In January 2024, clinical samples were collected from two pig farms in Anhui and Jiangsu provinces experiencing piglet diarrhea. From the Anhui farm, 158 samples were obtained, including 9 piglet intestinal tissue samples and 149 fecal samples. Meanwhile, 24 samples were collected from the Jiangsu farm, comprising 1 intestinal tissue sample and 23 fecal samples. The tissue samples were placed in 2 mL centrifuge tubes containing 1 mL of DMEM medium, homogenized, subjected to freeze-thaw cycles, and then centrifuged at 12,000 rpm for 5 minutes. Supernatants were stored at -80°C for further analysis. Fecal samples were diluted 1:100 in phosphate-buffered saline (PBS) and used for RNA extraction with the MagaBio Plus Virus DNA/RNA Purification Kit II (MagaBio, China), following the manufacturer’s protocol. Porcine epidemic diarrhea virus (PEDV), PDCoV, transmissible gastroenteritis virus (TGEV), swine acute diarrhea syndrome coronavirus (SADS-CoV), and porcine rotavirus (PoRV) were detected using the Hifair^® V C58P2 Multiplex One Step RT-qPCR Probe Kit (Yeasen Biotechnology, China).PEDV sense: 5-GAATTCCCAAGGGCGAAAAT-3′: antisense:5′-TTTTCGACAAATTCCGCATCT-3′: probe:CGTAGCAGCTTGCTTCGGACCCA),PDCoV sense: 5′-ATCGACCACATGGCTCCAA-3′: antisense:5′-CAGCTCTTGCCCATGTAGCTT-3′: probe:CACACCAGTCGTTAAGCATGGCAAGCT,TGEV sense: 5′-CCACCACAGAATCTAGTTTGACTTGC-3′: antisense:5′-ACCGCATCTGCAAACCATTGTAGG-3′: probe:GTGAGTGCAGGTTAAACCATAAGTTCCCT,SADS-CoV sense: 5′-CTGACTGTTGTTGAGGTTAC-3′: antisense:5′-TCTGCCAAAGCTTGTTTAAC-3′: probe:TCACAGTCTCGTTCTCGCAATCA,PoRV sense: 5′-GGACTTACATTACGAATTGAATCTG-3′: antisense:5′-TTGCCAAYAAAGTTTCRGAAGC-3′: probe:AGTTTGTGAATCTGTGCTTGCGGA.The one-step RT-PCR was conducted in a 20 μL reaction volume, containing 2 μg of RNA, 10 μL of 2× Hifair^® V C58P2 MP Buffer, 0.8 μL of Hifair^® V C58P2 Enzyme Mix, 0.4 μmol/L of each gene-specific primer, and 0.2 μmol/L of each gene-specific probe. RNase-free H₂O was added to bring the volume up to 20 μL. The thermal cycling conditions were as follows: 50°C for 20 min, 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s.

LLC-PK cells were obtained from Guangdong Wen’s Foodstuffs Group Co. Ltd (Guangdong, China) and cultured in DMEM medium (Hyclone, USA) supplemented with 10% fetal bovine serum (FBS) (BOVOGEN, Australia). PDCoV amplification was performed in DMEM supplemented with 8 µg/mL trypsin (Gibco, USA) in a 5% CO₂ incubator. After centrifugation of the homogenized positive tissue at 10,000 rpm for 10 minutes, the supernatant was mixed with DMEM at ratios of 1:10, 1:20, and 1:50, and then filtered through a 0.22 μm filter for sterilization. A volume of 500 µL of the mixture was added to monolayer LLC-PK cells in a six-well plate and incubated for 1.5 hours, after which the supernatant was discarded. Subsequently, 2 mL of DMEM containing 2% FBS and 1% dual-specific antibodies was added, and the cells were incubated at 37°C in a 5% CO₂ incubator for 48 hours to observe for cytopathic effects (CPE). If no CPE was observed, the cells underwent three freeze-thaw cycles at −80°C. The cells were then collected and passaged until approximately 80% exhibited CPE. During passage, positive control wells inoculated with PDCoV and negative control wells without virus inoculation were included.

LLC-PK cells were seeded in 96-well plates, cultured overnight, and subsequently washed twice with maintenance medium. A total of 100 μL of 10-fold serially diluted PDCoV was inoculated into eight wells per dilution and incubated at 37°C in a 5% CO₂ environment. The cytopathic effect (CPE) was monitored for 5 to 7 days, and virus titers were calculated using the Reed-Muench method (Reed and Muench, 1938) expressed as TCID50/mL.

LLC-PK cells in 6-well cell culture plates were either mock-infected or infected with porcine epidemic diarrhea virus (PEDV) at a multiplicity of infection (MOI) of 0.1. At 24 hours post-infection, the cells were fixed with 4% paraformaldehyde at 4°C for 30 minutes and then permeabilized with 0.25% Triton X-100 (Solarbio, China) for 10 minutes at room temperature. After washing the plates three times with phosphate-buffered saline (PBS) (Gibco™, USA), the cells were blocked with 5% bovine serum albumin (BSA; Solarbio, China) at room temperature for 1 hour. Mouse anti-PDCoV spike (S) protein (preserved in this laboratory) and Alexa Fluor^® 488-conjugated goat anti-mouse IgG (Abcam, UK) were used as primary and secondary antibodies, respectively. The cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Vectorlabs, USA) for 5 minutes at room temperature. After washing with PBS, the stained cells were observed using a fluorescence microscope (Olympus, Japan).

RNA was extracted from samples of clarified infected cell lysate or purified virus using TRIzol and prepared for next-generation sequencing. Briefly, reverse transcription was performed using random hexamers. Subsequent DNase treatment and cleanup were followed by second-strand synthesis before library preparation, which utilized Nextera XT reagents (Illumina) and sequencing on the NovaSeq 6000 platform (Illumina). Although originally described as a consensus-level sequencing methodology, the depth of coverage allowed for deep sequencing analysis. Bioinformatics analysis of the data was completed using the previously described pipeline.

Raw reads were filtered and trimmed using fastp (https://github.com/OpenGene/fastp) to remove sequencing adapters and low-quality reads, including those with a quality score of <Q20. Ribosomal RNA and host reads were subtracted through read mapping using the BBMAP program. De novo genome assembly was performed with SPAdes v3.13.0 (Nurk et al., 2013). The extracted assembled scaffolds were limited to a minimum contig length of 100 bases, with the best BLAST hits obtained from the NCBI nt database.

The sequence fragments were assembled and analyzed using DNAStar 7.0 and BioEdit software, respectively. Complete sequences of the S gene and full-length genome reference sequences obtained from GenBank were used for sequence alignment and phylogenetic analyses. Phylogenetic trees were constructed using the neighbor-joining method in MEGA version 6, with bootstrap values calculated for each node from 1,000 replicates. All tree figures were produced using MEGA 4.0 software.

All animals were obtained from a conventional breeding farm with a good health record and no prior history of Porcine Delta Coronavirus (PDCoV) outbreaks; they were confirmed negative for any porcine enteric viruses. Fifteen 3-day-old piglets were randomly assigned to three groups of five and housed in separate rooms. The piglets were fed commercial fresh milk five times daily and had unrestricted access to distilled water throughout the experiment. Before the challenge, rectal swabs confirmed that the piglets were negative for major porcine enteric viruses PEDV, TGEV, PDCoV, SADS CoV, and PoRV via RT-qPCR. The two groups were orally inoculated with either 1 mL of 1 × 10⁶ TCID50 of CHN-ANHZ-2024 or 1 mL of 1 × 10⁶ TCID50 of CHN-JSSQ-2024, the mock infection group was orally inoculated with 1 mL of DMEM. Following inoculation, the piglets were monitored daily for clinical symptoms such as depression, slow movement, diarrhea, vomiting, and anorexia. Rectal swabs were collected daily to monitor fecal viral RNA shedding using quantitative real-time RT-PCR targeting the PDCoV M gene. All surviving pigs were euthanized at the end of the experiment (5 days post-inoculation [dpi]).The clinical significance score (CSS) was assessed using the following criteria for diarrhea severity based on fecal consistency at 5 dpi: 0 = normal with no diarrhea; 1 = soft stool; 2 = mildly fluidic feces; 3 = moderately mucous-to-watery diarrhea; and 4 = severe watery and projectile diarrhea. To evaluate differences in pathogenicity among PDCoV strains during the acute phase of infection, experiments were performed on three piglets per group. Intestinal damage and viral load in intestinal tissues of piglets infected with different strains were assessed. All piglets were euthanized at 3 dpi, and samples from the small intestine, heart, lung, spleen, liver, kidney, brain, and cerebellum were collected and fixed in 4% paraformaldehyde for 48 hours. Fixed samples were subjected to hematoxylin and eosin (H&E) staining or immunohistochemistry (IHC) with a PDCoV N-specific monoclonal antibody.

The RNAscope in situ hybridization (ISH) method for formalin-fixed paraffin-embedded (FFPE) tissues has been previously described (Wang H. et al., 2014). To detect the distribution of Porcine Delta Coronavirus (PDCoV) nucleic acids in intestinal and organ tracts, ISH was performed on FFPE intestinal tissues using the RNAscope^® Multiplex Fluorescent Reagent Kit v2 (Cat. No. 510991, Advanced Cell Diagnostics, Inc, USA), according to the manufacturer’s instructions. Briefly, 20 double Z probe pairs specifically targeting the region coding for the PDCoV nucleocapsid protein were designed and synthesized by ACD. Each probe forms a 28-base hybridization with the targeted RNA, allowing for the preamplifier to contain 20 binding sites for the amplifier. Probes were fluorescently labeled with cyanine 3 for direct visualization under a fluorescence microscope. For tissue processing, the FFPE intestinal tissues were cut into 5-μm-thick sections, and tissue sections on slides were baked in a dry oven at 60°C for 1 hour before being deparaffinized in xylene and dehydrated through an ethanol series. Finally, slides were placed on absorbent paper with the section face up and air-dried for 5 minutes at room temperature (RT). Following this, the sections were treated with several drops of RNAscope Hydrogen Peroxide for 10 minutes at RT and then washed in distilled water 3–5 times. Afterwards, tissue sections were incubated in citrate buffer (10 nmol/L, pH 6) maintained at boiling temperature for 15 minutes. Immediately, the sections were rinsed in deionized water and transferred into 100% alcohol for 3 minutes before drying the slides in a 60°C incubator. Next, tissue sections were treated with 10 μg/mL protease at 40°C for 30 minutes in a HybEZ hybridization oven (ACD) and washed 3–5 times in distilled water. Then, the tissue sections were incubated at 40°C in the following order: target probes for 3 hours; preamplifier for 30 minutes; amplifier for 15 minutes; and label probe for 15 min. For each hybridization step, tissues were rinsed with wash buffer 3 times at RT after treatment. Hybridization signals were detected by TSA^® Plus Cyanine 3 (NEL744E001KT, PerkinElmer). At last, the sections on glass slides were counterstained with 4′,6-diamidino-2-phenylindole (DAPI). The images were captured by a Nikon A1 confocal microscope and processed by image J.

In January 2024, pig farms in Anhui and Jiangsu provinces of China reported cases of diarrhea in piglets. Clinical samples were tested for PEDV, PDCoV, TGEV, SADS-CoV, and PoRV by RT-qPCR. In the Anhui farm, all 33 fecal or intestinal samples were positive for PDCoV (100%), while tests for PEDV, TGEV, SADS-CoV, and PoRV were negative. In this farm, 24 piglets died (73%), subsequently leading to the infection of other piglets, which caused severe diarrhea and death in 134 piglets ( Figures 1A, B ). On the Jiangsu farm, 13 out of 24 fecal or intestinal samples (54%) tested positive for PDCoV, while other diarrhea-related pathogens were negative. The piglets on this farm exhibited only mild diarrhea and vomiting ( Figure 1C ), with no deaths recorded.

After grinding, centrifuging, and filtering intestinal tissues from PDCoV-positive piglets, the supernatant of two PDCoV-positive samples was diluted and used for the inoculation of LLC-PK cells, which were then passaged. Two PDCoV strains were successfully isolated, designated PDCoV CHN-ANHZ-2024 and CHN-JSSQ-2024. In LLC-PK cells, the cytopathic effects (CPE) of PDCoV manifested as cell aggregation and rounding, resulting in cell death within 24–36 hours post-infection ( Figures 2F–N ). Uninfected control cells ( Figures 2A–D ) remained flat and adherent to the culture plate. At 24 hours post-infection, the immunofluorescence assay (IFA) detected the PDCoV N protein in both CHN-ANHZ-2024 and CHN-JSSQ-2024. As shown in Figure 2E , no fluorescence was observed in uninfected control cells, while green fluorescence, corresponding to viral presence, was observed in cells infected with CHN-ANHZ-2024 and CHN-JSSQ-2024 ( Figure 2J ) and CHN-JSSQ-2024 ( Figure 2O ). Electron microscopy (EM) revealed the morphology and size of CHN-ANHZ-2024 and CHN-JSSQ-2024 virus particles purified from infected LLC-PK cells. Using negative staining, typical coronavirus-like virions with spike projections and diameters of 80–150 nm were observed under EM ( Figures 3A, B ). These results confirm the successful isolation of two PDCoV strains from the samples.

Sequence analysis revealed that CHN-ANHZ-2024 and CHN-JSSQ-2024 are part of the Chinese lineage of PDCoV strains ( Figure 4A ). Compared with other reported Chinese PDCoV strains, the S genes of CHN-ANHZ-2024 and CHN-JSSQ-2024 harbor several novel mutations. Specifically, nine nucleotide substitutions were identified within the S genes of both strains ( Figure 4C ). To investigate the genetic characteristics of CHN-ANHZ-2024 and CHN-JSSQ-2024, these strains, along with other reference strains, were analyzed using the Recombination Detection Program version 4.9.4 (RDP4) for evidence of genetic recombination. As shown in Figure 4A , no evidence of recombination was detected in CHN-ANHZ-2024. In contrast, CHN-JSSQ-2024 emerged as a result of recombination involving strain DH1 as the major parent and CHN-ANHZ-2024 as the minor parent, with recombination breakpoints mapped to positions 1971 (start) and 3421 (end) ( Figure 4B ). These findings suggest that CHN-JSSQ-2024 resulted from a natural recombination event between the DH1 and CHN-ANHZ-2024 strains.

To evaluate the pathogenicity of the isolated PDCoV strains CHN-ANHZ-2024 and CHN-JSSQ-2024, 15 piglets were randomly assigned to three groups of five and housed separately. The piglets were orally inoculated with either CHN-ANHZ-2024 or CHN-JSSQ-2024 at 1 mL of 1×10⁶ TCID50 per piglet, while the control group orally inoculated with 1 mL of DMEM. Piglets infected with CHN-ANHZ-2024 manifested acute watery diarrhea, vomiting, and severe dehydration ( Figure 5A ). In contrast, those infected with CHN-JSSQ-2024 displayed only mild diarrhea and slight dehydration ( Figure 5A ). By day 7, the survival rate for CHN-ANHZ-2024-infected piglets was 20%, whereas the survival rate of infected with CHN-JSSQ-2024 was 100% ( Figure 5D ). Viral RNA was measured by qRT-PCR in fecal swabs collected from day 1 to day 7, with CHN-ANHZ-2024 showing consistently higher viral loads than CHN-JSSQ-2024. No viral RNA was detected in the control group ( Figure 5B ). Post-infection, PDCoV were found in the duodenum, jejunum, and ileum of the infected piglets. Notably, CHN-ANHZ-2024 was also present in the brain, cerebellum, and kidneys, whereas CHN-JSSQ-2024 was localized primarily in the lungs ( Figure 5C ). These findings suggest that CHN-ANHZ-2024 is highly pathogenic, causing severe watery diarrhea and high mortality, while CHN-JSSQ-2024 induces only mild symptoms without mortality. Additionally, the two strains exhibit distinct organ tropism: CHN-ANHZ-2024 primarily targets the brain, cerebellum, and kidneys, while CHN-JSSQ-2024 predominantly infects the lungs.

To detect histological changes in piglets infected with the PDCoV CHN-ANHZ-2024 and CHN-JSSQ-2024 strains, necropsies were conducted on all piglets on day 3. In the MOCK group, the villi structures of the duodenum, jejunum, and ileum were intact and well-developed ( Figures 6A–C ). In the CHN-JSSQ-2024 group, the duodenum remained structurally intact, exhibiting slight hemorrhaging in the lamina propria and submucosa without any inflammatory response; the lamina propria of the jejunal villi displayed severe edema, while the ileal villi were well-developed, with no abnormal pathological changes noted ( Figures 6D–F ). In the CHN-AHHN-2024 group, the lamina propria of the duodenal villi exhibited edema, accompanied by mild dilation of the central lacteal; the jejunal villi demonstrated severe underdevelopment, and significant lymphocyte loss was noted in the ileal submucosa ( Figures 6G–I ). The lungs of the MOCK, CHN-JSSQ-2024, and CHN-AHHN-2024 groups exhibited a normal morphological structure without abnormal pathological changes ( Figures 7A, E, I ). The kidney tissues of the MOCK and CHN-JSSQ-2024 groups exhibited no abnormal pathological changes ( Figures 7B, F ). However, in the CHN-AHHN-2024 group, mild fibrosis was noted in the renal corpuscles, accompanied by degeneration and necrosis of renal tubular epithelial cells, along with the presence of hyaline casts ( Figure 7J ). The brain tissues of the MOCK and CHN-JSSQ-2024 groups appeared normal without any abnormal pathological changes ( Figures 7C, D, G, H ). In the CHN-AHHN-2024 group, inflammatory cell infiltration around the blood vessels in the cerebral cortex and the formation of small glial nodules, accompanied by a slight accumulation of glial cells, were noted ( Figures 7K, L ).

No positive signals were observed in the duodenum, jejunum, and ileum of the mock group ( Figures 8A–C ). Positive signals were detected in the epithelial cells of the duodenal, jejunal, and ileal villi in the CHN-JSSQ-2024 group( Figures 8D–F ). A substantial number of positive signals were noted in the epithelial cells, lamina propria, and submucosa of the duodenum, jejunum, and ileum in the CHN-AHHN-2024 group( Figures 8G–I ). In the CHN-JSSQ-2024 group, positive signals were primarily localized in the alveolar epithelial cells of the lungs ( Figure 9E ). No positive signals were detected in the kidneys ( Figure 9F ), brain ( Figure 9G ), and cerebellum ( Figure 9H ). In the CHN-ANHZ-2024 group, positive signals were detected in the renal interstitial cells ( Figure 9J ), while no positive signals were observed in the lungs ( Figure 9I ), brain ( Figure 9K ) and cerebellum ( Figure 9L ). In the mock group, no positive signals were detected in the lungs ( Figure 9A ), kidneys ( Figure 9B ), brain ( Figure 9C ), and cerebellum ( Figure 9D ).

RNA scope, a new technology for in situ RNA hybridization, was used to detect PDCoV nucleic acids in situ in piglet. Positive signals were detected in the villi of the duodenum, jejunum, and ileum of piglets infected with PDCoV-CHN-AHHN-2024 ( Figures 10G–I ) and CHN-JSSQ-2024 ( Figures 10D–F ). No positive signals were observed in the intestines of the mock group ( Figures 10A–C ). Viral RNA was detected in the brains, cerebella, and kidneys of piglets infected with the CHN-ANHZ-2024 strain ( Figures 11I, J, L ). In piglets infected with the CHN-JSSQ-2024 strain, viral RNA was detected in the lungs ( Figure 11G ). No viral RNA was detected in the control group and the untested positive organs ( Figures 11A–F, H, K ). In summary, PDCoV-CHN-ANHZ-2024 and CHN-JSSQ-2024 can cause intestinal lesions in three-day-old piglets. Viral RNA from PDCoV-CHN-ANHZ-2024 was primarily detected in the brain and kidneys, whereas PDCoV-CHN-JSSQ-2024 was primarily localized in the lungs.