<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2025.1537564</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Epicatechin gallate and its analogues interact with sortase A and &#x3b2;-lactamase to suppress <italic>Staphylococcus aureus</italic> virulence</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Teng</surname>
<given-names>Fei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2561001/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Wang</surname>
<given-names>Lihui</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2043101/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wen</surname>
<given-names>Jingyao</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3006596/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Tian</surname>
<given-names>Zizeng</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3006595/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Guizhen</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2910238/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes" corresp="yes">
<name>
<surname>Peng</surname>
<given-names>Liping</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/915309/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Respiratory Medicine, The First Hospital of Jilin University</institution>, <addr-line>Changchun</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>College of Biological and Food Engineering, Jilin Engineering Normal University</institution>, <addr-line>Changchun</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Sara Mar&#xed;a Soto, Instituto Salud Global Barcelona (ISGlobal), Spain</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Mei-Hui Lin, Chang Gung University, Taiwan</p>
<p>Curutiu Carmen, University of Bucharest, Romania</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Guizhen Wang, <email xlink:href="mailto:wanggz@jlenu.edu.cn">wanggz@jlenu.edu.cn</email>; Liping Peng, <email xlink:href="mailto:penglp@jlu.edu.cn">penglp@jlu.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>25</day>
<month>03</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>15</volume>
<elocation-id>1537564</elocation-id>
<history>
<date date-type="received">
<day>01</day>
<month>12</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>28</day>
<month>02</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Teng, Wang, Wen, Tian, Wang and Peng</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Teng, Wang, Wen, Tian, Wang and Peng</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Staphylococcus aureus</italic> sortase A can anchor virulence proteins, which are responsible for bacterial adhesion, biofilm formation, and inflammation, to the cell membrane surface. The ability of &#x3b2;-lactam antibiotics to combat <italic>S. aureus</italic> infections is limited by the presence of &#x3b2;-lactamases in this pathogen. In this study, we determined that epicatechin gallate (ECG) and its analogues inhibited the transpeptidase activity of sortase A by interacting with it directly, and the biofilm formation and adhesion abilities of the bacterium decreased after treatment with ECG and its analogues. Additionally, ECG bound to &#x3b2;-lactamase and reduced its ability to hydrolyze nitrocefin. Furthermore, ECG synergized with ampicillin (Amp), enhancing its bactericidal effects and inhibiting the formation of persisters. ECG did not affect the expression of sortase A or &#x3b2;-lactamase but significantly alleviated the cytotoxicity of <italic>S. aureus</italic> USA300. ECG alone or combined with Amp <italic>in vivo</italic> improved the survival of mice infected with <italic>S.&#xa0;aureus</italic> USA300, alleviated pathological tissue damage and pulmonary edema, and reduced the extent of inflammation and level of colonization. The results of this study indicate that the active ingredients of green tea, especially ECG, have the potential to be developed as anti-<italic>S. aureus</italic> infection agents.</p>
</abstract>
<kwd-group>
<kwd>ECG</kwd>
<kwd>sortase A</kwd>
<kwd>&#x3b2;-lactamase</kwd>
<kwd>biofilm</kwd>
<kwd>persisters</kwd>
<kwd>
<italic>Staphylococcus aureus</italic>
</kwd>
</kwd-group>
<counts>
<fig-count count="10"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="49"/>
<page-count count="15"/>
<word-count count="6694"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Biofilms</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>For successful infection, <italic>Staphylococcus aureus</italic> (<italic>S. aureus</italic>) must adhere to and colonize the host (<xref ref-type="bibr" rid="B35">Ronner et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B9">Foster, 2019</xref>), and this process is aided by adhesins covalently anchored to the cell wall by sortase A (<xref ref-type="bibr" rid="B10">Foster et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B9">Foster, 2019</xref>; <xref ref-type="bibr" rid="B1">Alharthi et&#xa0;al., 2021</xref>). Sortase A inhibitors significantly reduce bacterial adherence to cells (<xref ref-type="bibr" rid="B29">Liu et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B2">Bozhkova et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B37">Shulga and Kudryavtsev, 2022</xref>). In addition, sortase A can anchor many other surface proteins to the cell wall, which could improve bacterial pathogenicity (<xref ref-type="bibr" rid="B23">Jonsson et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B45">Weiss et&#xa0;al., 2004</xref>) through mechanisms such as affecting biofilm formation (<xref ref-type="bibr" rid="B25">Kim et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B46">Xu et&#xa0;al., 2024</xref>) and promoting <italic>S. aureus</italic> evasion of the host immune system (<xref ref-type="bibr" rid="B45">Weiss et&#xa0;al., 2004</xref>). Some inhibitors targeting sortase A have been reported to reduce bacterial adherence to host cells and biofilm formation, thereby increasing the survival rate of model animals with <italic>S. aureus</italic> infection (<xref ref-type="bibr" rid="B39">Song et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B40">Su et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B22">Jiang et&#xa0;al., 2023</xref>). The number of virulence proteins anchored to the bacterial cell wall decreases significantly upon sortase A inactivation, which results in a reduction in <italic>S. aureus</italic> pathogenicity. Therefore, sortase A is an ideal target for developing inhibitors of <italic>S. aureus</italic> infection (<xref ref-type="bibr" rid="B4">Cascioferro et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B3">Cascioferro et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B1">Alharthi et&#xa0;al., 2021</xref>).</p>
<p>
<italic>S. aureus</italic> &#x3b2;-lactamase can hydrolyze almost all &#x3b2;-lactam antibiotics, including the recently developed cephalosporins and all carbapenem antibiotics, known as the &#x201c;last antibiotics&#x201d;, which imposes a considerable challenge for the clinical treatment of <italic>S. aureus</italic> infection (<xref ref-type="bibr" rid="B33">Mossman et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B13">George et&#xa0;al., 2023</xref>); however, the development of new antibiotics is slow. Therefore, restoring bacterial sensitivity to current antibiotics is an effective strategy to alleviate resistance. Several compounds have been shown to restore bacterial susceptibility to antibiotics by targeting &#x3b2;-lactamases, indicating that restoring bacterial sensitivity to this class of antibiotics is feasible by inhibiting &#x3b2;-lactamase activity.</p>
<p>Catechins are active phenolic substances that are mainly found in green tea, including the main active components epicatechin gallate (ECG), catechin (C), epicatechin (EC), epigallocatechin (EGC), and epigallocatechin gallate (EGCG) (<xref ref-type="bibr" rid="B26">Kochman et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B34">Musial et&#xa0;al., 2020</xref>). These compounds have considerable biological functions, such as antiviral, antitumoral, antioxidant, and antithrombotic effects (<xref ref-type="bibr" rid="B21">Ide et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B6">Chen et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B5">Chen et&#xa0;al., 2022</xref>). EGCG has been reported to affect <italic>Streptococcus pneumoniae</italic> virulence by inactivating sortase A (<xref ref-type="bibr" rid="B38">Song et&#xa0;al., 2017</xref>), but compounds that act against both &#x3b2;-lactamase and sortase A simultaneously to suppress <italic>S. aureus</italic> virulence have not been reported. In this study, we discovered that the abovementioned components of green tea inhibited <italic>S. aureus</italic> USA300 infection by interacting with &#x3b2;-lactamase and sortase A. On the one hand, these compounds inhibited biofilm formation and bacterial adhesion by inhibiting sortase A. On the other hand, ECG, as a representative, restored the susceptibility of <italic>S. aureus</italic> USA300 to &#x3b2;-lactam antibiotics and protected mice from <italic>S. aureus</italic> USA300 infection.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Reagents, strains, and growth conditions</title>
<p>The small molecules used in this study were obtained from Chengdu Purechem-Standard Co., Ltd. Penicillin G (PG), ampicillin (Amp), ceftriaxone sodium (Cef), kanamycin, and nitrocefin were purchased from Dalian Meilun Biotechnology Co., Ltd. Dulbecco&#x2019;s modified Eagle&#x2019;s medium (DMEM), fetal bovine serum (FBS), trypsin (0.25%), and penicillin&#x2212;streptomycin solution were purchased from Beijing Solarbio Science &amp; Technology Co., Ltd. The substrate peptide of sortase A (Dabcyl-QALPETGEE-Edans) was purchased from GL Biochem (Shanghai), Ltd. <italic>S. aureus</italic> USA300, which expresses &#x3b2;-lactamase, was stored in our laboratory and cultured in Luria&#x2212;Bertani (LB) media at 37&#xb0;C with shaking or under static conditions.</p>
</sec>
<sec id="s2_2">
<title>Protein preparation</title>
<p>The <italic>S. aureus</italic> sortase A gene was cloned and inserted into the pET-28a (+) vector, which was subsequently transformed into <italic>Escherichia coli</italic> BL21 (DE3) (Beyotime, Shanghai, China). The <italic>E. coli</italic> was cultured in LB medium supplemented with 0.2 mM isopropyl-beta-D-thiogalactopyranoside (Beyotime, Shanghai, China) at 18&#xb0;C for 18 h. Then, the bacteria were harvested and lysed to obtain the supernatant. The supernatant was incubated with Ni-NTA agarose resin, and the purified protein was obtained after elution with 250 mM imidazole. To construct the sortase A mutants, primers designed for specific mutations (V168A, K173A, and L169A) were obtained using the QuikChange Site-Directed Mutagenesis Kit. The pET28a plasmid carrying the sortase A gene was used as a template, and the polymerase chain reaction (PCR) products were introduced into <italic>E. coli</italic> BL21 (DE3) after treatment with <italic>DpnI</italic> (Beyotime, Shanghai, China). The mutated proteins were obtained via the same purification method described above. Cloning, expression, and purification of &#x3b2;-lactamase and its mutants (Y96A, I158A, and I230A) were performed via the same methods. The mutants of sortase A and &#x3b2;-lactamase were used to identify the residues critical for interaction with the compounds. The primers used for this assay are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primers used for clone and site-directed mutagenesis.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="center">Oligonucleotide (5'-3')</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Sortase A-F</td>
<td valign="top" align="left">CTG<underline>GGATCC</underline>CAAGCTAAACCTCAAATT</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A-R</td>
<td valign="top" align="left">CTG<underline>GTCGAC</underline>TTATTTGACTTCTGTAGC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase-F</td>
<td valign="top" align="left">CTG<underline>GGATCC</underline>GCCAAAGAGTTAAATGATTTA</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase-R</td>
<td valign="top" align="left">CTG<underline>GTCGAC</underline>TTAAAATTCCTTCATTAC</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A V168A-F</td>
<td valign="top" align="left">CTACAGATGTAGGA<underline>GCG</underline>CTAGATGAACAAAAAG&#xa0;</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A V168A-R</td>
<td valign="top" align="left">CTTTTTGTTCATCTAG<underline>CGC</underline>TCCTACATCTGTAG</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A K173A-F</td>
<td valign="top" align="left">CTAGATGAACAA<underline>GCG</underline>GGTAAAGATAAAC</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A K173A-R</td>
<td valign="top" align="left">GTTTATCTTTACC<underline>CGC</underline>TTGTTCATCTAG</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A L169A-F</td>
<td valign="top" align="left">GATGTAGGAGTT<underline>GCG</underline>GATGAACAAAAAG</td>
</tr>
<tr>
<td valign="top" align="left">Sortase A L169A-R</td>
<td valign="top" align="left">CTTTTTGTTCATC<underline>CGC</underline>AACTCCTACATC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase Y96A-F</td>
<td valign="top" align="left">GATATAGTTGCT<underline>GCG</underline>TCTCCTATTTTAG</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase Y96A-R</td>
<td valign="top" align="left">CTAAAATAGGAGA<underline>CGC</underline>AGCAACTATATC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase I158A-F</td>
<td valign="top" align="left">GTTAGATATGAG<underline>GCG</underline>GAATTAAATTAC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase I158A-R</td>
<td valign="top" align="left">GTAATTTAATTC<underline>CGC</underline>CTCATATCTAAC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase I230A-F</td>
<td valign="top" align="left">GTGGTCAAGCA<underline>GCG</underline>ACATATGCTTC</td>
</tr>
<tr>
<td valign="top" align="left">&#x3b2;-lactamase I230A-R</td>
<td valign="top" align="left">GAAGCATATGT<underline>CGC</underline>TGCTTGACCAC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The underlines represent the mutation sites or cleavage sites.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_3">
<title>Inhibition of sortase A activity</title>
<p>The sortase A protein (10 &#xb5;g) was coincubated with various concentrations of ECG and its analogues (0, 8, 16, and 32 &#xb5;g/mL) at 37&#xb0;C for 0.5 h. The substrate peptide (10 &#xb5;g, final volume of 100 &#xb5;L) was subsequently added, and the samples were incubated for 1 h in the dark. Then, the fluorescence intensity was detected by using a microplate reader (excitation 490 nm, emission 520 nm), and the inhibitory effects of ECG and its analogues against sortase A were evaluated via a previously described method (<xref ref-type="bibr" rid="B38">Song et&#xa0;al., 2017</xref>). The inhibitory effects of ECG against the mutants of sortase A (V168A, K173A and L169A) were determined via the same method.</p>
</sec>
<sec id="s2_4">
<title>Computational biology</title>
<p>AutoDock Vina software (<xref ref-type="bibr" rid="B41">Trott and Olson, 2010</xref>) was used to perform docking calculations after the compounds (set as the ligands) were docked into proteins (&#x3b2;-lactamase PDB ID: 6WGR; sortase A PDB ID: 6R1V) with AutoDock Tools on the basis of methods described previously (<xref ref-type="bibr" rid="B11">Gao et&#xa0;al., 2020</xref>). Molecular dynamics simulations of the candidates were carried out using GROMACS 2020.6 and previously reported methods (<xref ref-type="bibr" rid="B30">Liu TT. et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B11">Gao et&#xa0;al., 2020</xref>). Briefly, RESP charges were assigned to the ligands using Gaussian and amber, and topology files of the ligands were obtained by using AmberTools. The Amber 14sb force field and SPC/E water model were also used. The root mean square deviation (RMSD) was used to evaluate the equilibrium of the system, and key protein residues involved in the interactions with the ligands were identified via the molecular mechanics Poisson&#x2212;Boltzmann surface area (MMPBSA) method.</p>
</sec>
<sec id="s2_5">
<title>Biofilm inhibition</title>
<p>Different concentrations of ECG and its analogues (0, 8, and 32 &#xb5;g/mL) were used to treat <italic>S. aureus</italic> USA300, which were seeded into 96-well plates (5 &#xd7; 10<sup>6</sup> CFUs/well). The samples were cultured at 37&#xb0;C until static. At 24 h later, the medium was removed, and the samples were washed with sterile phosphate-buffered saline (PBS) and stained with 0.1% crystal violet. The optical density at 570 nm (OD<sub>570</sub>) of each well was measured after adding 33% glacial acetic acid to dissolve the solids to evaluate the biofilm formation inhibitory effects of the compounds (<xref ref-type="bibr" rid="B16">Grossman et&#xa0;al., 2021</xref>). The free LB medium was defined as negative control (NC).</p>
</sec>
<sec id="s2_6">
<title>Inhibition of &#x3b2;-lactamase activity</title>
<p>
<italic>S. aureus</italic> USA300 &#x3b2;-lactamase protein activity inhibition assays were performed according to methods reported previously (<xref ref-type="bibr" rid="B48">Zhou et&#xa0;al., 2020</xref>). Briefly, different concentrations of ECG and its derivatives (0, 32, 64, and 128 &#xb5;g/mL) were used to treat the purified &#x3b2;-lactamase protein (5 &#xb5;g) for 30 min at 37&#xb0;C, and nitrocefin (5 &#xb5;g) was added for the final 10 min of incubation. The OD<sub>492</sub> of each well was subsequently measured to determine whether these compounds affect the activity of &#x3b2;-lactamase (<xref ref-type="bibr" rid="B48">Zhou et&#xa0;al., 2020</xref>). The inhibitory effects of ECG against the &#x3b2;-lactamase mutants (Y96A, I158A, and I230A) were determined via the same method.</p>
</sec>
<sec id="s2_7">
<title>Analysis of the antimicrobial properties</title>
<p>The minimum inhibitory concentrations (MICs) of PG, Amp, Cef, and kanamycin combined with or without the test compounds were determined on the basis of Clinical and Laboratory Standards Institute (CLSI) methods. Briefly, LB culture medium containing a series of concentrations of PG, Cef, Amp, or kanamycin (0&#x2013;256 &#xb5;g/mL) and ECG derivatives (0&#x2013;32 &#xb5;g/mL) was added to a 96-well plate, followed by the addition of <italic>S. aureus</italic> USA300 strains (5 &#xd7; 10<sup>5</sup> CFUs/mL). Samples were cultured at 37&#xb0;C for 24 h, and the MIC values were defined as the concentration of compound at which there was no visible bacteria growth. The antimicrobial properties of the ECG and its analogues and their synergistic effects with PG, Cef, Amp, and kanamycin were analyzed on the basis of the MIC values (<xref ref-type="bibr" rid="B18">Guo et&#xa0;al., 2024</xref>).</p>
</sec>
<sec id="s2_8">
<title>Time-dependent bacterial killing effects and analysis of persisters</title>
<p>On the basis of the synergistic effect between the ECG and its analogues and the tested antibiotics, Amp combined with ECG (32 &#xb5;g/mL) was used to carry out a time-dependent bacterial killing assay. <italic>S. aureus</italic> USA300 in the logarithmic growth phase (approximately 2 &#xd7; 10<sup>6</sup> CFUs/mL) was treated with ECG (32 &#xb5;g/mL), Amp (64 &#xb5;g/mL), or their combination and cultured with shaking. Samples from each group were collected every 2 h and plated on LB agar medium after dilution. The colonies were analyzed to evaluate the ability of ECG to improve the bactericidal ability of Amp (<xref ref-type="bibr" rid="B31">Liu S. et&#xa0;al., 2019</xref>). The persister assay was performed on the basis of a previously described method with some modifications (<xref ref-type="bibr" rid="B24">Keren et&#xa0;al., 2004</xref>). Briefly, <italic>S. aureus</italic> USA300 was treated with 10 &#xb5;g/mL gentamicin, then ECG (32 &#xb5;g/mL) was added, and the mixture was cultured with shaking. Finally, bacterial colonies were harvested at the indicated time points to analyze the formation of persisters (<xref ref-type="bibr" rid="B24">Keren et&#xa0;al., 2004</xref>).</p>
</sec>
<sec id="s2_9">
<title>Cell culture and assays</title>
<p>Mouse mononuclear macrophages (RAW264.7 cells) and human lung cancer epithelial cells (A549 cells) were cultured in DMEM supplemented with 10% FBS at 37&#xb0;C with 5% CO<sub>2</sub>. The RAW264.7 cells seeded in 96-well plates (2 &#xd7; 10<sup>4</sup> cells/well) were treated with <italic>S. aureus</italic> USA300 at a multiplicity of infection (MOI) of 60, after different concentrations of ECG (0, 16, or 32 &#xb5;g/mL) were added, and the samples were cocultured for 5 h. Then, the samples were centrifuged (1,000 rpm for 10 min), the supernatant was added to an equal volume of lactate dehydrogenase (LDH) reagent (Solarbio, Beijing, China), and the mixture was incubated in the dark for 30 min. The level of LDH in each sample was determined by measuring the OD<sub>490</sub>. After having been washed with sterile PBS, the cells were treated with ethidium bromide (EB, 50 &#xb5;g/mL) to observe the inhibitory effect of ECG on the toxicity of <italic>S. aureus</italic> USA300 by using fluorescence microscopy (OLYMPUS, IX83). The cytotoxicities of the tested compounds were determined by detecting the LDH levels. For the adhesion assay, A549 cells in 24-well plates (1 &#xd7; 10<sup>5</sup> cells/well) were treated with <italic>S. aureus</italic> USA300 (MOI = 30) containing ECG (0, 8, or 32 &#xb5;g/mL). At 1 h later, the medium was discarded, the cells were washed with sterile PBS, and the samples were plated onto LB agar medium after dilution. The number of colonies was used to assess the inhibitory effect of ECG on bacterial adhesion.</p>
</sec>
<sec id="s2_10">
<title>Protein expression and secretion analysis</title>
<p>
<italic>S. aureus</italic> USA300 was cocultured with different concentrations of ECG (0, 16, or 32 &#xb5;g/mL) for 8 h. The bacteria and supernatants were subsequently collected separately after centrifugation (12,000 rpm for 5 min). The expression levels of sortase A and &#x3b2;-lactamase in the bacteria were detected by western blotting. The secretion of&#xa0;&#x3b2;-lactamase into the supernatant was evaluated via Coomassie brilliant blue staining. The antibodies used in these experiments were stored in our laboratory (mouse sortase A, 1:1,000; mouse &#x3b2;-lactamase, 1:1,000; goat anti-mouse secondary antibodies, 1:10,000).</p>
</sec>
<sec id="s2_11">
<title>Animal infection model</title>
<p>Male C57BL/6J mice (weighing approximately 20 g) were purchased from Liaoning Changsheng Biotechnology Co., Ltd. All animal experiments were performed in accordance with the requirements of Jilin University. The mice had free access to food and water. The mice were intranasally inoculated with 30 &#x3bc;L of <italic>S. aureus</italic> USA300 suspension (5 &#xd7; 10<sup>8</sup> CFUs) to establish a pneumonia model. At 2 h later, ECG (50 mg/kg), Amp (50 mg/kg), or their combination was administered to the infected mice. Mice in the positive control (PC) group were infected with <italic>S. aureus</italic> USA300 and administered an equal volume of solvent instead of compound, and the mice in the negative control (NC) group were administered an equal volume of sterile PBS only. A total of 10 mice were assigned to each group for the survival assay, and the survival status of the mice was observed every 12 h. For other analyses, each group contained eight mice. After 48 hours of treatment, the mice were anaesthetized by injection of pentobarbital sodium (50 mg/kg) and then euthanized by cervical dislocation. The lung tissues of the mice were harvested, and pathological damage was observed after haematoxylin&#x2212;eosin staining. Additionally, the tissue bacterial load was analyzed after homogenization and culture on LB agar, the ratio of the weight of each lung before and after drying was analyzed, and the levels of inflammatory factors in the alveolar lavage fluid was detected via enzyme-linked immunosorbent assays (ELISAs; Sangon Biotech, Shanghai, China).</p>
</sec>
<sec id="s2_12">
<title>Statistical analysis</title>
<p>The data are presented as the means with the standard deviations (SDs) or standard errors of the means (SEMs) from three independent experiments. Statistical analysis was performed via the unpaired <italic>t test</italic> in GraphPad Prism 9.5.0. Statistical significance was defined as p &#x2264; 0.05.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>ECG and its analogues inhibit the activity of sortase A</title>
<p>The relative activity of sortase A was defined as 100% at a test compound concentration of 0 &#xb5;g/mL. Sortase A activity was reduced to 79.11%, 64.14% and 44.52% upon treatment with 8, 16 and 32 &#xb5;g/mL ECG, respectively (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Similarly, reductions in sortase A activity were observed after treatment with 8, 16 and 32 &#xb5;g/mL EGCG (13.68%, 36.35% and 61.22%, respectively) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>), EGC (28.23%, 29.87% and 48.07%, respectively) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref>), C (10%, 14.32% and 30.88%, respectively) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1D</bold>
</xref>) and EC (2.94%, 16.12% and 40.14%, respectively) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1E</bold>
</xref>). These results showed that ECG and its analogues could significantly inhibit the activity of sortase A and that the gallic acid moiety played a role in this activity.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>ECG and its analogues inhibit the activity of sortase A. Relative activities of sortase A after treatment with different concentrations of ECG <bold>(A)</bold>, EGCG <bold>(B)</bold>, EGC <bold>(C)</bold>, C <bold>(D)</bold>, and EC <bold>(E)</bold>. The sortase A protein was coincubated with different concentrations of ECG and its analogues at 37&#xb0;C for 30 min, and then the substrate peptide was added for an additional 1 h of incubation. The fluorescence intensity (excitation 490 nm, emission 520 nm) was measured by using a microplate reader. The relative activity of sortase A was calculated by using the following formula: (S<sub>1</sub>/S<sub>0</sub>) &#xd7; 100, where S<sub>1</sub> or S<sub>0</sub> represents the fluorescence value of samples treated with or without tested compounds. Data are shown as means with SEMs, <italic>n</italic> = 3; ns indicates not significant, * indicates <italic>p</italic> &#x2264; 0.05, and ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>ECG and its analogues show excellent affinity for <italic>S. aureus</italic> sortase A</title>
<p>Molecular docking was carried out, and these compounds were found to bind to the catalytic pocket of sortase A (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). The binding energies of ECG, EGCG, EGC, EC, C to sortase A were -7.2, -7.0, -6.7, -6.97 and -6.9 kcal/mol, respectively. Analysis of the sortase A binding site revealed that Thr180, Ser116, Glu108, Asn107 and Asn114 are involved in the binding of EC to sortase A (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>); that Gln178 and Asn107 of sortase A interact with C (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>); that EGCG interacts with residues Gln178, Leu169, Asp170 and Asn107 of sortase A (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>); and that residues Gln178, Asn114, Leu169, Thr180, Asp170 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>), Asn107 and Gln178 are involved in the interaction between EGC and sortase A (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>). These results indicate that the residues involved in the binding of each compound were not exactly the same even though all of the interacting residues were located in the same catalytic pocket.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Binding mode of ECG and its analogues to sortase A and analysis of the potential binding sites. <bold>(A)</bold> Binding mode of ECG and its analogues to sortase A. Potential interaction sites of sortase A with C <bold>(B)</bold>, EC <bold>(C)</bold>, EGCG <bold>(D)</bold>, ECG <bold>(E)</bold>, and EGC <bold>(F)</bold>. Hydrogen atoms and charges were added to sortase A (PDB ID: 6R1V) and ECG and its analogues using AutoDock Tools, and AutoDock Vina was used to perform docking. Potential binding sites were analyzed using Proteins Plus.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Residues Val168, Lys173, and Leu169 are critical for compound binding</title>
<p>The RMSD values of sortase A and ECG fluctuated around 0.38 nm and 0.1 nm, indicating that sortase A and the ECG complex reached an equilibrium state during the molecular dynamics simulations (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). Analysis of the binding free energies from the molecular dynamics simulations revealed that electrostatic interactions (ele), van der Waals forces (vdw) and solvation energy (sol) participated in compound binding (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Residue energy decomposition analysis revealed that Val168, Leu169, Ala104, Thr180, Asp165, Ile182, Asp170 and Lys173 have greater contributions to the binding energy (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>), which was confirmed by the closer proximity of these residues to ECG (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). Site-directed mutagenesis was performed to construct the V168A, K173A and L169A mutants, and the inhibitory effects of ECG on these mutants were significantly reduced compared with inhibition of the WT protein (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>), indicating that these residues are important for ECG and sortase A binding.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Identification of critical residues involved in ECG binding to sortase A. <bold>(A)</bold> RMSD values from the simulations. Contribution of each residue to the binding energy <bold>(B)</bold> and the residues with greater contributions <bold>(C)</bold>. <bold>(D)</bold> Distances between sortase A residues and ECG. <bold>(E)</bold> Inhibitory effects of ECG against sortase A and its mutants. GROMACS version 2020.6 was used to perform molecular dynamics simulations using the amber 14SB force field and SPC/E water model. The MMPBSA method was used to calculate the binding free energies. Data are shown as means with SDs, <italic>n</italic> = 3; * indicates <italic>p</italic> &#x2264; 0.05 and ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>ECG and its analogues inhibit <italic>S. aureus</italic> USA300 biofilm formation</title>
<p>sortase A is closely related to biofilm formation. Here, we quantitatively analyzed the effects of ECG and its analogues on <italic>S. aureus</italic> USA300 biofilm formation via crystal violet staining. <italic>S. aureus</italic> USA300 biofilm formation was defined as 100% in the absence of test compounds. When the bacteria were treated with 8 or 32 &#xb5;g/mL C, biofilm formation was 103.40% and 85.84%, respectively (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Similarly, biofilm formation was reduced to 43.48% and 34.83% when the bacteria were treated with 8 and 32 &#xb5;g/mL EGC, respectively (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>), and these values were 33.83% and 18.44%, respectively, upon treatment with ECG (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>); 13.26% and 10.92%, respectively, upon treatment with EGCG (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>); and 82.33% and 44.19%, respectively, upon treatment with EC (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). These results showed that ECG and its analogues inhibited <italic>S. aureus</italic> USA300 biofilm formation to different degrees.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>ECG and its analogues inhibit the biofilm formation of <italic>S. aureus</italic> USA300. Relative biofilm formation of <italic>S. aureus</italic> USA300 treated with different concentrations of C <bold>(A)</bold>, EGC <bold>(B)</bold>, ECG <bold>(C)</bold>, EGCG <bold>(D)</bold>, and EC <bold>(E)</bold>. <italic>S. aureus</italic> USA300 was cocultured with different concentrations of ECG and its analogues at 37&#xb0;C for 24 h, after which the samples were stained with 0.1% crystal violet, washed, and fixed, and the OD<sub>570</sub> was finally measured after treatment with 33% glacial acetic acid. NC indicates negative control. Data are shown as means with SEMs, <italic>n</italic> = 3; ns indicates not significant, * indicates <italic>p</italic> &#x2264; 0.05, and ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g004.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>ECG and its analogues reduce the adhesion of <italic>S. aureus</italic> USA300 to lung epithelial cells</title>
<p>Adhesion to host cells is the first step in <italic>S. aureus</italic> infection. The virulence factor anchored by sortase A to bacterial cell walls is closely related to bacterial adhesion. Therefore, in this study, the effects of ECG and its analogues on the adhesion of <italic>S. aureus</italic> USA300 to human lung epithelial cells were analyzed. The number of <italic>S. aureus</italic> USA300 colonies resulting from the treatment of A549 cells in the absence of test compounds was defined as 100%. When <italic>S. aureus</italic> USA300-treated A549 cells received 32 &#xb5;g/mL of the test compounds, the relative adhesion of the bacteria was 54.67% for C (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>), 14.89% for EGCG (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), 46.90% for EGC (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>), 17.83% for ECG (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>) and 49.91% for EC (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>). ECG and EGCG showed significantly better antiadhesion effects than the other compounds, which is consistent with the above results.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>ECG and its analogues reduce the adhesion of <italic>S. aureus</italic> USA300 to lung epithelial cells. Relative adhesion of <italic>S. aureus</italic> USA300 to A549 cells after treatment with different concentrations of C <bold>(A)</bold>, EGCG <bold>(B)</bold>, EGC <bold>(C)</bold>, ECG <bold>(D)</bold>, and EC <bold>(E)</bold>. Human lung cancer epithelial A549 cells in 24-well plates (1 &#xd7; 10<sup>5</sup> cells/well) were treated with <italic>S. aureus</italic> USA300 (MOI = 30) and different concentrations of the test compounds for 1 (h). Then, the cells were harvested after discarding the medium, washed with sterile PBS, diluted, plated onto LB agar in equal volumes, and cultured overnight at 37&#xb0;C. Data are shown as means with SEMs, <italic>n</italic> = 3; ns indicates not significant, * indicates <italic>p</italic> &#x2264; 0.05, and ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g005.tif"/>
</fig>
</sec>
<sec id="s3_6">
<title>ECG and its analogues inhibit &#x3b2;-lactamase activity</title>
<p>The &#x3b2;-lactamase secreted by <italic>S. aureus</italic> can decompose &#x3b2;-lactam antibiotics and induce bacterial tolerance. Nitrocefin is a kind of cephalosporin that is usually used to detect the activity of &#x3b2;-lactamases (<xref ref-type="bibr" rid="B48">Zhou et&#xa0;al., 2020</xref>), almost all &#x3b2;-lactamases can hydrolyze the amide bond between the carbonyl carbon and the nitrogen group on the &#x3b2;-lactam ring of nitrocefin, which could be&#xa0;judged by the color changing or detecting the OD<sub>492</sub> to analyze the inhibitory effect of inhibitors on &#x3b2;-lactamase activity. In this assay, the samples that were not treated with ECG or its analogues were defined as 100%. When treated with 128 &#xb5;g/mL test compounds, &#x3b2;-lactamase activity was reduced to 29.01% for ECG (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>), 40.85% for EGCG (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>), 73.24% for EGC (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>), 63.94% for C (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>) and 69.58% for EC (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6E</bold>
</xref>), indicating that ECG and its analogues inhibited &#x3b2;-lactamase activity.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>ECG and its analogues inhibit &#x3b2;-lactamase activity. Relative activities of &#x3b2;-lactamase after treatment with different concentrations of ECG <bold>(A)</bold>, EGCG <bold>(B)</bold>, EGC <bold>(C)</bold>, C <bold>(D)</bold>, and EC <bold>(E)</bold>. The &#x3b2;-lactamase protein was treated with various concentrations of the test compounds at 37&#xb0;C for 30 min, and then nitrocefin was added for an additional 10 min of incubation. The OD<sub>492</sub> values were measured to evaluate the inhibitory effects of these compounds on &#x3b2;-lactamase activity. Data are shown as means with SDs, <italic>n</italic> = 3; * indicates p &#x2264; 0.05; ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g006.tif"/>
</fig>
</sec>
<sec id="s3_7">
<title>ECG enhances the bactericidal ability of Amp and inhibits persister formation synergistically</title>
<p>This study evaluated the effects of ECG and its analogues on the tolerance of <italic>S. aureus</italic> USA300 to PG, Cef, Amp and kanamycin. When the concentrations of EGC, ECG and EGCG were 4 &#xb5;g/mL, the MICs of PG and Cef were reduced by 2-, 8- and 2-fold, respectively (<xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7A, B</bold>
</xref>). The MIC values of Amp against <italic>S.&#xa0;aureus</italic> USA300 decreased by 16- and 2-fold when it was combined with ECG and EGCG (4 &#xb5;g/mL), respectively, but cotreatment with EGC (4 &#xb5;g/mL) did not change the MIC value of Amp (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>). The MIC value of kanamycin against <italic>S. aureus</italic> USA300 was greater than 256 &#xb5;g/mL when kanamycin and ECG, EGCG, or EGC (32 &#xb5;g/mL) was coadministered to <italic>S. aureus</italic> USA300 and the MIC value did not change significantly (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), suggesting that these compounds did not synergize with kanamycin. These results indicate that ECG has excellent potential for use in combination with &#x3b2;-lactam antibiotics against infections caused by <italic>S. aureus</italic> USA300. For the synergistic sterilization assay, <italic>S. aureus</italic> USA300 showed similar growth trends with and without ECG treatment, but in the Amp and Amp combined with ECG treatment groups, the bacterial density gradually decreased over time. In the combination group, a more rapid downward trend was observed, and bacteria were not detected in the medium after 10 h (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7D</bold>
</xref>). The persister formation assay revealed that the bacterial density in the gentamicin treatment group decreased sharply, suggesting that the bacteria were killed quickly, but the downward trend gradually flattened, indicating that some bacteria survived as persisters; however, bacteria were not detected in the combination group after 2 h of treatment (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7E</bold>
</xref>). Taken together, these results indicate that ECG enhanced the bactericidal ability of Amp and inhibited persister formation synergistically.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>ECG enhances the bactericidal ability of Amp and inhibits persister formation synergistically. Changes in the MICs of PG <bold>(A)</bold>, Cef <bold>(B)</bold>, and Amp <bold>(C)</bold> upon cotreatment with EGC, ECG, and EGCG. <bold>(D)</bold> Logarithmic values of <italic>S. aureus</italic> USA300 density after treatment with ECG, Amp, and their combination. <bold>(E)</bold> Logarithmic values of <italic>S. aureus</italic> USA300 density after treatment with gentamicin with or without ECG. The MIC values of the tested antibiotics without or with ECG and its analogues were determined on the basis of CLSI methods. The <italic>S. aureus</italic> USA300 strain was treated with Amp, ECG, or their combination and then cultured with shaking. Samples were taken at specific time points to determine the number of clones. For the persister assay, <italic>S. aureus</italic> USA300 cultured overnight was treated with gentamicin with or without ECG, and colony numbers from the different samples were determined at the indicated time points. Data are shown as means with SDs, <italic>n</italic> = 3; ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g007.tif"/>
</fig>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>The MIC values of kanamycin against <italic>S. aureus</italic> USA300 when combined with tested compounds.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Names</th>
<th valign="top" align="center">MIC (&#xb5;g/mL)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">ECG</td>
<td valign="top" align="center">&#x2265; 128</td>
</tr>
<tr>
<td valign="top" align="center">EGCG</td>
<td valign="top" align="center">&#x2265; 128</td>
</tr>
<tr>
<td valign="top" align="center">EGC</td>
<td valign="top" align="center">&#x2265; 128</td>
</tr>
<tr>
<td valign="top" align="center">kanamycin</td>
<td valign="top" align="center">&gt; 256</td>
</tr>
<tr>
<td valign="top" align="center">Kanamycin + ECG (32 &#xb5;g/mL)</td>
<td valign="top" align="center">&gt; 256</td>
</tr>
<tr>
<td valign="top" align="center">Kanamycin + EGCG (32 &#xb5;g/mL)</td>
<td valign="top" align="center">&gt; 256</td>
</tr>
<tr>
<td valign="top" align="center">Kanamycin + EGC (32 &#xb5;g/mL)</td>
<td valign="top" align="center">64</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s3_8">
<title>ECG reduces <italic>S. aureus</italic> USA300-mediated cytotoxicity but does not affect the expression of its target proteins</title>
<p>
<italic>S. aureus</italic> induces cytotoxic effects that promote the development of infection. In this study, ECG was used to evaluate the cytotoxicity mediated by <italic>S. aureus</italic> USA300. Red fluorescence was abundant in the <italic>S. aureus</italic> USA300 treatment group, indicating that most of the cells died, but the intensity of red fluorescence decreased gradually upon treatment with 16 or 32 &#xb5;g/mL ECG (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8A</bold>
</xref>). In the LDH assay, the amount of LDH secreted by RAW264.7 cells treated with <italic>S. aureus</italic> USA300 alone was defined as 100%. When 16 or 32 &#xb5;g/mL ECG was added to the samples, the amount of LDH decreased to 69.14% and 44.48%, respectively (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8B</bold>
</xref>), indicating that ECG significantly alleviated the toxicity mediated by <italic>S. aureus</italic> USA300 to the cells. The amounts of LDH secreted from cells treated with 32 or 64 &#xb5;g/mL ECG analogues were similar to that in the DMEM treatment group (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>), suggesting that these analogues did not exhibit cytotoxicity. Furthermore, the expression levels of sortase A and &#x3b2;-lactamase did not change significantly when the samples were treated with 16 or 32 &#xb5;g/mL ECG (<xref ref-type="fig" rid="f8">
<bold>Figures&#xa0;8C, D</bold>
</xref>), and the secretion of &#x3b2;-lactamases in the bacterial culture supernatant was similar (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8E</bold>
</xref>), indicating that ECG did not affect the expression or secretion of &#x3b2;-lactamase or sortase A.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>ECG reduces <italic>S. aureus</italic> USA300-mediated cytotoxicity but does not affect the expression of its target proteins. <bold>(A)</bold> Cell survival after treatment with different concentrations of ECG detected by EB staining. <bold>(B)</bold> LDH levels in the cell culture supernatant. RAW264.7 cells were seeded in a 96-well plate (2 &#xd7; 10<sup>4</sup> cells/well) and treated with <italic>S. aureus</italic> USA300 (MOI = 60) with or without ECG for 5 (h). The samples were centrifuged, and the supernatant was obtained. Then, an equal volume of LDH reagent was added to each well, and the mixture was incubated for 20 min in the dark. LDH levels were determined by measuring the OD<sub>490</sub>. The cells were stained with 50 &#xb5;g/mL EB to observe their survival status. Data are shown as means with SDs, <italic>n</italic> = 3; ** indicates <italic>p</italic> &#x2264; 0.01. Expression levels of sortase A <bold>(C)</bold> and &#x3b2;-lactamase <bold>(D)</bold> and the secretion of &#x3b2;-lactamase into the bacterial culture supernatant <bold>(E)</bold>. <italic>S. aureus</italic> USA300 was treated with different concentrations of ECG at 37&#xb0;C with shaking for 8 (h). Following centrifugation, the bacteria and supernatant were obtained, and the expression of sortase A and &#x3b2;-lactamase was measured via western blotting. The secretion of &#x3b2;-lactamase in the supernatant was evaluated via Coomassie brilliant blue staining.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g008.tif"/>
</fig>
</sec>
<sec id="s3_9">
<title>Tyr96, Ile158, and Ile230 of &#x3b2;-lactamase are important for ECG binding</title>
<p>The &#x3b2;-lactamase&#x2013;ECG complex was determined to be in equilibrium when the RMSD fluctuated around approximately 0.2 and 0.1 nm (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9A</bold>
</xref>). In this complex, ECG was located in the active center of the enzyme (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9B</bold>
</xref>), and binding site analysis revealed that Ile158, Ile230, Ala229, Pro265, Ala95, and Tyr96 of &#x3b2;-lactamase interacted with ECG, and Asn123 and Gln228 of &#x3b2;-lactamase formed H-bonds with ECG (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9C</bold>
</xref>). The binding free energy results revealed that Tyr96, Ile230, and Ile158 contributed more energy to this interaction, and the total free energy contributions of these residues were -8.73, -7.81, and -4.03 kJ/mol, respectively (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9D</bold>
</xref>). To identify key residues involved in ECG binding, site-directed mutagenesis of &#x3b2;-lactamase was performed, and the results revealed that the inhibitory effects of ECG against the Y96A, I158A, and I230A mutants were much lower than that against the WT protein (<xref ref-type="fig" rid="f9">
<bold>Figure&#xa0;9E</bold>
</xref>), suggesting that these residues are critical for ECG binding.</p>
<fig id="f9" position="float">
<label>Figure&#xa0;9</label>
<caption>
<p>Tyr96, Ile158, and Ile230 are important for ECG binding to &#x3b2;-lactamase. <bold>(A)</bold> Fluctuations in the RMSDs during the experiment. Binding mode of ECG to &#x3b2;-lactamase <bold>(B)</bold> and the interacting residues <bold>(C)</bold>. <bold>(D)</bold> Energy contributions of the residues involved in binding. <bold>(E)</bold> Activities of &#x3b2;-lactamase and its mutants after treatment with ECG. Molecular simulations were performed by using GROMACS 2020.6, the binding free energy between &#x3b2;-lactamase and ECG was measured via the MMPBSA method, and the interacting residues were analyzed using LigPlus. Data are shown as means with SDs, <italic>n</italic> = 3; ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g009.tif"/>
</fig>
</sec>
<sec id="s3_10">
<title>ECG combined with Amp protects mice from <italic>S. aureus</italic> USA300 infection</title>
<p>Mice in the PC and Amp treatment groups died after 12 h, and the survival ratios of the two groups were 6.67% and 13.33%, respectively. However, in the ECG and combination groups, the mice died at 24 or 36 h, and the survival ratios reached 46.67% and 76.67%, respectively (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10A</bold>
</xref>). In addition, the number of <italic>S. aureus</italic> USA300 colonies in the ECG and ECG combined&#xa0;with the Amp treatment groups was significantly lower than that in the PC and Amp treatment groups (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10B</bold>
</xref>). Additionally, the lung tissues from the PC and Amp treatment groups exhibited inflammatory factor infiltration and the alveolar structures were destroyed compared with those in the NC group, whereas these manifestations were alleviated in the samples from the ECG and ECG combined with Amp groups (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10C</bold>
</xref>). Compared with that in the PC group, the wet/dry lung weight ratios from the ECG and ECG combined with Amp treatment groups were significantly lower, but Amp treatment alone did not affect this ratio (<xref ref-type="fig" rid="f10">
<bold>Figure&#xa0;10D</bold>
</xref>). As important indicators of inflammation level, TNF-&#x3b1; and IL-1&#x3b2; are often used to quantitatively evaluate the inflammation level of cells or tissue (<xref ref-type="bibr" rid="B28">Li et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2022</xref>). <italic>S. aureus</italic> infection is usually accompanied by an excessive inflammatory response, accompanied by an excessive release of TNF-&#x3b1; and IL-1&#x3b2; (<xref ref-type="bibr" rid="B15">Ghosh et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B14">Ghosh and Bishayi, 2024</xref>); the levels of TNF-&#x3b1; and&#xa0;IL-1&#x3b2; here in the samples from the ECG and ECG with Amp&#xa0;groups were significantly lower than those in the other&#xa0;groups, and Amp treatment alone slightly reduced the levels of these cytokines (<xref ref-type="fig" rid="f10">
<bold>Figures&#xa0;10E, F</bold>
</xref>). These results suggest&#xa0;that ECG alone or in combination with Amp could delay mouse death, improve mouse survival, weaken the colonization ability of bacteria, and relieve edema and inflammation in the lungs.</p>
<fig id="f10" position="float">
<label>Figure&#xa0;10</label>
<caption>
<p>ECG combined with Amp protects mice from <italic>S. aureus</italic> USA300 infection. <bold>(A)</bold> Survival of the mice in the different treatment groups, <italic>n</italic> = 30. <bold>(B)</bold> Bacterial loads in the lungs of the mice in the different treatment groups, <italic>n</italic> = 8. <bold>(C)</bold> Degree of pathological injury in each of the different treatment groups. <bold>(D)</bold> Lung weight ratio and level of inflammation in the lungs <bold>(E, F)</bold> in different treatment groups. C57BL/6J mice were intranasally inoculated with <italic>S. aureus</italic> USA300 (5 &#xd7; 10<sup>8</sup> CFUs/mouse) to establish a pneumonia model. The mice were treated with 50 mg/kg ECG, Amp, or their combination every 12 (h). To evaluate the survival rate, the mice were monitored at the specified time points. To evaluate the other indicators, lung tissues were obtained after the mice were euthanized. The bacterial loads of the lung tissues from the different groups were evaluated by analyzing the numbers of clones, and inflammation, pulmonary edema, and tissue damage were assessed by detecting the levels of cytokines, the weight ratio, and HE staining, respectively. Data are shown as means with SDs; <italic>n</italic> = 5; ns indicates not significant; ** indicates <italic>p</italic> &#x2264; 0.01.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-15-1537564-g010.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Sortase A is the most important member of the sortase family and anchors more than 20 different surface proteins to the bacterial cell wall (<xref ref-type="bibr" rid="B12">Geoghegan and Foster, 2017</xref>). The biological functions of some of these surface proteins, such as fibronectin-binding proteins that influence adhesion and biofilm formation, have been characterized (<xref ref-type="bibr" rid="B25">Kim et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B9">Foster, 2019</xref>; <xref ref-type="bibr" rid="B46">Xu et&#xa0;al., 2024</xref>). Chalcone has been reported to reduce the pathogenicity of <italic>Listeria monocytogenes</italic> by inhibiting sortase A activity by occupying the active center of sortase A (<xref ref-type="bibr" rid="B27">Li et&#xa0;al., 2016</xref>). Astilbin and trans-chalcone have been shown to inactivate <italic>Streptococcus mutans</italic> sortase A and reduce their formation of biofilms (<xref ref-type="bibr" rid="B42">Wallock-Richards et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B44">Wang et&#xa0;al., 2019</xref>). Wogonin was found to attenuate the pathogenicity of <italic>Streptococcus pneumoniae</italic> by inhibiting pneumolysin and sortase A, but the mechanism has not been elucidated (<xref ref-type="bibr" rid="B17">Gu et&#xa0;al., 2023</xref>). Here we found that ECG and its analogues bind directly to <italic>S. aureus</italic> sortase A and significantly reduce its activity; consequently, the <italic>S. aureus</italic> biofilm formation and adhesive abilities were inhibited, possibly resulting from the inactivation of sortase A, although other potential mechanisms maybe exist.</p>
<p>The crystal structure of sortase A and its substrate complex was reported in 2004 (PDB ID: 1T2W) (<xref ref-type="bibr" rid="B49">Zong et&#xa0;al., 2004</xref>). The substrate LPETG is located in the enzyme&#x2019;s catalytic center, with its N-terminus located around hydrophobic residues Ile158, Ile199, Val201, Val 168, and Leu169 and its C-terminus pointing to the narrow opening of the active site, wherein the key active site residues His120, Cys184, and Arg197 are positioned around the substrate peptide (<xref ref-type="bibr" rid="B49">Zong et&#xa0;al., 2004</xref>). In this study, the crystal structure of sortase A (PDB ID: 6R1V) was used for molecular docking, and it was found that ECG binds to the active pocket and that Leu169, Val168, Lys173, Asp170, Ile182, and Thr180 in sortase A had greater contributions to the binding free energy. Additionally, the inhibitory effects of ECG against the V168A, L169A, and K173A mutants decreased significantly, as these residues were located on the active center of the enzyme.</p>
<p>&#x3b2;-lactam antibiotics have played an important role in combating bacterial infections since the application of penicillin in the treatment of <italic>S. aureus</italic> infection. Unfortunately, the emergence and diversification of &#x3b2;-lactamases have posed challenges to the control of bacterial infections (<xref ref-type="bibr" rid="B8">Chen and Herzberg, 2001</xref>; <xref ref-type="bibr" rid="B32">Mlynarczyk-Bonikowska et&#xa0;al., 2022</xref>), limiting the clinical efficacy of all currently available &#x3b2;-lactam antibiotics. Therefore, it is important to identify antibiotic adjuvants, especially natural compounds with no or little antibacterial activity, to improve the sustainability of these types of antibiotics in clinical applications. To date, some natural compounds used as adjuvants have been shown to reduce pathogenic bacterial virulence, such as plumbagin, which binds to the catalytic pocket of monooxygenase to reduce the resistance of tet(X3)/tet(X4)-positive bacteria to tetracycline (<xref ref-type="bibr" rid="B47">Xu et&#xa0;al., 2022</xref>); thymol nanoemulsion, which reverses colistin resistance in <italic>Salmonella enterica serovar Typhimurium (</italic>
<xref ref-type="bibr" rid="B36">Sheng et&#xa0;al., 2023</xref>); and fisetin, which attenuates meropenem resistance in NDM-1-producing <italic>E. coli</italic> by targeting metallo-&#x3b2;-lactamases (<xref ref-type="bibr" rid="B19">Guo et&#xa0;al., 2022</xref>). This study revealed that ECG and its analogues restored the sensitivity of bacteria to Amp, Cef, and PG by inhibiting &#x3b2;-lactamase activity. ECG improved the bactericidal ability of Amp and inhibited the formation of persisters. ECG alone or in combination with Amp <italic>in vivo</italic> had a systemic protective effect in the <italic>S. aureus</italic> pneumonia model. These results suggest that ECG has the potential to be developed as an adjuvant for &#x3b2;-lactam antibiotics in the future to improve the sustainability of antibiotic applications.</p>
<p>O Herzberg reported the crystal structure of the <italic>S. aureus</italic> &#x3b2;-lactamase (PDB ID: 3BLM), which is composed of two domains, and the catalytic center is located at the interface between the two domains. Many residues are found in the catalytic pocket, including but not limited to Tyr105, Glu166, Leu169, Asn170, Lys73, Ser70, Ile239, Ser130, Lys234, and Tyr165 (<xref ref-type="bibr" rid="B20">Herzberg, 1991</xref>). Crystal structures of &#x3b2;-lactamases with their ligands were subsequently reported (PDB IDs: 1BLC and 6WGR), and both ligands were located in the catalytic center (<xref ref-type="bibr" rid="B7">Chen and Herzberg, 1992</xref>). Here the &#x3b2;-lactamase crystal structure 6WGR was used to perform molecular docking, and it was found that ECG bound to the catalytic pocket of &#x3b2;-lactamase. The calculated binding free energy and mutagenesis analysis results revealed that Tyr96, Ile158, and Ile230 are important for ECG binding. We aligned the 6WGR and 3BLM structures and found that Tyr96, Ile158, and Ile230 in 6WGR corresponded to Tyr105, Ile167, and Ile239 in 3BLM, which are the constituent residues of the active pocket.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<title>Conclusion</title>
<p>This study revealed that green tea bioactive ingredients, especially ECG, target <italic>S. aureus</italic> sortase A and &#x3b2;-lactamase simultaneously to alleviate the pathogenicity of <italic>S. aureus</italic>. By interacting with sortase A, ECG decreased <italic>S. aureus</italic> biofilm formation and the adhesion of this bacteria to host cells. ECG also bound to &#x3b2;-lactamase to restore the susceptibility of this bacteria to &#x3b2;-lactam antibiotics, improve the bactericidal ability of Amp, and reduce the formation of persisters. ECG alleviated the cytotoxicity mediated by <italic>S. aureus</italic> USA300 without affecting the expression of sortase A or &#x3b2;-lactamase and protected mice from <italic>S. aureus</italic> USA300 infection comprehensively. These results support the potential of the development of ECG or its analogues as anti-<italic>S. aureus</italic> infection agents.</p>
</sec>
</body>
<back>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Animal Ethics Committee of Jilin University. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>FT: Data curation, Investigation, Writing &#x2013; original draft. LW: Methodology, Writing &#x2013; original draft, Investigation. JW: Investigation, Visualization, Writing &#x2013; original draft. ZT: Investigation, Visualization, Writing &#x2013; original draft. GW: Conceptualization, Funding acquisition, Software, Writing &#x2013; review &amp; editing. LP: Conceptualization, Funding acquisition, Supervision, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by grant from the National Natural Science Foundation of China (Grant No.81870030 and No. 82070043) and the Scientific Research Project of Jilin province (JJKH20240246KJ).</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="ai-statement">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
</sec>
<sec id="s12" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2025.1537564/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2025.1537564/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="Table1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alharthi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Alavi</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Moyle</surname> <given-names>P. M.</given-names>
</name>
<name>
<surname>Ziora</surname> <given-names>Z. M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Sortase A (SrtA) inhibitors as an alternative treatment for superbug infections</article-title>. <source>Drug Discovery Today</source> <volume>26</volume>, <fpage>2164</fpage>&#x2013;<lpage>2172</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.drudis.2021.03.019</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bozhkova</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Gordina</surname> <given-names>E. M.</given-names>
</name>
<name>
<surname>Labutin</surname> <given-names>D. V.</given-names>
</name>
<name>
<surname>Kudryavtsev</surname> <given-names>K. V.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Oligopeptide sortase inhibitor modulates staphylococcus aureus cell adhesion and biofilm formation</article-title>. <source>Antibiotics (Basel)</source> <volume>11</volume>, <fpage>1836</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antibiotics11121836</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cascioferro</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Raffa</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Maggio</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Raimondi</surname> <given-names>M. V.</given-names>
</name>
<name>
<surname>Schillaci</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Daidone</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Sortase A inhibitors: recent advances and future perspectives</article-title>. <source>J. Med. Chem.</source> <volume>58</volume>, <fpage>9108</fpage>&#x2013;<lpage>9123</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.jmedchem.5b00779</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cascioferro</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Totsika</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Schillaci</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Sortase A: an ideal target for anti-virulence drug development</article-title>. <source>Microb. Pathog.</source> <volume>77</volume>, <fpage>105</fpage>&#x2013;<lpage>112</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micpath.2014.10.007</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>(-)-Epicatechin gallate prevents inflammatory response in hypoxia-activated microglia and cerebral edema by inhibiting NF-&#x3ba;B signaling</article-title>. <source>Arch. Biochem. Biophys.</source> <volume>729</volume>, <fpage>109393</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.abb.2022.109393</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Epicatechin gallate prevents the <italic>de novo</italic> synthesis of fatty acid and the migration of prostate cancer cells</article-title>. <source>Acta Biochim. Biophys. Sin. (Shanghai)</source> <volume>53</volume>, <fpage>1662</fpage>&#x2013;<lpage>1669</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/abbs/gmab144</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>C. C.</given-names>
</name>
<name>
<surname>Herzberg</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Inhibition of beta-lactamase by clavulanate. Trapped intermediates in cryocrystallographic studies</article-title>. <source>J. Mol. Biol.</source> <volume>224</volume>, <fpage>1103</fpage>&#x2013;<lpage>1113</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0022-2836(92)90472-V</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>C. C.</given-names>
</name>
<name>
<surname>Herzberg</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Structures of the acyl-enzyme complexes of the Staphylococcus aureus beta-lactamase mutant Glu166Asp: Asn170Gln with benzylpenicillin and cephaloridine</article-title>. <source>Biochemistry</source> <volume>40</volume>, <fpage>2351</fpage>&#x2013;<lpage>2358</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/bi002277h</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foster</surname> <given-names>T. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Surface proteins of staphylococcus aureus</article-title>. <source>Microbiol. Spectr.</source> <volume>7</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/microbiolspec.GPP3-0046-2018</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Foster</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Geoghegan</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Ganesh</surname> <given-names>V. K.</given-names>
</name>
<name>
<surname>H&#xf6;&#xf6;k</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Adhesion, invasion and evasion: the many functions of the surface proteins of Staphylococcus aureus</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>12</volume>, <fpage>49</fpage>&#x2013;<lpage>62</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrmicro3161</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Structure-Activity relationship of MDSA and its derivatives against Staphylococcus aureus Ser/Thr phosphatase Stp1</article-title>. <source>Comput. Biol. Chem.</source> <volume>85</volume>, <fpage>107230</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.compbiolchem.2020.107230</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Geoghegan</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Foster</surname> <given-names>T. J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Cell wall-anchored surface proteins of staphylococcus aureus: many proteins, multiple functions</article-title>. <source>Curr. Top. Microbiol. Immunol.</source> <volume>409</volume>, <fpage>95</fpage>&#x2013;<lpage>120</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tim.2017.11.008</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>George</surname> <given-names>C. R. R.</given-names>
</name>
<name>
<surname>Lahra</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Gatus</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Disc test for detecting staphylococcus aureus strains producing type A and type C &#x3b2;-lactamases</article-title>. <source>Microbiol. Spectr.</source> <volume>11</volume>, <elocation-id>e0022023</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/spectrum.00220-23</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghosh</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Bishayi</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Endogenous blocking of TLR2 along with TNF-&#x3b1; and IL-1&#x3b2; ameliorates the severity of the S. aureus arthritis via modulating STAT3/SOCS3 expressions in tissue resident macrophages</article-title>. <source>Microb. Pathog.</source> <volume>187</volume>, <fpage>106518</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2024.112153</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghosh</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ghosh</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Sawoo</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Dutta</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Bishayi</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Impact of dual neutralization of TNF-&#x3b1; and IL-1&#x3b2; along with Gentamicin treatment on the functions of blood and splenic neutrophils and its role on improvement of S. aureus induced septic arthritis</article-title>. <source>Int. Immunopharmacol</source> <volume>123</volume>, <fpage>110766</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2023.110766</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Grossman</surname> <given-names>A. B.</given-names>
</name>
<name>
<surname>Burgin</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Rice</surname> <given-names>K. C.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Quantification of staphylococcus aureus biofilm formation by crystal violet and confocal microscopy</article-title>. <source>Methods Mol. Biol.</source> <volume>2341</volume>, <fpage>69</fpage>&#x2013;<lpage>78</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-0716-1550-8_9</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gu</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Wogonin attenuates the pathogenicity of Streptococcus pneumoniae by double-target inhibition of Pneumolysin and Sortase A</article-title>. <source>J. Cell Mol. Med.</source> <volume>27</volume>, <fpage>563</fpage>&#x2013;<lpage>575</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jcmm.17684</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Novel metallo-&#x3b2;-lactamases inhibitors restore the susceptibility of carbapenems to New Delhi metallo-lactamase-1 (NDM-1)-harbouring bacteria</article-title>. <source>Br. J. Pharmacol.</source> <volume>181</volume>, <fpage>54</fpage>&#x2013;<lpage>69</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/bph.v181.1</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Guo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>G.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Metallo-&#x3b2;-lactamases inhibitor fisetin attenuates meropenem resistance in NDM-1-producing Escherichia coli</article-title>. <source>Eur. J. Med. Chem.</source> <volume>231</volume>, <fpage>114108</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejmech.2022.114108</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Herzberg</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>Refined crystal structure of beta-lactamase from Staphylococcus aureus PC1 at 2.0 A resolution</article-title>. <source>J. Mol. Biol.</source> <volume>217</volume>, <fpage>701</fpage>&#x2013;<lpage>719</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/0022-2836(91)90527-D</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ide</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kawasaki</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kawakami</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Yamada</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Anti-influenza virus effects of catechins: A molecular and clinical review</article-title>. <source>Curr. Med. Chem.</source> <volume>23</volume>, <fpage>4773</fpage>&#x2013;<lpage>4783</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/0929867324666161123091010</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>EChinacoside, a promising sortase A inhibitor, combined with vancomycin against murine models of MRSA-induced pneumonia</article-title>. <source>Med. Microbiol. Immunol.</source> <volume>212</volume>, <fpage>421</fpage>&#x2013;<lpage>435</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00430-023-00782-9</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jonsson</surname> <given-names>I. M.</given-names>
</name>
<name>
<surname>Mazmanian</surname> <given-names>S. K.</given-names>
</name>
<name>
<surname>Schneewind</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Bremell</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Tarkowski</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>The role of Staphylococcus aureus sortase A and sortase B in murine arthritis</article-title>. <source>Microbes Infect.</source> <volume>5</volume>, <fpage>775</fpage>&#x2013;<lpage>780</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1286-4579(03)00143-6</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Keren</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Kaldalu</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Spoering</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lewis</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Persister cells and tolerance to antimicrobials</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>230</volume>, <fpage>13</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0378-1097(03)00856-5</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Rimal</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Schaefer</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Surface proteins and the formation of biofilms by Staphylococcus aureus</article-title>. <source>Biochim. Biophys. Acta Biomembr</source> <volume>1860</volume>, <fpage>749</fpage>&#x2013;<lpage>756</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbamem.2017.12.003</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kochman</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Jakubczyk</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Antoniewicz</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Mruk</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Janda</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Health benefits and chemical composition of matcha green tea: A review</article-title>. <source>Molecules</source> <volume>26</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules26010085</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>Z.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection</article-title>. <source>Biochem. Pharmacol.</source> <volume>106</volume>, <fpage>19</fpage>&#x2013;<lpage>29</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bcp.2016.01.018</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wei</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Si</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Deng</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Quercetin reduces Streptococcus suis virulence by inhibiting suilysin activity and inflammation</article-title>. <source>Int. Immunopharmacol</source> <volume>69</volume>, <fpage>71</fpage>&#x2013;<lpage>78</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.intimp.2019.01.017</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Bi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhong</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Cai</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Quercitrin, an inhibitor of Sortase A, interferes with the adhesion of Staphylococcal aureus</article-title>. <source>Molecules</source> <volume>20</volume>, <fpage>6533</fpage>&#x2013;<lpage>6543</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules20046533</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>T. T.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Gao</surname> <given-names>M. N.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>K. X.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>K. Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>The inhibitory mechanism of aurintricarboxylic acid targeting serine/threonine phosphatase Stp1 in Staphylococcus aureus: insights from molecular dynamics simulations [J</article-title>. <source>Acta Pharmacol. Sin.</source> <volume>40</volume>, <fpage>850</fpage>&#x2013;<lpage>858</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41401-019-0216-x</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Pterostilbene restores carbapenem susceptibility in New Delhi metallo-&#x3b2;-lactamase-producing isolates by inhibiting the activity of New Delhi metallo-&#x3b2;-lactamases</article-title>. <source>Br. J. Pharmacol.</source> <volume>176</volume>, <fpage>4548</fpage>&#x2013;<lpage>4557</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/bph.v176.23</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mlynarczyk-Bonikowska</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Kowalewski</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Krolak-Ulinska</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Molecular mechanisms of drug resistance in staphylococcus aureus</article-title>. <source>Int. J. Mol. Sci.</source> <volume>23</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms23158088</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mossman</surname> <given-names>A. K.</given-names>
</name>
<name>
<surname>Svishchuk</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Waddell</surname> <given-names>B. J. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Staphylococcus aureus in non-cystic fibrosis bronchiectasis: prevalence and genomic basis of high inoculum &#x3b2;-lactam resistance</article-title>. <source>Ann. Am. Thorac. Soc.</source> <volume>19</volume>, <fpage>1285</fpage>&#x2013;<lpage>1293</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1513/AnnalsATS.202108-965OC</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Musial</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Kuban-Jankowska</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gorska-Ponikowska</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Beneficial properties of green tea catechins</article-title>. <source>Int. J. Mol. Sci.</source> <volume>21</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms21051744</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ronner</surname> <given-names>A. C.</given-names>
</name>
<name>
<surname>Curtin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Karami</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Adhesion of meticillin-resistant Staphylococcus aureus to DACC-coated dressings</article-title>. <source>J. Wound Care</source> <volume>23</volume>, <fpage>484, 6</fpage>&#x2013;<lpage>484, 8</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.12968/jowc.2014.23.10.484</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sheng</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>A new function of thymol nanoemulsion for reversing colistin resistance in Salmonella enterica serovar Typhimurium infection</article-title>. <source>J. Antimicrob. Chemother.</source> <volume>78</volume>, <fpage>2983</fpage>&#x2013;<lpage>2994</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jac/dkad342</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shulga</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Kudryavtsev</surname> <given-names>K. V.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Theoretical studies of leu-pro-arg-asp-ala pentapeptide (LPRDA) binding to sortase A of staphylococcus aureus</article-title>. <source>Molecules</source> <volume>27</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules27238182</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Teng</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Epigallocatechin gallate inhibits Streptococcus pneumoniae virulence by simultaneously targeting pneumolysin and sortase A</article-title>. <source>J. Cell Mol. Med.</source> <volume>21</volume>, <fpage>2586</fpage>&#x2013;<lpage>2598</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/jcmm.2017.21.issue-10</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Hibifolin, a natural sortase A inhibitor, attenuates the pathogenicity of staphylococcus aureus and enhances the antibacterial activity of cefotaxime</article-title>. <source>Microbiol. Spectr.</source> <volume>10</volume>, <elocation-id>e0095022</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/spectrum.00950-22</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Cyanidin chloride protects mice from methicillin-resistant Staphylococcus aureus-induced pneumonia by targeting Sortase A</article-title>. <source>Virulence</source> <volume>13</volume>, <fpage>1434</fpage>&#x2013;<lpage>1445</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/21505594.2022.2112831</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Trott</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Olson</surname> <given-names>A. J.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading</article-title>. <source>J.&#xa0;Comput. Chem.</source> <volume>31</volume>, <fpage>455</fpage>&#x2013;<lpage>461</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jcc.21334</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wallock-Richards</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Marles-Wright</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Clarke</surname> <given-names>D. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Molecular basis of Streptococcus mutans sortase A inhibition by the flavonoid natural product trans-chalcone</article-title>. <source>Chem. Commun. (Camb)</source> <volume>51</volume>, <fpage>10483</fpage>&#x2013;<lpage>10485</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/C5CC01816A</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Kaempferol-driven inhibition of listeriolysin O pore formation and inflammation suppresses listeria monocytogenes infection</article-title>. <source>Microbiol. Spectr.</source> <volume>10</volume>, <elocation-id>e0181022</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/spectrum.01810-22</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jing</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Astilbin inhibits the activity of sortase A from streptococcus mutans</article-title>. <source>Molecules</source> <volume>24</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/molecules24030465</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Weiss</surname> <given-names>W. J.</given-names>
</name>
<name>
<surname>Lenoy</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Murphy</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Effect of srtA and srtB gene expression on the virulence of Staphylococcus aureus in animal models of infection</article-title>. <source>J.&#xa0;Antimicrob. Chemother.</source> <volume>53</volume>, <fpage>480</fpage>&#x2013;<lpage>486</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/jac/dkh078</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Cell-wall-anchored proteins affect invasive host colonization and biofilm formation in Staphylococcus aureus</article-title>. <source>Microbiol. Res.</source> <volume>285</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micres.2024.127782</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>A novel inhibitor of monooxygenase reversed the activity of tetracyclines against tet(X3)/tet(X4)-positive bacteria</article-title>. <source>EBioMedicine</source> <volume>78</volume>, <fpage>103943</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ebiom.2022.103943</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Application of oleanolic acid and its&#xa0;analogues in combating pathogenic bacteria <italic>in vitro</italic>/vivo by a two-pronged strategy of &#x3b2;-lactamases and hemolysins</article-title>. <source>ACS Omega</source> <volume>5</volume>, <fpage>11424</fpage>&#x2013;<lpage>11438</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acsomega.0c00460</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zong</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Bice</surname> <given-names>T. W.</given-names>
</name>
<name>
<surname>Ton-That</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Crystal structures of Staphylococcus aureus sortase A and its substrate complex</article-title>. <source>J. Biol. Chem.</source> <volume>279</volume>, <fpage>31383</fpage>&#x2013;<lpage>31389</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M401374200</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>