The current case-control study involved 500 DM patients who were referred to two main diabetes care centers in Lorestan Province, Iran between December 2022 and June 2024. The present study included patients diagnosed with type II DM who had a confirmed history of the condition and who were both willing and capable of providing written informed consent. Furthermore, a control group comprising 500 healthy persons without DM (non-DM) who were referred to health centers during the same study period was incorporated into the research. In the case group, a non-probability consecutive sampling method was employed during the specified time frame. Conversely, the control group was utilized a non-probability quota sampling method that aligns with the case group regarding age, gender, and distribution of place of residence. The exclusion criteria for the study included individuals who declined to participate, those who had recently used systemic antibiotics within the previous three months, and individuals with immune system deficiencies (e.g., Acquired immunodeficiency syndrome, cancer chemotherapy, and lupus). Additionally, individuals with a history or current presence of clinically significant chronic diseases, excluding diabetes mellitus, as well as those with conditions such as substance abuse, alcohol dependence, or psychiatric disorders, were also excluded from participation.

The protocol was authorized by Lorestan University of Medical Sciences' Committee on the Ethics of Animal Experiments (Permit Number: IR.LUMS.REC.1401.245). This approval is reliant on the proposal/documents received by this committee on 2023.01-18.

Information and consent documents were developed and disseminated to the participants in both studies groups. Following this, a questionnaire was administered to collect demographic information, including age, gender, place of residence, education level, occupation, monthly income, tooth brushing practices, and mouthwash usage.

Samples were obtained from participants for microscopic analysis by collecting two samples with sterile swabs from saliva and dental plaque. Furthermore, an additional saliva sample was preserved in tubes containing sterile normal saline for molecular testing purposes (Bao et al., 2020).

After the preparation of smears on glass slides, the slides were subjected to staining procedures utilizing trichrome and Giemsa stains, and were subsequently analyzed under a light microscope (Ghabanchi et al., 2010).

DNA purification from saliva and dental plaque samples was performed utilizing a commercial kit (Parstous, Iran) in accordance with the manufacturer's instructions. The extracted DNA samples were subjected to conventional PCR analysis for the identification of oral parasites. Two specific sets of PCR primers were utilized to amplify and detect E. gingivalis (small ribosomal RNA (SrRNA) gene, F5′- GCGCATTTCGAACAGGAATGTAGA -3′ and R 5′-CAAAGCCTTTTCAATAGTATCTTCATTCA-3′) and T. tenax (18S ribosomal RNA gene, F5′-ATGACCAGTTCCATCGATGCCATTC-3′) and R5′-CTCCAAAGATTCTGCCACTAACAAG -3′). The thermal cycling protocol for PCR included an initial denaturation step of 5 minutes at 95°C, followed by 37 cycles comprising denaturation at 95°C for 30 seconds, primer annealing at 62°C for 1 minute, and elongation at 74°C for 60s. A final elongation step was performed for 10 minutes at 73°C (Selahbarzin et al., 2024). To ensure the integrity of DNA extraction and the PCR results, appropriate positive and negative controls were implemented to mitigate contamination. Positive controls consisted of patient samples containing motile E. gingivalis and T. tenax, which yielded the expected amplicon sizes, while nuclease-free water was utilized as the negative control. The resulting amplicons were visualized using 1% agarose gel electrophoresis.

The statistical analysis of the results was conducted utilizing SPSS version 24.0 (SPSS Inc., Chicago, IL, USA). Chi-square tests were employed to assess the differences in participant distribution between the case and control groups, as well as to evaluate the associations between independent and dependent variables. Variables that demonstrated a significant relationship with oral cavity parasites were further analyzed as potential risk factors. Variables with a p-value of less than or equal to 0.20 were incorporated into the final multivariate logistic regression model. To ascertain the likelihood of exposure to the oral parasites in DM patients compared to healthy individuals, odds ratios with a 95% confidence interval were calculated. P-values of less than 0.05 were deemed indicative of statistical significance.

Out of a total of 500 DM patients, 136 (27.2%) and 146 (29.2%) patients had the oral cavity parasites (E. gingivalis and T. tenax) by microscopic ( Figure 1 ) and PCR analysis ( Figure 2 ). Within the positive samples, 101 (69.2%) and 44 (33.1%) DM patients were found to be infected with E. gingivalis and T. tenax, respectively; while one DM patient (0.7%) showed a mixed infection involving both E. gingivalis and T. tenax. In contrast, within the control group comprising 500 non-DM, 61 (12.2%) and 65 (13.0%) tested positive for parasites using microscopic and PCR methods, respectively. Among the positive samples from non-DM participants, 41 (63.1%) were identified as positive for E. gingivalis, while 24 (36.9%) tested positive for T. tenax ( Table 1 ). These results suggest that the probability of exposure to oral cavity parasites in non-DM participants is significantly lower than that observed in the case group (p<0.001, OR = 0.411; CI= 0.274-0.539).

In DM patients under the age of 30 yrs, 10 participants (20.0%) exhibited the presence of oral cavity parasites, while 40 participants (80.0%) did not show the presence of oral cavity parasites. Among the DM patients aged 30 to 60 years, 112 individuals (31.4%) tested positive for oral cavity parasites, in contrast to 245 individuals (68.6%) were negative positive for oral cavity parasites. In the DM patients aged over 60 years, 24 individuals (25.8%) were found to have oral cavity parasites, whereas 69 individuals (74.2%) did not have oral cavity parasites. The observed differences in the prevalence of oral cavity parasites across the various age groups were not statistically significant (p=0.185), indicating that there is no meaningful association between age and the presence of oral cavity parasites (p > 0.05). The results indicated that among 157 men DM patients, 42 men (26.8%) tested positive for oral cavity parasites, while 115 men (73.2%) tested negative. Among female DM patients, 104 individuals (30.3%) were positive for oral cavity parasites, whereas 239 individuals (69.7%) were negative for oral cavity parasites. The observed difference in the prevalence of oral cavity parasites between male and female participants was not statistically significant (p=0.240); demonstrating that there is no significant association between gender and the presence of oral cavity parasites (p>0.05). It was found that among DM patients who living in urban areas, 109 individuals (33.7%) tested positive for such infections, while 214 individuals (66.3%) tested negative. Conversely, DM patients who living in rural areas, 37 individuals (20.9%) were positive for oral cavity parasites n infections, and 140 individuals (79.1%) were negative. The observed difference in the prevalence of oral cavity parasites between urban and rural residents was statistically significant (p=0.002). This indicates a significant association between the residence and the prevalence of oral cavity parasites n (p<0.05). Among unemployed and employed DM patients, it was found that 113 unemployed patients (29.1%) tested positive for the oral cavity parasites. In contrast, among the employed DM patients, 33 out of 112 individuals (29.5 %) were positive for oral cavity parasites. The statistical analysis revealed that the difference in prevalence rates between the two occupational groups was not significant (p=0.516). This indicates that there is no statistically significant association between occupation and the presence of oral cavity parasites (p>0.05) ( Table 2 ). In a similar vein, the analysis revealed no significant correlation between age (p=0.185), gender (p=0.240), and employment status (p=0.208) with the prevalence of oral cavity parasites among non-DM participants. Conversely, a significant association was found between the participants' place of residence and the prevalence of oral cavity parasites in the non-DM group (p<0.002) ( Table 3 ). Among DM patients with illiteracy, 21 participants (39.6%) exhibited the presence of oral cavity parasites; while, in the DM patients with a diploma or lower educational attainment and DM patients with education exceeding a diploma, 104 individuals (30.2%) and 21 individuals (20.4%) tested positive for oral cavity parasites, respectively. The observed differences in the prevalence of oral cavity parasites across the various educational groups in DM patients were statistically significant (p=0.033), indicating a significant association between educational level and the presence of oral cavity parasites infection (p<0.05) ( Table 2 ). However, no significant relationship was identified between the education level and the prevalence of both oral cavity parasites in the and non-DM participants (p=0.564) ( Table 3 ). Concerning the prevalence of oral cavity parasites among DM patients with varying income levels, it was found that among those earning less than $250, 93 individuals (23.3%) tested positive for oral cavity parasites. In the DM patients with incomes ranging from $300 to $600, 46 individuals (68.7%) and among those with incomes exceeding $600, 7 individuals (21.2%) tested positive for oral cavity parasites, respectively. The observed differences in the prevalence of parasites in the oral cavity across the various income groups were statistically significant (p=0.01); indicated that there is a significant relationship between income and infection with oral cavity parasites (p<0.05). Similarly, a meaningful link was reported between income levels and the incidence of oral cavity parasites among non-DM participants (p=0.001).

The results showed that that 112 (28.2%) out of 397 DM patients who did not engage in regular tooth brushing tested positive for these oral cavity parasites. In non-DM participants who did not engage in regular tooth brushing, 50 individuals (13.8%) tested positive for the oral cavity parasites, while the rest were negative. The observed difference in the prevalence of oral cavity parasites and the tooth brushing among participants was not statistically significant in the DM (p=0.202) and non-DM participants (p=0.246). Oral cavity parasites were detected in 141 DM patients (31.1%) who did not use mouthwash, while, among non-DM patients who did not use mouthwash, 64 individuals (43.3%) were positive for oral cavity parasites. An examination of tooth brushing practices demonstrated a notable correlation between the frequency of mouthwash using and the occurrence of both E. gingivalis and T. tenax in individuals with DM (p<0.001) as well as in those without DM (p=0.002). This indicates a significant relationship between the use of mouthwash and parasites n infection in the oral cavity (p<0.001) ( Tables 2 , 3 ).

Among several factors, income, place of residence, education, and use mouthwash demonstrated a significant predictive effect on the oral cavity parasites (p<0.05). Patients with an income of lower than 600 USD had a higher probability of oral cavity parasites compared to those with an income of > 600 USD (p=0.001, OR = 5.491, 95% CI: 4.089 to 9.723). The probability of oral cavity parasites was 1.98 times higher in patients who living in urban areas compared to rural regions (p=0.006, OR = 1.982, 95% CI: 1.222). Patients who were not literate had a 3.57 times greater chance of being infected with oral cavity parasites compared to patients with less than and equal to a diploma (p= 0.002, OR = 3.577 (1.618, 5.907)). Patients with a diploma education had 1.84 times the likelihood of being infected with oral cavity parasites compared to those who were higher diploma (p=0.037, OR = 1.864 [1.039 - 3.346]). Furthermore, DM patients who use mouthwash demonstrated a protective factor of oral cavity parasites [p=0.001, OR=0.016 (0.005-0.048)] ( Table 4 ).