<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2024.1486426</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Viable but nonculturable state in the zoonotic pathogen <italic>Bartonella henselae</italic> induced by low-grade fever temperature and antibiotic treatment</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Gou</surname>
<given-names>Yuze</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2252560"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Dongxia</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xin</surname>
<given-names>Yuxian</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1940360"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Ting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Jiaxin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xi</surname>
<given-names>Yiwen</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zheng</surname>
<given-names>Xiaoling</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Che</surname>
<given-names>Tuanjie</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2047308"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Ying</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Tingting</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/983746"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Feng</surname>
<given-names>Jie</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/387165"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Key Laboratory of Preclinical Study for New Drugs of Gansu Province, School of Basic Medical Sciences, Lanzhou University</institution>, <addr-line>Lanzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>State Key Laboratory of Veterinary Etiological Biology, College of Veterinary Medicine, Lanzhou University</institution>, <addr-line>Lanzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Scientific Experimental Research, Innovation Center of Functional Genomics and Molecular Diagnostics Technology of Gansu Province</institution>, <addr-line>Lanzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>State Key Laboratory for the Diagnosis and Treatment of Infectious Diseases, The First Affiliated Hospital, Zhejiang University School of Medicine</institution>, <addr-line>Hangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Center for Microbiome and Disease Research, Jinan Microecological Biomedicine Shandong Laboratory</institution>, <addr-line>Jinan</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Deepak Kumar, University of Southern Mississippi, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Max Maurin, Centre Hospitalier Universitaire de Grenoble, France</p>
<p>Surendra Raj Sharma, University of North Carolina at Chapel Hill, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Jie Feng, <email xlink:href="mailto:jfeng@lzu.edu.cn">jfeng@lzu.edu.cn</email>; Tingting Li, <email xlink:href="mailto:litt@lzu.edu.cn">litt@lzu.edu.cn</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>21</day>
<month>11</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>14</volume>
<elocation-id>1486426</elocation-id>
<history>
<date date-type="received">
<day>26</day>
<month>08</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>21</day>
<month>10</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Gou, Liu, Xin, Wang, Li, Xi, Zheng, Che, Zhang, Li and Feng</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Gou, Liu, Xin, Wang, Li, Xi, Zheng, Che, Zhang, Li and Feng</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The zoonotic pathogen <italic>Bartonella henselae</italic> is responsible for diverse human diseases, from mild to life-threatening, but it often eludes detection in culture-based assays. This study investigates the potential of <italic>B. henselae</italic> to enter a viable but nonculturable (VBNC) state when exposed to human fever temperature or antibiotics, with this state confirmed by successful resuscitation. Viability was assessed using SYBR Green I/PI staining and propidium monoazide&#x2013;quantitative polymerase chain reaction (PMA-qPCR), while culturability was determined through colony-forming unit (CFU) counting on blood agar plates. Resuscitation of VBNC cells was attempted using modified Schneider&#x2019;s medium with 10% defibrillated sheep blood. In the results, <italic>B. henselae</italic> cells entered a VBNC state after 19 days of exposure to 38.8&#xb0;C. Antibiotics, particularly with bactericidal activity, induced the VBNC state within 4 days treatment. Successful resuscitation confirmed the VBNC state developed via the above two strategies. Transmission electron microscopy (TEM) examination revealed intact cell structures and dense cytosol in VBNC cells, with a significant increase in plasmolytic cells. Notably, VBNC cells demonstrated greater drug tolerance than cells in the stationary phase, which encompassed a substantial portion of persisters. Proteomic analysis revealed the up-regulation of proteins linked to host cell invasion and stress resistance, while proteins related to signaling and cellular processes were down-regulated. Fluorescence <italic>in situ</italic> hybridization (FISH) analysis confirmed that the VBNC state truly boosted <italic>B. henselae</italic>&#x2019;s invasion of HUVECs. This study highlights <italic>B. henselae</italic>&#x2019;s capacity to enter a VBNC state under thermal and antibiotic stress, emphasizing the urgent need for advanced diagnostic and therapeutic strategies to effectively target VBNC cells, which complicate diagnosis and treatment.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Bartonella</italic>
</kwd>
<kwd>
<italic>B. henselae</italic>
</kwd>
<kwd>VBNC</kwd>
<kwd>resuscitation</kwd>
<kwd>persister</kwd>
<kwd>blood-culture-negative endocarditis (BCNE)</kwd>
<kwd>cat-scratch disease (CSD)</kwd>
</kwd-group>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences<named-content content-type="fundref-id">10.13039/501100011135</named-content>
</contract-sponsor>
<counts>
<fig-count count="4"/>
<table-count count="0"/>
<equation-count count="0"/>
<ref-count count="46"/>
<page-count count="11"/>
<word-count count="5632"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Molecular Bacterial Pathogenesis</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Bartonellae are fastidious vector-borne Gram-negative bacteria responsible for multiple human diseases (<xref ref-type="bibr" rid="B14">Jin et&#xa0;al., 2023</xref>). The predominant Bartonelloses in humans are primarily attributed to <italic>Bartonella henselae</italic>, <italic>Bartonella bacilliformis</italic>, and <italic>Bartonella quintana</italic>. Infection with <italic>B. henselae</italic> can result in the prototypical cat-scratch disease (CSD), characterized by fever and regional lymphadenopathy, primarily affecting immunocompromised individuals and occasionally immunocompetent individuals, especially children and adolescents (<xref ref-type="bibr" rid="B35">Pulliainen and Dehio, 2012</xref>). In severe cases, <italic>B. henselae</italic> can lead to bacillary angiomatosis, a condition marked by vasoproliferative tumors affecting the skin and internal organs (<xref ref-type="bibr" rid="B35">Pulliainen and Dehio, 2012</xref>). Additionally, a broad spectrum of manifestations has been reported in association with persistent infection of <italic>B. henselae</italic>, including asymptomatic bacteremia, which is a distinctive characteristic of <italic>Bartonella</italic> (<xref ref-type="bibr" rid="B28">Massei et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B4">Breitschwerdt et&#xa0;al., 2008</xref>). The prevalence of <italic>B. henselae</italic> infection is worldwide, with a seroprevalence in China of up to 9.68% (<xref ref-type="bibr" rid="B43">Song Xiu et&#xa0;al., 2020</xref>). In the United States, there are estimated 12,500 cases of CSD annually, with the proportion of hospitalized CSD patients increasing from 3.5% in 2005&#x2013;2007 to 4.2% in 2011&#x2013;2013 (<xref ref-type="bibr" rid="B29">Nelson et&#xa0;al., 2016</xref>). Despite the prevalence, diagnosing <italic>B. henselae</italic> infections remains challenging. Antibody-based serological assays are widely applied for diagnosing <italic>B. henselae</italic> infection. However, these assays present several limitations, including cross-reactivity with other species and organisms, variability in antigen preparations, cutoff titers, and other factors (<xref ref-type="bibr" rid="B20">La Scola and Raoult, 1996</xref>; <xref ref-type="bibr" rid="B28">Massei et&#xa0;al., 2004</xref>).</p>
<p>Traditional diagnostic methods based on bacterial cultivation (<xref ref-type="bibr" rid="B10">Drummond et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B18">Koutantou et&#xa0;al., 2023</xref>), often face challenges due to the fastidious nature of <italic>B. henselae</italic>, which is difficult to culture and detect. This limitation can result in diagnostic difficulties, as in blood-culture-negative endocarditis (BCNE) (<xref ref-type="bibr" rid="B31">Okaro et&#xa0;al., 2017</xref>). While molecular techniques offer higher detection rates (<xref ref-type="bibr" rid="B33">Prudent et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B38">Sayed et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B18">Koutantou et&#xa0;al., 2023</xref>), they do not confirm the presence of live bacterial cells. Despite the well-established causative relationship between <italic>B. henselae</italic> and certain diseases, the difficulty of isolating <italic>B. henselae</italic> from some infected hosts, combined with the limitations of molecular detection methods, means that these techniques alone cannot fully satisfy Koch&#x2019;s postulates. This difficulty underscores the importance of microbial culture, still considered the gold standard for detecting infectious pathogens. Higher recovery rates from clinical specimens have been achieved by the shell-vial technique, which involves the inoculation of clinical specimens onto confluent cell monolayers on coverslips within shell vials, followed by low-speed centrifugation to enhance bacterial attachment and penetration, with subsequent detection via immunofluorescence, and definitive bacterial identification by PCR (<xref ref-type="bibr" rid="B19">Lagier et&#xa0;al., 2015</xref>). In a study of endocarditis patients suspected of <italic>Bartonella</italic> spp. infection, the recovery rate was 44% using a shell vial culture assay, compared to only 4% when directly culturing on Columbia sheep blood agar plates (<xref ref-type="bibr" rid="B21">La Scola and Raoult, 1999</xref>). The improved sensitivity for recovering <italic>Bartonella</italic> isolates by shell-vial culture methods suggests that certain factors in the subculture system are essential for the growth of some <italic>Bartonella</italic> isolates, which may enter a viable but nonculturable (VBNC) state and have the potential to revert to a culturable state under appropriate conditions.</p>
<p>The VBNC state is a survival strategy employed by various bacterial species, allowing them to maintain cellular integrity and metabolic activity while remaining undetectable by standard culturing methods (<xref ref-type="bibr" rid="B25">Liu et&#xa0;al., 2023</xref>). VBNC bacteria can resuscitate under favorable conditions, potentially leading to recurrent infections and complicating treatment. For example, VBNC <italic>Listeria monocytogenes</italic> can resuscitate and cause listeriosis in vulnerable populations (<xref ref-type="bibr" rid="B26">Lotoux et&#xa0;al., 2022</xref>). VBNC cells also exhibit resistance to antibiotics and immune stress (<xref ref-type="bibr" rid="B2">Ayrapetyan et&#xa0;al., 2015b</xref>), contributing to persistent infections. The persistence of VBNC pathogens in hosts, especially intracellular pathogens like <italic>Bartonella</italic>, poses significant challenges for accurate diagnosis and risk assessment in clinical settings.</p>
<p>Given these challenges, this study aimed to determine whether <italic>B. henselae</italic> can enter a VBNC state and to characterize these cells in detail. We induced the VBNC state in <italic>B. henselae</italic> using high temperature and antibiotic treatment, mimicking conditions like fever and antimicrobial exposure, and developed a method for resuscitating <italic>B. henselae</italic> VBNC cells, which could greatly improve the diagnosis, detection, and treatment of bartonellosis.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Bacterial strain and culture conditions</title>
<p>
<italic>Bartonella henselae</italic> strain Houston-1 (ATCC 49882) was cultured in a modified Schneider&#x2019;s medium (<xref ref-type="bibr" rid="B36">Riess et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B23">Li et&#xa0;al., 2019</xref>). Briefly, 10 mL modified Schneider&#x2019;s medium was composed of 8 mL Schneider&#x2019;s drosophila medium (Gibco, USA), 1 mL heat-inactivated fetal bovine serum (VivaCell, China), and 1 mL 50% sucrose solution. Cultures were incubated at 33&#xb0;C without shaking. Colony forming units (CFU) were counted after serial 10-fold dilutions on Columbia blood agar plates with 5% defibrinated sheep blood, followed by incubation at 33&#xb0;C.</p>
</sec>
<sec id="s2_2">
<title>Quantification of live <italic>B. henselae</italic> cells via SYBR Green I/PI assay</title>
<p>The viability of <italic>B. henselae</italic> was evaluated using a SYBR Green I/propidium iodide (PI) staining method (<xref ref-type="bibr" rid="B11">Feng et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B23">Li et&#xa0;al., 2019</xref>). Bacterial samples were stained with SYBR Green I (Invitrogen, USA) and PI (Solarbio, China), incubated in darkness at room temperature (RT) for 30 minutes, and counted under an IX71 inverted microscope (Olympus, Japan). Dead cells, marked by red fluorescence emitted from PI, were distinguished from live cells, which exhibited green fluorescence due to SYBR Green I binding.</p>
<p>For plate reader analysis, standard samples were prepared by mixing live and 70% isopropanol-killed bacteria in varying ratios. Both these standards and culture samples were stained with SYBR Green I/PI, incubated at RT in darkness for 30 minutes, and analyzed using a fluorescence plate reader. Green and red fluorescence intensities were measured using a fluorescence plate reader (Thermo Fisher Scientific, USA). The percentage of viable <italic>B. henselae</italic> cells in each sample was calculated based on the ratios of green to red fluorescence intensities, providing a quantitative assessment of cell viability under various experimental conditions.</p>
</sec>
<sec id="s2_3">
<title>Quantification via PMA-qPCR</title>
<p>Live <italic>B. henselae</italic> cells were quantified using the PMA-qPCR method, following a previously described protocol (<xref ref-type="bibr" rid="B22">Lazou et&#xa0;al., 2019</xref>). Briefly, 990 &#x3bc;L aliquots of bacterial cultures were added with 10 &#x3bc;L propidium monoazide (PMA) (Bioscience, China) in Eppendorf tubes and kept at RT for 10 min in darkness with occasional mixing. Samples were then exposed to light for 15 min, followed by centrifugation at 10,000 g for 5 min. DNA was extracted from the cell pellets using QIAamp DNA Mini Kit (Qiagen, Germany). For the calibration standard curve preparation, mixtures of live and 3% H<sub>2</sub>O<sub>2</sub>-killed bacteria were prepared to create five different ratios of viable cells. These mixtures were treated in parallel with the samples described above. The extracted DNA from each sample, including standards and samples, was mixed with Hieff UNICON Universal Blue qPCR SYBR Green Master Mix (YEASEN, China) and specific primers (Bhe-16s-qF AATCTTGCGACCGTACTCCC, Bhe-16s-qR TCCACGCCGTAAACGATGAA) targeting the <italic>B. henselae</italic> 16S rRNA gene. Quantitative PCR was performed on a QuantStudio (Applied Biosystems). Live <italic>B. henselae</italic> cells were quantified using a PMA-qPCR method (<xref ref-type="bibr" rid="B22">Lazou et&#xa0;al., 2019</xref>). The PMA inhibition factor was calculated using the formula 2^(Ct(PMA treated)-Ct(PMA untreated)), and the viability percentage was determined by 100/(PMA inhibition factor) and calibrated using the standard calibration curve.</p>
</sec>
<sec id="s2_4">
<title>Induction of VBNC cells</title>
<p>VBNC cells were induced by two methods: culture under fever-like temperature (38.8&#xb0;C) up to 25 days and treatment with antibiotics at 37&#xb0;C. The antibiotics tested included gentamicin (15 &#x3bc;g/mL), streptomycin (43 &#x3bc;g/mL), doxycycline (7 &#x3bc;g/mL) and erythromycin (1.44 &#x3bc;g/mL). Cultures were periodically sampled to assess viability and culturability. The drugs were prepared according to the manual of clinical and laboratory standards institute (CLSI) and sterilized with a 0.22 &#x3bc;m filter. Methylene blue was dissolved in DMSO.</p>
</sec>
<sec id="s2_5">
<title>Resuscitation of <italic>B. henselae</italic> from the VBNC state</title>
<p>Cultures of <italic>B. henselae</italic> cells in the VBNC state-inducing course were periodically drawn. Samples were then divided into two aliquots. One aliquot from each sample was directly deposited onto blood agar plates, and the second aliquot underwent a resuscitation process. For the aliquot dropped on the blood agar plate, drug removal and resuspension were required for antibiotic-induced VBNC cells in the culture. For the resuscitation, cells were collected by centrifugation (5000&#xd7;g, 5 min), resuspended in the modified Schneider&#x2019;s medium supplemented with 10% defibrinated sheep blood, and incubated at 33&#xb0;C for 1 day, followed by plating on Columbia blood agar plate. The successful resuscitation of <italic>B. henselae</italic> in pure VBNC state was achieved when the aliquot gone through resuscitation displayed colonies but the parallel aliquot directly deposited on blood agar plates failed to do so.</p>
</sec>
<sec id="s2_6">
<title>Transmission electron microscopy</title>
<p>Bacterial cells were pelleted and fixed with 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer. After that, the cells were suspended in 2% agarose and cut into cubes. Then, samples were washed and resuspended in 0.1 M sodium cacodylate buffer, and fixed in osmium tetroxide. After staining, samples were washed, dehydrated, and soaked in acetone, followed by immersion in 3:1 acetone: epoxy resin, 1:1 acetone: epoxy resin and pure epoxy resin overnight. Finally, samples were cut into ultrathin sections, stained with uranyl acetate and lead citrate, and visualized with a Hitachi HT7700 transmission electron microscope. Cell size and shape were analyzed using Fiji software (<xref ref-type="bibr" rid="B39">Schindelin et&#xa0;al., 2012</xref>).</p>
</sec>
<sec id="s2_7">
<title>DIA (data-independent acquisition) proteomic analysis by LC-MS/MS</title>
<p>
<italic>B. henselae</italic> cells were pelleted by centrifugation and washed with PBS to remove residual culture medium. Cell pellets were resuspended in lysis buffer composed of 4% SDS, 100 mM DTT, and 100 mM Tris-HCl (pH 8.0), boiled for 3 min, and were then ultrasonicated, with insoluble cellular debris removed after centrifugation at 16,000 g for 15 min. The resultant clear supernatant was then assayed for protein concentration using the BCA Protein Assay Kit (BeyoTime, China). Protein digestion was conducted by adopting the Filter-Aided Sample Preparation (FASP) technique. LC-MS/MS analyses were performed with an Orbitrap Astral mass spectrometer linked to a Vanquish Neo UHPLC system. Peptides were loaded into a Low-Load &#xb5;PAC&#x2122; Neo HPLC Column (Thermo Scientific). The mobile phase consisted of (A) water with 0.1% formic acid, and (B) 80% acetonitrile with 0.1% formic acid. We used a DIA method that included a survey scan from 380-980 m/z at resolution 240000 with AGC target of 500% and 5 ms injection time. The energy and timing for the scans were precisely controlled, and the resulting spectra were recorded in two different formats. The DIA MS/MS scans were acquired by Astral from 150-2000 m/z with 2 m/z isolation window and with AGC target of 500% and 3 ms injection time. The spectra of full MS scan and DIA scan were recorded in profile and centroid type, respectively. Data were analyzed using the DIA-NN 1.8.1 (<xref ref-type="bibr" rid="B7">Demichev et&#xa0;al., 2020</xref>), and underwent a database search against the GenBank database, specifically targeting the NCBI for <italic>B. henselae</italic> Houston-1 sequence (NC_005956). Results from the database search were refined to ensure a false discovery rate of less than 1% at both the peptide-spectrum match and protein levels. Gene ontology enrichment analysis, heat map figure and volcano figure were executed by using KEGG database (<xref ref-type="bibr" rid="B15">Kanehisa et&#xa0;al., 2017</xref>) and statistical language R with ggplot2, pheatmap and EnhencedVolcano packages.</p>
</sec>
<sec id="s2_8">
<title>Fluorescence <italic>in situ</italic> hybridization of HUVECs</title>
<p>Prior to infection, log-phase <italic>B. henselae</italic> cultured at 33&#xb0;C and <italic>B. henselae</italic> VBNC induced by culturing at 38.8&#xb0;C for 19 days were washed twice with PBS and resuspended in DMEM (F12) medium. Human umbilical vein endothelial cells (HUVECs, CCTCC GDC0635) were washed twice with PBS before being infected with a multiplicity of infection (MOI) of 100 of <italic>B. henselae</italic> either in logarithmic phase or in VBNC state. The plates were centrifuged at 1800 g for 5 min and then incubated in 5% CO<sub>2</sub> at 37&#xb0;C or 38.8&#xb0;C. At various post-infection time points, the plates were washed thoroughly with PBS and fixed with 4% paraformaldehyde for 2 h. Following fixation, cells were washed three times with PBS, and then treated with PBS containing 0.1% Triton X-100 for 10 min to permeabilize the cell membrane. Cells were then dehydrated in 50%, 80%, and 100% ethanol, respectively, and hybridized overnight with the BA23 probe (5&#x2019;-6-FAM-CTATCACCCTCTTTGGTTCG-3&#x2019;) in hybridization buffer (900 mM NaCl, 20% formamide, 0.01% SDS, 20 mM Tris, pH8.0) (<xref ref-type="bibr" rid="B34">Prudent et&#xa0;al., 2017</xref>). After hybridization, the cells were washed with washing buffer (0.225 M NaCl, 5 mM EDTA, 0.01% SDS, pH 8.0) and then stained with DAPI for 3 min. Following three washes with ddH<sub>2</sub>O, coverslips were sealed and examined using a Zeiss LZM 900 confocal laser scanning microscope.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>VBNC formation at elevated temperature</title>
<p>We investigated the impact of temperature on the formation of VBNC cells by assessing cell viability and culturability of <italic>B. henselae</italic> at 38.8&#xb0;C and 33&#xb0;C. Culturable cells were determined by CFU counting on blood agar plates, while viable cells were evaluated using SYBR Green I/PI staining and/or PMA-qPCR. The viability measurements from these methods showed a strong linear relationship (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S1</bold>
</xref>). At 33&#xb0;C, <italic>B. henselae</italic> cells remained viable from the 2-day logarithmic phase to the 19-day late-stationary phase. However, culturability significantly declined, from 77.3% in 2-day cultures to 1.8% in 19-day cultures (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>), indicating VBNC cell formation. At 38.8&#xb0;C, approximately 20%-30% of the cells remained viable after 19 days, but no colonies formed on blood agar plates (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>), suggesting that the entire population of viable cells had entered a VBNC state.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Temperature effect on the formation of <italic>B. henselae</italic> VBNC cells. <bold>(A)</bold> Evaluation of culturability and viability for <italic>B. henselae</italic> cells cultured at 33&#xb0;C and 38.8&#xb0;C, respectively. Culturable cells were monitored by CFU counting, whereas viable cell counting were monitored by SYBR Green I/PI assay and PMA-qPCR assay. The CFU-based viability for each sample was determined by dividing the CFU count by the total cell count observed under the microscope. Similarly, the SYBR Green I/PI-based viability was calculated by dividing the count of green-stained (live) cells by the total cell count under the microscope. For the PMA-qPCR assay, viability was calculated based on the PMA inhibition factor and calibrated by the calibration curve. <bold>(B)</bold> The entry of VBNC state at 33&#xb0;C and 38.8&#xb0;C were monitored over time. The arrows and dash lines represent the resuscitation for 18-day-cultured and 19-day-cultured VBNC bacteria at 38.8&#xb0;C. All tests were run in triplicates, and all data are averages of biological triplicates &#xb1; standard deviation.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1486426-g001.tif"/>
</fig>
<p>Overtime, at 33&#xb0;C, viable and culturable cells were initially comparable, but culturable cells declined markedly by 18- and 19-day, confirming VBNC cell presence. At 38.8&#xb0;C, viable cells remained relatively constant, but no culturable cells were detected by 18- and 19-day, confirming a pure VBNC state. Resuscitation experiments demonstrated that <italic>B. henselae</italic> could recover from the VBNC state (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
</sec>
<sec id="s3_2">
<title>Morphological and physiological changes in <italic>B. henselae</italic> VBNC cells</title>
<p>Bacteria typically undergo a series of changes in morphological structure and physiological characteristics upon entering the VBNC state. In this study, TEM was utilized to observe the morphological adjustments and intracellular content changes in <italic>B. henselae</italic> cells in the VBNC state. We observed that VBNC cells maintained intact cell walls, membranes and abundant intracellular content, with no significant changes in shape or size (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;C</bold>
</xref>). However, many VBNC cells exhibited plasmolysis (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, D</bold>
</xref>), a morphological abnormality characterized by the cell membrane shrinking away from the cell wall, especially when compared to cells in the logarithmic and stationary phases. The intracellular contents in plasmolytic VBNC cells appeared to be more intensely condensed relative to those in cells from the other two cultures, with a pronounced separation between the cell membrane and the cell wall. These observations suggest that while <italic>B. henselae</italic> VBNC cells retain their overall structural integrity they undergo significant intracellular condensation and membrane detachment, indicative of a stress response and metabolic adjustment characteristic of the VBNC state.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Comparison of morphology and drug tolerance of <italic>B. henselae</italic> cells across different states. <bold>(A)</bold> TEM images show the morphology of <italic>B. henselae</italic> in the logarithmic phase (LOG), stationary phase (STA), and VBNC state, with a scale bar of 0.5 &#x3bc;m. ImageJ software was used to analyze bacterial cell size <bold>(B)</bold>, shape <bold>(C)</bold> and the percentage of plasmolysis <bold>(D)</bold>. <bold>(E)</bold> The percentage of viable cells in the population after drug exposure. <italic>B. henselae</italic> cells were separately treated for 10 days with different drugs, including clinically used (ampicillin, doxycycline, ofloxacin, gentamicin, erythromycin) and anti-persister drugs (daptomycin, methylene blue). Over 15-fold MIC for each antibiotic (100 &#xb5;g/mL) was used to sort out persisters from bacterial populations in cultures. Viable cells were quantified using SYBR Green I/PI staining combined with a plate reader assay. <bold>(F)</bold> The formation of <italic>B. henselae</italic> persisters was monitored over time at 38.8&#xb0;C and 33&#xb0;C. Statistical significance between groups was assessed using <italic>t-</italic>tests, with significant differences indicated by asterisks (*P &lt;0.05; **P &lt;0.01; ***P &lt;0.001).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1486426-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Drug tolerance of <italic>B. henselae</italic> VBNC cells</title>
<p>VBNC cells of various bacterial species exhibit robust competence in surviving antibiotics of multiple classes. We compared the drug susceptibility of VBNC cells cultured at 38.8&#xb0;C for 19 days with cells cultured at 33&#xb0;C for 19 days. VBNC cells showed significant tolerance to multiple antibiotics, especially anti-persister drugs like daptomycin and methylene blue (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>). Meanwhile, the corresponding MIC values for the resuscitated VBNC cells were identical to those of logarithmic-phase cells (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>), consistent with previous suggestion that VBNC cells are part of drug-tolerant persisters, not drug-resistant mutants (<xref ref-type="bibr" rid="B45">Zhang, 2014</xref>; <xref ref-type="bibr" rid="B1">Ayrapetyan et&#xa0;al., 2015a</xref>). Notably, over 80% of <italic>B. henselae</italic> cells at 38.8&#xb0;C developed multi-drug tolerance within just 5 days&#x2019; culture, while cells at 33&#xb0;C took 10 days to reach similar levels (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>). The enhanced development of drug-tolerant VBNC cells of <italic>B. henselae</italic> at elevated temperatures poses a significant treatment challenge, particularly under febrile conditions.</p>
</sec>
<sec id="s3_4">
<title>Antibiotic-induced VBNC state in <italic>B. henselae</italic>
</title>
<p>To explore if antibiotics could also induce VBNC states, we treated <italic>B. henselae</italic> cultures with several clinically used antibiotics at their maximum serum concentrations, defined as the highest concentrations achievable in human serum following administration. Treatment with gentamicin and streptomycin for 4 days led to a slight decrease of viable cells and undetectable levels of culturable cells (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), which indicates that <italic>B. henselae</italic> fully transitioned into the VBNC state, as confirmed by successful resuscitation. In contrast, doxycycline and erythromycin led to only a partial transition to the VBNC state after 7 days (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>), indicating that bactericidal antibiotics (gentamicin and streptomycin) are more effective in inducing the VBNC state than bacteriostatic agents.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Antibiotic induction of <italic>B. henselae</italic> into the VBNC state. The culturability and the viability curve of <italic>B. henselae</italic> treated with bacteriocidal antibiotics <bold>(A)</bold> and bacteriostatic antibiotics <bold>(B)</bold> at 37&#xb0;C. The arrows and dash lines represent the resuscitation of VBNC cells. The culturable cells and viable cells were monitored by CFU and SYBR Green I/PI assay, respectively. All tests were run in triplicates, and all data are averages of biological triplicates &#xb1; standard deviation. GEN, gentamicin; STR, streptomycin; DOX, doxycycline; ERY, erythromycin.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1486426-g003.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Divergent proteomic profiles between VBNC and culturable <italic>B. henselae</italic> cells</title>
<p>To understand the molecular mechanisms governing the VBNC state, we conducted a comparative proteomic analysis between VBNC cells and late-stationary-phase cells. The datasets have been deposited to the iProX partner repository (<xref ref-type="bibr" rid="B5">Chen et&#xa0;al., 2022</xref>) with the identifier PXD055316. Out of 1230 identified proteins, 217 showed significant differential expression (<italic>p</italic>-value &lt; 0.05). Of these, 104 proteins were up-regulated (FC &gt;= 1.5), with 63 exhibiting FC values exceeding 2.0, while 113 were down-regulated (FC &lt;= 0.67), with 45 falling below 0.5 (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>). Particularly, up-regulated expression of HecB/FhaC family proteins (BH07920, BH06540 and BH06660), filamentous hemagglutinin (FhaB1), the hemin-binding protein (BH02570), TrwL/J, VirB, invasion-associated locus B (IalB), BafA, and superoxide dismutase (SOD) was observed. <italic>B. henselae</italic> VBNC cells also up-regulated molecular chaperones and heat shock proteins, including GroES (HSP10 family), GroEL (HSP60 family), DnaK (HSP70 family), and IbpA (HSP20 family).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Differential protein expression in <italic>B. henselae</italic> VBNC cells and their ability to invade HUVECs. <bold>(A)</bold> Comparison of protein expression in VBNC cells <italic>vs</italic>. late-stationary-phase cells. A volcano plot showes significant protein expression changes in VBNC cells (<italic>p</italic>-value &lt; 0.05, log<sub>2</sub>FC &#x2265; 1 or log<sub>2</sub>FC &#x2264; -1) marked in red. Other proteins with less pronounced changes are shown in green (log<sub>2</sub>FC &#x2265; 1 or log<sub>2</sub>FC &#x2264; -1, but <italic>p</italic>-value &#x2265; 0.05) and blue (<italic>p</italic>-value &lt; 0.05, but log<sub>2</sub>FC between -1 and 1). Protein label abbreviations: HP, hypothetical protein; PhP, phage protein. <bold>(B)</bold> A bar chart depicts the enrichment of Gene Ontology terms among significantly altered proteins (<italic>p</italic>-value &lt; 0.05, log<sub>2</sub>FC &#x2265; 1 or log<sub>2</sub>FC &#x2264; -1), categorized by KEGG pathways and visualized using R ggplot2 boxplots. For <bold>(A, B)</bold>, VBNC cells were confirmed through a resuscitation assay after 19 days of incubation at 38.8&#xb0;C, with the control group of <italic>B. henselae</italic> cells cultured at 33&#xb0;C for 19 days. <bold>(C)</bold> The invasion of HUVECs by <italic>B. henselae</italic> VBNC cells and cells at the logarithmic stage was analyzed at 12 and 18 hours post-infection using FISH combined with confocal scanning microscopy. A multiplicity of infection (MOI) of 100 of <italic>B. henselae</italic> was used either in logarithmic phase or in VBNC state. <italic>B. henselae</italic> cells, labeled with a specific 16S rRNA probe, appear in red, while HUVECs nucleic acids, stained with DAPI, are shown in cyan.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1486426-g004.tif"/>
</fig>
<p>Pathways related to energy and lipid metabolism were notably up-regulated, while those associated with nucleotide, amino acid, glycan, cofactor, and vitamin metabolism were down-regulated (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>), reflecting the metabolic adaptation of VBNC cells.</p>
</sec>
<sec id="s3_6">
<title>Rapid invasion of HUVECs by VBNC <italic>B. henselae</italic>
</title>
<p>Proteomic analysis revealed that VBNC <italic>B. henselae</italic> upregulates proteins related to adhesion and host cell invasion. Using FISH and confocal scanning microscopy, we found that VBNC cells rapidly invade HUVECs, with internalization observed within 12-18 hours post-infection, whereas no internalization was observed with logarithmic-phase <italic>B. henselae</italic> at the same time points (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>Microbial cultivation has long been considered the gold standard for identifying pathogens in clinical samples. However, the existence of VBNC bacteria, which do not grow on routine culture media, complicates clinical diagnosis. For <italic>Bartonella</italic> species, cultivation on blood agar plates is critical for diagnosing infections (<xref ref-type="bibr" rid="B21">La Scola and Raoult, 1999</xref>; <xref ref-type="bibr" rid="B31">Okaro et&#xa0;al., 2017</xref>). However, cases of &#x201c;culture-negative&#x201d; endocarditis caused by <italic>B. henselae</italic> have been reported (<xref ref-type="bibr" rid="B31">Okaro et&#xa0;al., 2017</xref>). Furthermore, culture-based tests fail to detect all <italic>Bartonella</italic> in blood samples, with only 69% (11/16) of <italic>Bartonella-</italic>infected samples successfully cultured (<xref ref-type="bibr" rid="B32">Pitassi et&#xa0;al., 2015</xref>). Shell-vial culture techniques have improved the recovery rates of <italic>Bartonella</italic> from clinical specimens (<xref ref-type="bibr" rid="B19">Lagier et&#xa0;al., 2015</xref>), particularly compared to direct culture on blood agar plates (<xref ref-type="bibr" rid="B21">La Scola and Raoult, 1999</xref>), suggesting that <italic>Bartonella</italic> spp. may enter a viable but nonculturable (VBNC) state under certain conditions, which could be one of the causes for the failure in cultivation.</p>
<p>To prove that <italic>B. henselae</italic> can enter a VBNC state under specific conditions, <italic>B. henselae</italic> was cultivated at 38.8&#xb0;C, a temperature equivalent to the body temperature of cats and dogs and the fever temperature in humans, to induce the VBNC state in this study. We found that <italic>B. henselae</italic> could enter a pure VBNC state after 19 days at 38.8&#xb0;C, with no culturable cells detected (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The formation of VBNC cells was primarily indicated by discrepancies between the number of culturable cells and the total viable cell count. Culturable cells were routinely quantified through CFU counts on agar plates, while total viable cells were assessed using cell membrane integrity-based methods, such as PMA-qPCR (<xref ref-type="bibr" rid="B16">Kibbee and Ormeci, 2017</xref>; <xref ref-type="bibr" rid="B22">Lazou et&#xa0;al., 2019</xref>) and SYBR Green I/PI staining (<xref ref-type="bibr" rid="B12">Feng et&#xa0;al., 2018</xref>). The viability percentages measured by PMA-qPCR showed a linear correlation with those obtained using SYBR Green I/PI staining combined with plate reader or microscopic analysis (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S1</bold>
</xref>). However, PMA-qPCR consistently reported lower viability compared to SYBR Green I/PI staining combined with microscopic observation (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>), indicating a higher signal from dead bacterial cells in PMA-qPCR. It is well-documented that extracellular DNA can lead to overestimations of viable bacterial counts in PMA-qPCR (<xref ref-type="bibr" rid="B27">Lovdal et&#xa0;al., 2011</xref>). Although washing bacterial cells may mitigate this bias, the additional washing and centrifugation steps can damage fragile <italic>B. henselae</italic> cells, further complicating the accurate assessment of viability. In this study, SYBR Green I/PI staining was favored for its faster and convenient sample processing, eliminating the need for cell washing and pelleting, and its minimal sample requirements (10 &#x3bc;L), making it an ideal method for the timely assessment of resuscitation.</p>
<p>Clinically used antibiotics, particularly bactericidal ones like gentamicin and streptomycin, also triggered the VBNC state (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>), converting the entire viable population into VBNC state after just 4 days. Over 100 bacterial species have been documented to enter a nonculturable state, with some species, such as <italic>Mycobacterium tuberculosis</italic> (<xref ref-type="bibr" rid="B46">Zhang et&#xa0;al., 2001</xref>), <italic>Vibrio vulnificus</italic>, and <italic>Legionella pneumophila</italic>, can resuscitate (<xref ref-type="bibr" rid="B24">Li et&#xa0;al., 2014</xref>). Given resuscitation is now a gold standard for verifying the VBNC state (<xref ref-type="bibr" rid="B25">Liu et&#xa0;al., 2023</xref>), we developed a specialized medium as described in the Methods section and successfully resuscitated VBNC cells generated by cultivation at 38.8&#xb0;C or antibiotic treatment, which otherwise failed to grow on regular blood agar plates. The resuscitation method developed here would be promising to improve the diagnostic detection of <italic>B. henselae</italic> in clinical practice, though further studies in clinical settings are needed.</p>
<p>The viability assessment of bacterial cells in this study (PMA-qPCR assay and SYBR Green I/PI assay) relied on membrane integrity, which might misclassify dead cells with intact membrane as VBNC cells (<xref ref-type="bibr" rid="B42">Song and Wood, 2021</xref>). However, TEM analysis confirmed that <italic>B. henselae</italic> VBNC cells developed at 38.8&#xb0;C maintain an intact cell wall, intact inner membrane, and dense cytosol (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Notably, substantial shrinkage of the inner membrane away from the cell wall was observed in a large portion of VBNC cells, highlighting its relevance under stress conditions. Similar morphology was reported in <italic>E. coli</italic> in response to nutrient depletion (<xref ref-type="bibr" rid="B41">Shi et&#xa0;al., 2021</xref>), and the presence of plasmolysis implies that bacterial cells were alive (<xref ref-type="bibr" rid="B17">Korber et&#xa0;al., 1996</xref>). The morphology changes of VBNC <italic>B. henselae</italic> need further study in the future.</p>
<p>The ability of <italic>B. henselae</italic> to enter the VBNC state likely contributes to the frequent failure to isolate the bacterium from hosts, posing challenges for clinical diagnosis and treatment. The generation of a pure VBNC state at an elevated temperature of 38.8&#xb0;C in our study suggests that <italic>B. henselae</italic> may exist in the VBNC state within infected hosts, such as febrile humans, cats, and dogs, where the normal body temperatures in the latter animal hosts can range from 38.3 to 39.2&#xb0;C. This hypothesis aligns with the difficulty of isolating <italic>B. henselae</italic> from infected animals (<xref ref-type="bibr" rid="B8">Diniz et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B38">Sayed et&#xa0;al., 2022</xref>). Additionally, it suggests that fever in patients caused by <italic>B. henselae</italic> infection may also promote the transition to the VBNC state.</p>
<p>VBNC state has been proposed as part of bacterial persistence (<xref ref-type="bibr" rid="B45">Zhang, 2014</xref>; <xref ref-type="bibr" rid="B3">Ayrapetyan et&#xa0;al., 2018</xref>) for bacterial survival in adverse environments, exhibiting significant convergence in their characteristics and molecular mechanisms, particularly in antibiotic tolerance (<xref ref-type="bibr" rid="B2">Ayrapetyan et&#xa0;al., 2015b</xref>). Previous studies demonstrated that stationary-phase cultures contain a large portion of drug-tolerant persisters in various bacterial species, including <italic>B. henselae</italic> (<xref ref-type="bibr" rid="B23">Li et&#xa0;al., 2019</xref>). This study found that pure <italic>B. henselae</italic> VBNC cells exhibited enhanced drug tolerance relative to persisters (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>), especially against anti-persister drugs like daptomycin and methylene blue (<xref ref-type="bibr" rid="B23">Li et&#xa0;al., 2019</xref>). Currently, the VBNC state and bacterial persistence are regarded as closely related phenomena along a shared &#x2018;dormancy continuum&#x2019;, rather than entirely distinct states (<xref ref-type="bibr" rid="B2">Ayrapetyan et&#xa0;al., 2015b</xref>). However, the mechanisms underlying drug tolerance in <italic>B. henselae</italic> during these two forms may be different and require further investigation. High-temperature exposure also significantly accelerated the formation of <italic>B. henselae</italic> persisters (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2F</bold>
</xref>), suggesting that <italic>B. henselae</italic> in infected individuals may be more drug-tolerant, posing substantial challenges for clinical treatment.</p>
<p>Furthermore, clinically used antibiotics were shown to induce the VBNC state in <italic>B. henselae</italic>. Bacterial antibiotics like gentamicin and streptomycin eliminated culturable cells within 4 days (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>), which is consistent with our previous findings (<xref ref-type="bibr" rid="B23">Li et&#xa0;al., 2019</xref>). However, viable cell counts remained high. This, combined with successful resuscitation, unearthed a novel insight: these clinically employed antibiotics can induce <italic>B. henselae</italic> into VBNC state, at least under <italic>in vitro</italic> conditions. Even bacteriostatic antibiotics like doxycycline and erythromycin, also converted a portion of <italic>B. henselae</italic> cells to VBNC state (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Therefore, the current antibiotic treatment for <italic>B. henselae</italic>-infected individuals may have paradoxical effect of killing some growing bacteria while promoting VBNC cell formation, which can contribute to persistent and/or chronic infection. These findings advance our understanding of the impact of antibiotic treatment for <italic>Bartonella</italic> infections, urging the need to develop more effective treatments to combat the persister forms of this emerging human pathogen, especially the VBNC form.</p>
<p>The molecular mechanisms underlying VBNC formation in bacteria remain incompletely understood (<xref ref-type="bibr" rid="B25">Liu et&#xa0;al., 2023</xref>), though key genes and pathways, including those related to stress response, membrane proteins, toxin-antitoxin systems, and cell division, have been identified (<xref ref-type="bibr" rid="B9">Dong et&#xa0;al., 2020</xref>). Proteomic analysis in this study revealed that 17.6% of identified proteins were significantly altered in <italic>B. henselae</italic> VBNC cells compared to culturable cells. Notably, up-regulated proteins involved in hemin and iron uptake, such as FhaB1 and the hemin-binding proteins (<xref ref-type="bibr" rid="B37">Sander et&#xa0;al., 2000</xref>), suggest an iron deficiency in VBNC cells. This iron deficiency is supported by the resuscitation process, where sheep blood, rich in heme iron, promoted the recovery of VBNC cells to a culturable state. However, the specific contribution of sheep blood in the resuscitation process is a complex issue. Future studies should focus on identifying the key factors involved in the resuscitation of <italic>B. henselae</italic> VBNC cells, including the evaluation of various iron components.</p>
<p>Beyond their role in facilitating hemin and/or iron uptake, the HecB/FhaC proteins and hemin-binding proteins are also responsible for mediating <italic>B. henselae</italic> adhesion to host cells (<xref ref-type="bibr" rid="B13">Franz and Kempf, 2011</xref>). More proteins involved in host cell adhesion and invasion were up-regulated in VBNC cells (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S2</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S2</bold>
</xref>), including TrwL/J, VirB, and IalB. The Trw and VirB systems, which are Type 4 secretion system (T4SS), play critical roles in the adhesion of <italic>Bartonella</italic> to host cells (<xref ref-type="bibr" rid="B14">Jin et&#xa0;al., 2023</xref>), whereas IalB protein is implicated in erythrocyte invasion. The increased expression of these proteins in VBNC cells are likely responsible for facilitating the entry and invasion of <italic>B. henselae</italic> into host cells. FISH analysis in this study indeed confirmed that <italic>B. henselae</italic> in the VBNC state could invade HUVECs within 12-18 hours, whereas no invasion was observed for logarithmic-phase <italic>B. henselae</italic> during this same period (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>). Typically, actively growing bacteria require at least 24-30 hours to invade HUVECs (<xref ref-type="bibr" rid="B6">Dehio et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B40">Schmid et&#xa0;al., 2004</xref>). This suggests that VBNC <italic>B. henselae</italic> may have a faster invasion capability compared to its logarithmic-phase counterpart. This rapid invasion provides an effective strategy for countering environmental stress and evading the host immune clearance.</p>
<p>Another up-regulated protein in VBNC cells was BafA, a <italic>Bartonella</italic>-produced mitogen that exhibits pro-angiogenic activity through vascular endothelial growth factor receptor-2 (VEGFR-2) on the cell surface, resulting in the proliferation of <italic>Bartonella</italic>-infected vascular endothelial cells through activating the mitogen-activated protein kinase (MAPK) pathway (<xref ref-type="bibr" rid="B44">Tsukamoto et&#xa0;al., 2020</xref>). Other up-regulated proteins in VBNC cells included molecular chaperones and heat shock proteins (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Figure S2</bold>
</xref>), which are likely critical for maintaining the stability and folding of proteins in the VBNC state, thereby ensuring bacterial survival under unfavorable conditions. The down-regulation of cold shock proteins (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref>) aligns with VBNC induction under high temperatures. SOD, an enzyme that eliminates reactive oxygen species, was also up-regulated, possibly aiding <italic>B. henselae</italic> VBNC cells survival at elevated temperatures.</p>
<p>Pathways involved in energy metabolism, lipid metabolism, and protein synthesis were up-regulated, while those related to the metabolism of nucleotides, amino acids, glycans, cofactors, and vitamins were down-regulated (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>). This metabolic shift suggests that <italic>B. henselae</italic> VBNC cells maintain essential functions for survival while down-regulating less critical pathways, characteristics of VBNC states (<xref ref-type="bibr" rid="B25">Liu et&#xa0;al., 2023</xref>) that share similarities with bacterial persister pathways (<xref ref-type="bibr" rid="B45">Zhang, 2014</xref>; <xref ref-type="bibr" rid="B30">Niu et&#xa0;al., 2024</xref>).</p>
<p>In conclusion, this study investigated <italic>B. henselae</italic>&#x2019;s ability to enter the VBNC state and invade host cells efficiently. <italic>B. henselae</italic> can fully enter the VBNC state under fever-mimicking temperature (38.8&#xb0;C) and antibiotic treatment, exhibiting enhanced drug tolerance and specific morphological and proteomic adjustments. The evidence suggests that bacteria in the VBNC state are not just a theoretical risk but may actively contribute to host pathogenesis, relapsing infections, and antibiotic failure. These findings underscore the diagnostic challenges posed by <italic>B. henselae</italic> in the VBNC state and emphasize the need for improving treatment strategies and developing effective culture methods to recover <italic>B. henselae</italic> isolates from patients.</p>
</sec>
</body>
<back>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are publicly available. This data can be found here: ProteomeXchange website: <uri xlink:href="http://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD055316">http://proteomecentral.proteomexchange.org/cgi/GetDataset?ID=PXD055316</uri> and iProX: <uri xlink:href="https://www.iprox.cn//page/project.html?id=IPX0009557000">https://www.iprox.cn//page/project.html?id=IPX0009557000</uri>.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>YG: Data curation, Methodology, Validation, Writing &#x2013; original draft. DL: Data curation, Methodology, Validation, Writing &#x2013; original draft. YXX: Data curation, Methodology, Validation, Writing &#x2013; original draft. TW: Data curation, Methodology, Writing &#x2013; review &amp; editing. JL: Data curation, Methodology, Writing &#x2013; review &amp; editing. YWX: Data curation, Methodology, Writing &#x2013; review &amp; editing. XZ:&#xa0;Data curation, Formal analysis, Writing &#x2013; review &amp; editing. TC: Conceptualization, Writing &#x2013; review &amp; editing. YZ: Conceptualization, Writing &#x2013; review &amp; editing. TL: Conceptualization, Data curation, Formal analysis, Investigation, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing. JF: Conceptualization, Funding acquisition, Investigation, Writing &#x2013; original draft, Writing &#x2013; review &amp; editing.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This study was funded by the Science and Technology Project of Gansu Province (No. 24CXGA022), the National Natural Science Foundation of China (No. 81902099) and the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (No. SKLVEB2020KFKT005). The funders had no role in study design, data collection or analysis, decision to publish, or preparation of the manuscript.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2024.1486426/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2024.1486426/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ayrapetyan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Williams</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Baxter</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Oliver</surname> <given-names>J. D.</given-names>
</name>
</person-group> (<year>2015</year>a). <article-title>Viable but nonculturable and persister cells coexist stochastically and are induced by human serum</article-title>. <source>Infect. Immun.</source> <volume>83</volume>, <fpage>4194</fpage>&#x2013;<lpage>4203</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.00404-15</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ayrapetyan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Williams</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Oliver</surname> <given-names>J. D.</given-names>
</name>
</person-group> (<year>2015</year>b). <article-title>Bridging the gap between viable but non-culturable and antibiotic persistent bacteria</article-title>. <source>Trends Microbiol.</source> <volume>23</volume>, <fpage>7</fpage>&#x2013;<lpage>13</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tim.2014.09.004</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ayrapetyan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Williams</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Oliver</surname> <given-names>J. D.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Relationship between the viable but nonculturable state and antibiotic persister cells</article-title>. <source>J. bacteriol.</source> <volume>200</volume> (<issue>20</issue>), <fpage>e00249</fpage>&#x2013;<lpage>18</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JB.00249-18</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Breitschwerdt</surname> <given-names>E. B.</given-names>
</name>
<name>
<surname>Maggi</surname> <given-names>R. G.</given-names>
</name>
<name>
<surname>Nicholson</surname> <given-names>W. L.</given-names>
</name>
<name>
<surname>Cherry</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Woods</surname> <given-names>C. W.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Bartonella sp. bacteremia in patients with neurological and neurocognitive dysfunction</article-title>. <source>J. Clin. Microbiol.</source> <volume>46</volume>, <fpage>2856</fpage>&#x2013;<lpage>2861</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.00832-08</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ma</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>iProX in 2021: connecting proteomics data sharing with big data</article-title>. <source>Nucleic Acids Res</source> <volume>50 (D1)</volume>, <elocation-id>D1522&#x2013;D1527</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkab1081</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dehio</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Meyer</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Berger</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Schwarz</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Lanz</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Interaction of Bartonella henselae with endothelial cells results in bacterial aggregation on the cell surface and the subsequent engulfment and internalisation of the bacterial aggregate by a unique structure, the invasome</article-title>. <source>J. Cell Sci.</source> <volume>110</volume>, <fpage>2141</fpage>&#x2013;<lpage>2154</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1242/jcs.110.18.2141</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Demichev</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Messner</surname> <given-names>C. B.</given-names>
</name>
<name>
<surname>Vernardis</surname> <given-names>S. I.</given-names>
</name>
<name>
<surname>Lilley</surname> <given-names>K. S.</given-names>
</name>
<name>
<surname>Ralser</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>DIA-NN: neural networks and interference correction enable deep proteome coverage in high throughput</article-title>. <source>Nat. Methods</source> <volume>17</volume>, <fpage>41</fpage>&#x2013;<lpage>44</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41592-019-0638-x</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diniz</surname> <given-names>P. P.</given-names>
</name>
<name>
<surname>Morton</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Tngrian</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kachani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Barron</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Gavidia</surname> <given-names>C. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Infection of domestic dogs in Peru by zoonotic bartonella species: a cross-sectional prevalence study of 219 asymptomatic dogs</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>7</volume>, <elocation-id>e2393</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0002393</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dong</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Pan</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Rao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Induction, detection, formation, and resuscitation of viable but non-culturable state microorganisms</article-title>. <source>Compr. Rev. Food Sci. Food Saf.</source> <volume>19</volume>, <fpage>149</fpage>&#x2013;<lpage>183</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/1541-4337.12513</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Drummond</surname> <given-names>M. R.</given-names>
</name>
<name>
<surname>Dos Santos</surname> <given-names>L. S.</given-names>
</name>
<name>
<surname>de Almeida</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Lins</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Barjas-Castro</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Diniz</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Comparison of molecular methods for Bartonella henselae detection in blood donors</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>17</volume>, <elocation-id>e0011336</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0011336</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>An optimized SYBR green I/PI assay for rapid viability assessment and antibiotic susceptibility testing for <italic>borrelia burgdorferi</italic>
</article-title>. <source>PloS One</source> <volume>9</volume>, <elocation-id>e111809</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0111809</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yee</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tian</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>A rapid growth-independent antibiotic resistance detection test by SYBR green/propidium iodide viability assay</article-title>. <source>Front. Med</source>. <volume>5</volume>, <fpage>127</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmed.2018.00127</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Franz</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Kempf</surname> <given-names>V. A.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae</article-title>. <source>Parasit Vectors</source> <volume>4</volume>, <elocation-id>54</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1756-3305-4-54</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jin</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Gou</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Advancements in understanding the molecular and immune mechanisms of Bartonella pathogenicity</article-title>. <source>Front. Microbiol.</source> <volume>14</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2023.1196700</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kanehisa</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Furumichi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tanabe</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Morishima</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>KEGG: new perspectives on genomes, pathways, diseases and drugs</article-title>. <source>Nucleic Acids Res.</source> <volume>45</volume>, <fpage>D353</fpage>&#x2013;<lpage>D361</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gkw1092</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kibbee</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>Ormeci</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Development of a sensitive and false-positive free PMA-qPCR viability assay to quantify VBNC Escherichia coli and evaluate disinfection performance in wastewater effluent</article-title>. <source>J. microbiol. Methods</source> <volume>132</volume>, <fpage>139</fpage>&#x2013;<lpage>147</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mimet.2016.12.004</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Korber</surname> <given-names>D. R.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Wolfaardt</surname> <given-names>G. M.</given-names>
</name>
<name>
<surname>Caldwell</surname> <given-names>D. E.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Bacterial plasmolysis as a physical indicator of viability</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>62</volume>, <fpage>3939</fpage>&#x2013;<lpage>3947</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/aem.62.11.3939-3947.1996</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koutantou</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kambas</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Makka</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fournier</surname> <given-names>P. E.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Angelakis</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Limitations of serological diagnosis of typical cat scratch disease and recommendations for the diagnostic procedure</article-title>. <source>Can. J. Infect. Dis. Med. Microbiol.</source> <volume>2023</volume>, <elocation-id>4222511</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2023/4222511</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lagier</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Edouard</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Pagnier</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Mediannikov</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Drancourt</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Current and past strategies for bacterial culture in clinical microbiology</article-title>. <source>Clin. Microbiol. Rev.</source> <volume>28</volume>, <fpage>208</fpage>&#x2013;<lpage>236</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/Cmr.00110-14</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>La Scola</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii</article-title>. <source>J. Clin. Microbiol.</source> <volume>34</volume>, <fpage>2270</fpage>&#x2013;<lpage>2274</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/jcm.34.9.2270-2274.1996</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>La Scola</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Culture of Bartonella quintana and Bartonella henselae from human samples: a 5-year experience, (1993 to 1998)</article-title>. <source>J. Clin. Microbiol.</source> <volume>37</volume>, <fpage>1899</fpage>&#x2013;<lpage>1905</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.37.6.1899-1905.1999</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lazou</surname> <given-names>T. P.</given-names>
</name>
<name>
<surname>Iossifidou</surname> <given-names>E. G.</given-names>
</name>
<name>
<surname>Gelasakis</surname> <given-names>A. I.</given-names>
</name>
<name>
<surname>Chaintoutis</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Dovas</surname> <given-names>C. I.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Viability quantitative PCR utilizing propidium monoazide, spheroplast formation, and campylobacter coli as a bacterial model</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>85</volume>(<issue>20</issue>), <fpage>e01499</fpage>&#x2013;<lpage>19</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/AEM.01499-19</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xiao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Sullivan</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Identification of FDA-Approved Drugs with Activity against Stationary Phase Bartonella henselae</article-title>. <source>Antibiot. (Basel)</source> <volume>8</volume>, <elocation-id>50</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antibiotics8020050</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Mendis</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Trigui</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Oliver</surname> <given-names>J. D.</given-names>
</name>
<name>
<surname>Faucher</surname> <given-names>S. P.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>The importance of the viable but non-culturable state in human bacterial pathogens</article-title>. <source>Front. Microbiol.</source> <volume>5</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2014.00258</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Kjellerup</surname> <given-names>B. V.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Z. B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Viable but nonculturable (VBNC) state, an underestimated and controversial microbial survival strategy</article-title>. <source>Trends Microbiol.</source> <volume>31</volume>, <fpage>1013</fpage>&#x2013;<lpage>1023</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tim.2023.04.009</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lotoux</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Milohanic</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Bierne</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>The viable but non-culturable state of listeria monocytogenes in the one-health continuum</article-title>. <source>Front. Cell Infect. Microbiol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2022.849915</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lovdal</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hovda</surname> <given-names>M. B.</given-names>
</name>
<name>
<surname>Bjorkblom</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Moller</surname> <given-names>S. G.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Propidium monoazide combined with real-time quantitative PCR underestimates heat-killed Listeria innocua</article-title>. <source>J. microbiol. Methods</source> <volume>85</volume>, <fpage>164</fpage>&#x2013;<lpage>169</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mimet.2011.01.027</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Massei</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Messina</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Gori</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Macchia</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Maggiore</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>High prevalence of antibodies to Bartonella henselae among Italian children without evidence of cat scratch disease</article-title>. <source>Clin. Infect. Dis.</source> <volume>38</volume>, <fpage>145</fpage>&#x2013;<lpage>148</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1086/379824</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nelson</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Saha</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mead</surname> <given-names>P. S.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Cat-scratch disease in the United States 2005-2013</article-title>. <source>Emerg. Infect. Dis.</source> <volume>22</volume>, <fpage>1741</fpage>&#x2013;<lpage>1746</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3201/eid2210.160115</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Gu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Bacterial persisters: molecular mechanisms and therapeutic development</article-title>. <source>Signal Transduct Target Ther.</source> <volume>9</volume>, <fpage>174</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41392-024-01866-5</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Okaro</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Addisu</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Casanas</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Bartonella species, an emerging cause of blood-culture-negative endocarditis</article-title>. <source>Clin. Microbiol. Rev.</source> <volume>30</volume>, <fpage>709</fpage>&#x2013;<lpage>746</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/CMR.00013-17</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pitassi</surname> <given-names>L. H.</given-names>
</name>
<name>
<surname>de Paiva Diniz</surname> <given-names>P. P.</given-names>
</name>
<name>
<surname>Scorpio</surname> <given-names>D. G.</given-names>
</name>
<name>
<surname>Drummond</surname> <given-names>M. R.</given-names>
</name>
<name>
<surname>Lania</surname> <given-names>B. G.</given-names>
</name>
<name>
<surname>Barjas-Castro</surname> <given-names>M. L.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Bartonella spp. bacteremia in blood donors from Campinas, Brazil</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>9</volume>, <elocation-id>e0003467</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0003467</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Prudent</surname> <given-names>E.</given-names>
</name>
<name>
<surname>La Scola</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Drancourt</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Angelakis</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Raoult</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Molecular strategy for the diagnosis of infectious lymphadenitis</article-title>. <source>Eur. J. Clin. Microbiol. Infect. Dis.</source> <volume>37</volume>, <fpage>1179</fpage>&#x2013;<lpage>1186</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10096-018-3238-2</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Prudent</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Lepidi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Audoly</surname> <given-names>G.</given-names>
</name>
<name>
<surname>La Scola</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Fournier</surname> <given-names>P. E.</given-names>
</name>
<name>
<surname>Edouard</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Bartonella henselae is usually not viable in lymph nodes of patients with cat scratch disease</article-title>. <source>Eur. J. Clin. Microbiol. Infect. Dis.</source> <volume>36</volume>, <fpage>2207</fpage>&#x2013;<lpage>2213</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10096-017-3047-z</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pulliainen</surname> <given-names>A. T.</given-names>
</name>
<name>
<surname>Dehio</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Persistence of Bartonella spp. stealth pathogens: from subclinical infections to vasoproliferative tumor formation</article-title>. <source>FEMS Microbiol. Rev.</source> <volume>36</volume>, <fpage>563</fpage>&#x2013;<lpage>599</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-6976.2012.00324.x</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riess</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Dietrich</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Schmidt</surname> <given-names>K. V.</given-names>
</name>
<name>
<surname>Kaiser</surname> <given-names>P. O.</given-names>
</name>
<name>
<surname>Schwarz</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Schafer</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>Analysis of a novel insect cell culture medium-based growth medium for Bartonella species</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>74</volume>, <fpage>5224</fpage>&#x2013;<lpage>5227</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/AEM.00621-08</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sander</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kretzer</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Bredt</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Oberle</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Bereswill</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Hemin-dependent growth and hemin binding of Bartonella henselae</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>189</volume>, <fpage>55</fpage>&#x2013;<lpage>59</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-6968.2000.tb09205.x</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sayed</surname> <given-names>A. S. M.</given-names>
</name>
<name>
<surname>Alsaadawy</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Ali</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Abd El-Hamid</surname> <given-names>R. F.</given-names>
</name>
<name>
<surname>Baty</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Elmahallawy</surname> <given-names>E. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Serological and molecular detection of bartonella henselae in cats and humans from Egypt: current status and zoonotic implications</article-title>. <source>Front. Vet. Sci.</source> <volume>9</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fvets.2022.859104</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schindelin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Arganda-Carreras</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Frise</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Kaynig</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Longair</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Pietzsch</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Fiji: an open-source platform for biological-image analysis</article-title>. <source>Nat. Methods</source> <volume>9</volume>, <fpage>676</fpage>&#x2013;<lpage>682</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schmid</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Schulein</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Dehio</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Denecker</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Carena</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Dehio</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>The VirB type IV secretion system of Bartonella henselae mediates invasion, proinflammatory activation and antiapoptotic protection of endothelial cells</article-title>. <source>Mol. Microbiol.</source> <volume>52</volume>, <fpage>81</fpage>&#x2013;<lpage>92</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2958.2003.03964.x</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Westfall</surname> <given-names>C. S.</given-names>
</name>
<name>
<surname>Kao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Odermatt</surname> <given-names>P. D.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Cesar</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Starvation induces shrinkage of the bacterial cytoplasm</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>118</volume>, <elocation-id>e2104686118</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.2104686118</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wood</surname> <given-names>T. K.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>[amp]]lsquo;Viable but non-culturable cells&#x2019; are dead</article-title>. <source>Environ. Microbiol.</source> <volume>23</volume>, <fpage>2335</fpage>&#x2013;<lpage>2338</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/1462-2920.15463</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song Xiu</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Zhang Hai</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Liu Qi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun Ji</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Gu Shao</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Seroprevalence of <italic>bartonella henselae</italic> and identification of risk factors in China</article-title>. <source>Biomed. Environ. Sci.</source> <volume>33</volume>, <fpage>72</fpage>&#x2013;<lpage>75</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3967/bes2020.011</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsukamoto</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Shinzawa</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kawai</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Suzuki</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kidoya</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Takakura</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>The Bartonella autotransporter BafA activates the host VEGF pathway to drive angiogenesis</article-title>. <source>Nat. Commun.</source> <volume>11</volume>, <fpage>3571</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41467-020-17391-2</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Persisters, persistent infections and the Yin-Yang model</article-title>. <source>Emerg. Microbes Infect.</source> <volume>3</volume>, <elocation-id>1</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/emi.2014.3</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Woods</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Cotter</surname> <given-names>R. J.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Resuscitation of dormant Mycobacterium tuberculosis by phospholipids or specific peptides</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>284</volume>, <fpage>542</fpage>&#x2013;<lpage>547</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/bbrc.2001.4993</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>