACCCTT and reverse: CACAGAAGTCAACTCAGTCTTGATATATCCAGTTCC).

HEK293T cells were cultured in DMEM (11965126, Gibco) supplemented with 10% FBS (A5670701, Gibco) at 5% CO₂ and 37°C. Expression plasmids were transiently transfected into HEK293T cells using Lipofectamine 3000 (L300001, ThermoFisher). IFN-γ (10⁵ IU/mL, C014, Novoprotein, Suzhou, China) was added to stimulate the cells for either 30 or 60 minutes, with phosphate buffer saline (PBS) serving as control.

Cells were lysed using IP lysis buffer (87788, ThermoFisher) containing protease inhibitor cocktail (04693132001, Merck) and protein phosphatase inhibitors (FD1002, Fudebio-tech, Hangzhou, China). The protein samples were separated by NuPAGE™ 4-12% Bis-Tris Protein Gels (NP0322BOX, ThermoFisher) and transferred onto NC membranes. The blots were blocked with 5% milk at room temperature for 1 h, followed by overnight incubation at 4°C with primary antibodies, including GAPDH (ZSGB-Bio Cat# TA-08, RRID: AB_2747414), FLAG (Sigma-Aldrich Cat# F1804, RRID: AB_262044), and STAT1 (Abcam Cat# ab109457, RRID: AB_10865748). After the incubation with secondary antibodies, immunoreactivity was detected using Immobilon Western Chemiluminescent HRP Substrate (WBKLS0500, Millipore).

After 24 hrs of culture, transfected HEK293T cells in chamber slides were stimulated with IFN-γ (10⁴ IU/mL) or PBS for 30 minutes. Cells were then fixed with paraformaldehyde, permeabilized with 0.1% Triton, and blocked with goat serum for 30 minutes. After the overnight incubation with anti-FLAG (Sigma-Aldrich Cat# F1804, RRID: AB_262044) at 4°C, cells were incubated with the corresponding fluorescein-conjugated secondary antibody at room temperature for 1h. Images were captured using a laser confocal microscope (Nikon, A1R-HD25) after being mounted with DAPI (ZLI-9557, ZSGB-BIO).

HEK293T cells cultured in 24-well plates were transfected with pGAS (HanYi Biosciences Inc.), Renilla (HanYi Biosciences Inc.) and plasmids expressing wild-type STAT1 or STAT1-Ile707Thr variant, with a ratio of 200:2:300. The relative luciferase units (RLUs) were measured on above cells stimulated with IFN-γ (10⁴ IU/mL) or PBS for 24 hrs, according to the manufacturer’s instructions. The RLUs were normalized with the Renilla signal and analyzed using ANOVA with GraphPad Prism 8.

Three patients from a family with MSMD were recruited, with clinical features summarized in Table 1 . II-2, a 4-year-old boy, presented with hypertrophy of the right first metatarsal bone at 2 years old, and the bone enlargement progressively increased. He also presented with progressive papules on the trunk. Over the past two years, he has experienced recurrent fever for more than two years, with a maximum body temperature of 39 °C, accompanied by cough and white sputum, which was diagnosed with pneumonia in the local hospital. Physical examination revealed a yellow-reddish lobulated plaque on his left chest, approximately 10*8 cm, surrounded by yellow-reddish papules ( Figure 1A ). The plaque’s surface tended to bleed when touched. The right elbow and knee joints of II-2 were also enlarged without redness or swelling, leading to limited mobility. Multiple enlarged cervical lymph nodes and axillary lymph nodes were observed. X-ray imaging revealed bone destruction with low bone density in limbs. Histopathological analysis of the skin lesion suggested necrotizing granulomatous inflammation ( Figure 1G ). Acid-fast staining was positive. II-3, the younger brother of II-2, presented with similar symptoms, including progressive limb bone enlargement, enlarged lymph nodes, and papules on the trunk. He also experienced recurrent fever and pneumonia, which responded to anti-infective therapy. Notably, he had enlargements of phalanges in the 2^nd, 4^th, and 5^th digits of the right hand ( Figure 1C ), the right first toe ( Figure 1F ), and the left metatarsals. X-ray imaging of his hands and feet revealed bone destruction with low bone density. I-1, father of II-3 and II-2, initially developed erythematous plaques on the right ankle at the age of 26. The plaques progressed to involve the faciocervical regions, limbs, and the medial aspect of the right knee ( Figure 1D ). He denied the history of frequent respiratory or other infections. Though conventional microbiological culture or metagenomics sequencing failed to identify pathogens in II-2 and I-1, Mycobacterium marinum was detected in the FFPE tissue of I-1 by real⁃time PCR. Thereafter, clarithromycin (0.125g) twice daily and rifampicin (0.15g) once daily were administered to three patients. After six months of regular treatment, substantial alleviation of the skin lesions was observed in both patients ( Figure 1B, E ). The enlarged bones of II-2 and III-3 were also recovered.

To identify the underlying genetic defect, WES was performed on II-2. A heterozygous variant c.2120T>C (p. Ile707Thr) in STAT1 (Genbank: NM_007315.4) was detected ( Figure 1J ). Sanger sequencing verified the variant in the proband and confirmed the co-segregation of the variant with the phenotype in the family. The Ile707 is highly conserved across different species ( Figure 1I ), and the variant is absent in all known public databases. The pedigree chart is shown in Figure 1H .

Structural analysis of the AlphaFold3-predicted structure of STAT1 revealed distinct spatial position of the residue Ile707 in phosphorylated and unphosphorylated STAT1 homodimers. In the phosphorylated state, the residue Ile707 is located at the interface of the homodimer, while at the periphery in the unphosphorylated state, suggesting the residue Ile707 might involve in the formation of phosphorylated homodimer ( Figure 2A ). Structural alteration of the phosphorylated homodimer induced by the STAT1-Ile707Thr variant was revealed by the AlphaFold3-predicted structure. Although the number of hydrogen bonds increased when Ile707 was replaced by residue Threonine, those excessive hydrogen bonds may disrupt the native hydrophobic environment inside of protein, ultimately destabilize the dimer ( Figure 2B ). As shown in Figure 2C , cluster analysis of inter-monomeric contacts in wild-type phosphorylated dimers (designated as Chain A and Chain B) illustrated critical contribution of residues 631 to 710 located at the SH2 domain and TAD domains, consistent with previous findings (Boisson-Dupuis et al., 2012). However, the Ile707Thr variant exhibited substantial reduction of interaction residues in Chain A’s SH2 domain ( Figure 2C ), mirroring the interfacial defect observed in the established loss-of-function variant, STAT1-Leu706Ser (Dupuis et al., 2003). These computational evidences collectively suggest that the Ile707Thr variant might impair the function of STAT1 via interfering with the structure and stability of the phosphorylated dimer.

To investigate the phosphorylation level of the STAT1-Ile707Thr variant, Western blot analysis was performed on HEK293T cells transfected with wild-type or the STAT1-Ile707Thr variant. The expression level of total STAT1 was comparable in cells expressing the wild-type and the STAT1-Ile707Thr before and immediately after the stimulation of IFN-γ ( Figure 3A ). Intriguingly, after 30 and 60 minutes of IFN-γ stimulation, there was a significant reduction of the phosphorylated STAT1 in cells expressing the STAT1-Ile707Thr variant, compared to those expressing the wild-type STAT1 ( Figure 3A ), suggesting the impaired phosphorylation of the STAT1-Ile707Thr variant.

IF was performed on transfected HEK293T cells using the antibody against the FLAG tag to assess the subsequent nuclear translocation. Before the IFN-γ stimulation, both wild-type STAT1 and the STAT1-Ile707Thr variant were distributed in the cytoplasm and nucleus ( Figure 3B ). After 30 minutes of IFN-γ stimulation, the wild-type STAT1 concentrated in the nucleus, while the distribution of STAT1-Ile707Thr variant showed no discernible difference ( Figure 3B ), demonstrating the blocked nuclear translocation of the STAT1-Ile707Thr variant. Consistently, IF of p-STAT1 in the FFPE tissue showed significantly decreased p-STAT1 expression and reduced nuclear localization of STAT1 in I-1 ( Supplementary Figure S2 ).

To explore whether the variant suppressed the transcriptional activity of GAS, a luciferase reporter assay was carried out on transfected cells. Upon the stimulation of IFN-γ, the wild-type STAT1 displayed a significant increase in transcriptional activity, while only a slight increase in transcriptional activity was induced by the STAT1-Ile707Thr variant ( Figure 3C ). These findings suggested that the STAT1-Il707Thr variant exhibits a loss-of-function effect, resulting in the inhibition of IFN-γ signaling.