All animal experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. All efforts were made to minimize suffering. All animal procedures were approved by the Animal Management Committee and Technology Commission of Shanghai municipal government for Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, China (Permit number: SYXK 2016–0010). The life cycle of S. japonicum (Jiangxi isolate) was maintained in Kunming mice (Shanghai JieSiJie Laboratory Animal Co., Ltd, Shanghai, China) and Oncomelania hupensis was obtained from Center of National Institute of Parasitic Disease, Chinese Center for Disease Control and Prevention, Shanghai, China. Mice were infected with approximately 200 cercariae, respectively via the skin of the abdomen. Before infection and at 5-, 10-, 22- and 28-days post-infection (dpi), blood was collected from the mice by retro-orbital bleeding. After collection, the whole blood was allowed to clot at room temperature for 30 min, centrifuged at 3000 ×g for 10 min at 4°C. The resulting sera were collected and stored at -80°C until use. In addition, human serum samples infected with S. japonicum were provided by Institute of Biology, University of the Philippines Diliman. Worms were collected from infected mice by perfusion at 7, 14, 21 and 28 dpi. Eggs were isolated from the livers of infected animals as described elsewhere (Lewis et al., 1986). All collected parasites were stored in liquid nitrogen until further use.

Based on our previous study, Zhu et al. (2016) identified 403 proteins in S. japonicum EVs by LC-MS/MS, and there were 116 proteins identified from a total of 9 gel blocks. SJCHGC Hypothetical protein (UniProtKB/SwissProt ID: C1L4B9), SJCHGC02838 protein (UniProtKB/SwissProt ID: Q5DGI7), SJCHGC05593 protein (UniProtKB/SwissProt ID: Q5BW52), and SJCHGC05668 protein (UniProtKB/SwissProt ID: Q5DD37) were selected because they all possess signal peptide and are predicted to be SjEVs structure-associated and secreted proteins (Zhu et al., 2016), one of which previously showed diagnostic potential (Wang et al., 2018).

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed to analyze the expression profiles of these four S. japonicum genes in eggs, cercariae, and parasites collected at 7, 14, 21 and 28 dpi. Total RNA was isolated from eggs and parasites from different developmental stages using TRIzol reagent (Life Technologies, Carlsbad, CA, USA). The isolated RNA was quantified using a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) and stored at -80°C until further use. To determine the transcriptional levels of these genes at different developmental stages of S. japonicum, 500 ng RNA from each stage was reverse transcribed to cDNAs using a PrimeScript RT reagent Kit (TaKaRa, China). The level of mRNA of these genes under different conditions were analyzed by qRT-PCR using specific primers as follows: the forward primer for SJHYP 5’: GTTAGTCTTTATGTTGGTTGTCCTT and the reverse primer for SJHYP 3’: CAATTCTACTTGATTACTTCTCGATT, the forward primer for SJCHGC05668 protein 5’: AAAAGTAAATCAGAAAGTGTGTATTG and the reverse primer for SJCHGC05668 protein 3’: AGTTCAAACAGGAATAACAACTGA, the forward primer for SJCHGC05593 protein 5’: CGATTAAATCTTTCGCAGACC and the reverse primer for SJCHGC05593 protein 3’: ATCTTCAAAGGGTATTGGATGT, the forward primer for SJCHGC02838 protein 5’: AGTGAGATCATCAGGATGGTTAG and the reverse primer for SJCHGC02838 protein 3’: AGAGGAGCCTGTCACAGATA. S. japonicum nicotinamide adenine dinucleotide dehydrogenase (NADH) gene was used as an internal control using the forward primer: CGAGGACCTAACAGCAGAGG and the reverse primer: TCCGAACGAACTTTGAATCC (Liu et al., 2012). qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa) using the following cycling conditions: 95°C for 30 s, followed by 40 cycles of amplification (95°C for 5 s, 60°C for 30 s, 72°C for 20 s). Relative mRNA expression was calculated using the 2^−ΔCt method (Livak and Schmittgen, 2001).

The extracted total RNA of S. japonicum adult worms was reverse transcribed to cDNA as described above. The full-length of SJHYP, SJCHGC02838, SJCHGC05593 and SJCHGC05668 were amplified by PCR from the reverse transcribed cDNA using the forward primer for SJHYP-5’: GACAGCCCAGATCTGGGTACCATGAAACTTGTGTTAGTCTTTATG and the reverse primer for SJHYP-3’: GGTGCTCGAGTGCGGCCGCAAGCTTTCATTCCTCACGAGTAGAC, the forward primer for SJCHGC02838–5’: GACAGCCCAGATCTGGGTACCATGTGGTCAATATTCATCTTG and the reverse primer for SJCHGC02838–3’: GGTGCTCGAGTGCGGCCGCAAGCTTTCACTCGATCGATTTTCTC, the forward primer for SJCHGC05593–5’: GACAGCCCAGATCTGGGTACCATGGGGGGCTTGTTTTCAG and the reverse primer for SJCHGC05593–3’: GGTGCTCGAGTGCGGCCGCAAGCTTTTATAATATCTTGAAGTGCAGATTTATTTTTTCAATTTTC, the forward primer for SJCHGC05668–5’: GACAGCCCAGATCTGGGTACCATGAACAGTGGTTTTAAATTC and the reverse primer for SJCHGC05668–3’: GGTGCTCGAGTGCGGCCGCAAGCTTTTATAGAATGTATCCACTGATTG. The amplification reaction contained 12.5 μL 2×Hieff^®PCR Master Mix (With Dye) (Yeason, Shanghai, China), 2 μL cDNA, 0.4 μM primers, and ddH₂O up to 25 μL. The PCR conditions were, 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 59°C for 30 s, 72°C for 90 s and a final extension step of 72°C for 10 min. Then purified amplicons were cloned into plasmid pET32a (+) using double-restriction digestion of KpnI and HindIII. The recombinant plasmids were transformed into Escherichia coli DH5α (Novagen, Germany) and further confirmed by double restriction digestion and sequencing (Shanghai Jieyi Biotechnology Co., Ltd, Shanghai, China).

The recombinant plasmids with correct insertion were transformed into E. coli BL21(DE3) (Novagen) competent cells for the expression of these four recombinant proteins. The fusion proteins with His-tags were induced by adding 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) at 37°C and 220 rpm. After 8 h, bacterial cells were collected and broken by sonication for 30 min on ice at 10 s intervals (Sonics & Materials Inc., Newtown, CT, USA). The enriched recombinant proteins were purified using the Ni-NTA Agarose (TYHF Biological Science and Technology Co., Ltd, Wuhan, China) according to the manufacturer’s instructions. To check the purification outcome, the recombinant proteins were separated using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reducing conditions and stained in Coomassie Brilliant Blue G-250. The photos were taken by iBright image system (ThermoFisher Scientific, USA). The concentrations were determined by a BCA protein assay kit (Beyotime, Shanghai, China) and purified proteins were aliquot and stored at -80°C until further use.

The purified recombinant proteins were separated using 12% SDS-PAGE under reducing conditions, transferred onto polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Hercules, CA, USA), and blocked in phosphate-buffered saline (PBS, pH 7.4) containing 0.1% Tween-20 (PBST, Sigma-Aldrich, St. Louis, MO, USA) and 5% non-fat dry milk for 2 h at room temperature. The membranes were incubated overnight at 4°C with S. japonicum-infected mice sera (1:200 dilution) collected at 7, 14, 21 and 28 dpi separately and washed 3 times for 10 min each with PBST. The membranes were further incubated with the secondary goat anti-mouse immunoglobulin (Ig) G antibody conjugated with horseradish peroxidase (1:5000 dilution; BWBIO, Beijing, China) at room temperature for 1 h. After three washes with PBST, the membrane was developed using the Immobilon Western kit (Millipore, Billerica, MA, USA). The immunoreactive bands were detected by iBright image system (ThermoFisher Scientific).

Several pre-experiments were conducted to determine the coating concentration of recombinant proteins (2 μg/mL), the dilution of mice serum (1:200), the optimal dilution of the secondary antibody (1: 5000), the optimal reaction time (15 min) of substrate solution. The 96-well ELISA plates (BBI, Sangon Biotech, Shanghai, China) coated with 100 µL/well of each protein diluted in carbonate buffer (disodium carbonate [Na₂CO₃]: 1.59 g/L and sodium bicarbonate [NaHCO₃]: 2.93 g/L) were incubated overnight at 4°C. Non-specific binding was blocked using 200 µL/well PBS (pH 7.4) containing 0.1% Tween-20 (Sigma-Aldrich) and 5% non-fat dry milk for 1 h at 37°C. Then, the plates were washed 5 times for 2 min each with PBST, and incubated with 100 µL/well serum diluted with PBST for 1 h at 37°C. After five washes with PBST, 100 µL/well horseradish peroxidase-conjugated goat anti-mouse (to detect mice sera) or rabbit anti-human (to detect human sera) IgG (Beijing CoWin Biotech Co., Ltd. Beijing, China) diluted with PBST was added and incubated at 37°C for 1 h. The plates were washed five times with PBST, 100 µL/well 3,3′,5,5′-tetramethyl benzidine dihydrochloride (TMB) single-component substrate solution (Solarbio, Beijing, China) was added, and the reaction was stopped 15 min later using 50 µL/well ELISA Stop Solution (Solarbio). The absorbance was determined using a microplate reader (BioTek, USA) at 450 nm and each ELISA included a negative serum control.

ELISA was used to identify the levels of the four purified recombinant proteins separately recognized by serum of mice (n=5) infected with S. japonicum 200 cercariae collected at 5, 10, 22 and 28 dpi respectively, each ELISA included a negative serum control. Besides, based on the levels of four recombinant proteins and their mixtures recognized by the serum of mice (n=16) at 28 dpi, the diagnostic potentials of rSJHYP, rSJCHGC02838, rSJCHGC05593, rSJCHGC05668 separately and their equal mixture were preliminarily evaluated and compared. In addition, we also determined the diagnostic potential of these four proteins for mice infected with 10 and 20 cercariae at 3 and 5 dpi. The different number of S. japonicum cercariae for mice infection (10, 20, 200 cercariae) was also evaluated (n=3).

ELISA conditions were optimized for different coating concentrations (2, 4, 6 μg/mL), serum dilutions (1:100, 1:200, 1:400 and 1:800), secondary antibody dilutions (1: 2500, 1: 5000, 1: 10000, 1: 20000), and the reaction time of substrate solution (5, 10, 15, 20 min). The rSJCHGC05668-indirect ELISA results of 38 human serum samples were compared with PCR results using cfDNA extracted from human sera as templates. The positive and negative sera were ratio diluted (1:100, 1:200, 1:400, 1:800,1:1600, 1:3200, 1:6400 and 1:12800) respectively to test the sensitivity of the human sera for this method. Five human serum samples were selected randomly to detect and evaluate the repeatability of intra and inter batch test results.

cfDNA was isolated from human serum samples using QIAamp Circulating Nucleic Acid kit following the manufacturer’s instructions. The isolated DNA was eluted using 25–50 µL of RNase-free water and measured the concentration and purity of eluted DNA were in a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific).

The data are represented as mean ± standard error (S.E.) derived from triplicate experiments. The significant differences between two groups were compared using the Student’s T-test considering P ≤ 0.05 is statically significant. The diagnostic potentials of the recombinant proteins were preliminarily evaluated by Receiver Operating Characteristic (ROC) analysis. We used GraphPad Prism 8.0 software to perform statistical analyses and plot the graphs and curves.

Based on our previous study (Zhu et al., 2016), we performed bioinformatics analysis and identified 41 proteins with secreted signal peptides out of 403 S. japonicum EVs proteins that could be recognized by the S. japonicum infected sera. Further BLASTP analysis revealed that out of 41 proteins segregated into 7 repeated proteins, 6 proteins were homologous to the host, 16 proteins were homologous to other helminths and 12 were schistosome-specific ( Figure 1 ). Out of these proteins 16 were homologous to other helminths and 12 were schistosome specific proteins, we selected the proteins namely SJHYP, SJCHGC02838 and SJCHGC05593; and SJCHGC05668 protein, respectively because these proteins were showing highest similarity to S. mansoni. Expression profiles of the transcript level of these four genes in eggs, cercariae and parasites collected at 7, 14, 21 and 28 dpi were determined by qRT-PCR analysis. The results indicated that these four genes were expressed in all of the developmental stages investigated; showed higher expression in worms collected at 14, 21 and 28 dpi than in worms collected at 7 dpi and were expressed at relatively low levels in cercariae and eggs ( Figures 2A-D ). Results suggest that these four S. japonicum EV proteins are probably important in the regulation of adult development.

Complete sequences of Opening Reading Frames for SJHYP (261 bp), SJCHGC02838 (1524 bp), SJCHGC05593 (720 bp) and SJCHGC05668 (579 bp) were amplified by PCR using the cDNA reversely transcribed from the total RNA isolated from S. japonicum adult worms as templates and then cloned into plasmid pET-32a(+), respectively ( Figure 3A ). These four recombinant proteins were expressed in E. coli BL21(DE3) and purified using Ni-NTA agarose. SDS-PAGE analysis showed all four His-tagged recombinant proteins were purified and their rough molecular weight with 26 kDa (rSJHYP), 75 kDa (rSJCHGC02838), 44 kDa (rSJCHGC05593) and 37 kDa (rSJCHGC05668) corresponded to their expected sizes ( Figures 3B, C ).

To evaluate immune responses against four S. japonicum EV proteins in final hosts, we used Western blot to test the immunological recognition of these recombinant proteins at different time points of post-infection. Serum samples were collected from mice before infection and at 7, 14, 21 and 28 dpi. The results showed that all the four recombinant proteins could be specifically recognized by the serum samples of S. japonicum-infected mice ( Figures 3D-G ). Specifically, rSJHYP could be recognized by serum samples collected at 7–21 dpi and stronger recognition was observed with serum samples at 28 dpi ( Figure 3D ); rSJCHGC02838 could be specifically recognized at 14, 21 and-28 dpi ( Figure 3E ); SJCHGC05593 could be weakly recognized by the serum samples collected at 7 dpi and the recognition is stronger with serum samples collected at 14, 21 and 28 dpi ( Figure 3F ); rSJCHGC05668 could be recognized by serum samples collected at 7, 14, 21 and 28 dpi ( Figure 3G ). Furthermore, ELISA was used to identify the levels of the four purified recombinant proteins separately recognized by serum of mice infected with S. japonicum cercariae collected at 5, 10, 22, and 28 dpi respectively ( Figures 3H-K ). P/N value greater than or equal to 2.1 is considered positive. Compared with the results of Western blot, it exhibited similar trends, all four recombinant proteins could be diagnosed as positive at 28 dpi and rSJCHGC05668 could be diagnosed as positive as early as 5 dpi. These results suggested that all four S. japonicum EV proteins can serve as potential diagnostic antigens but the diagnostic potentials varied. To further evaluate the potential of four SjEV proteins as effective biomarkers for early diagnosis, we defined mice infected with approximately 10 and 20 cercariae as having a known level of infection. ELISA was used to identify the levels of the four purified recombinant proteins separately recognized by serum collected at 3 and 5 dpi respectively ( Figures 3L-S ). It was shown that only rSJCHGC05668 could be diagnosed as positive at 5 dpi, even at low levels of infection.

Therefore, we used ELISA to further identify the levels of four recombinant proteins and their mixtures recognized by the serum of mice at 28 dpi which was positive and before infection which was negative ( Figures 4A-E ). The diagnostic potentials of the rSJHYP, rSJCHGC02838, SJCHGC05593, rSJCHGC05668 and the equal mixture of four recombinant proteins were preliminarily evaluated by Receiver Operating Characteristic (ROC) analysis ( Figures 4F-J ). The Area under Curve (AUC) of the mixtures was highest but rSJCHGC05668 was pretty close. Besides, the diagnostic potentials of the other three recombinant proteins were less effective compared to rSJCHGC05668.

According to the results of the above detection of mice sera, we established rSJCHGC05668-indirect ELISA for the diagnosis of S. japonicum-infected/uninfected human sera. ELISA conditions were optimized and the best conditions (coating concentration 4 μg/ml, serum dilution 1:200, secondary antibody dilution 1: 5000 and reaction time of substrate solution 15 min) were subsequently used ( Supplementary Figures 1A-C ). Using established rSJCHGC05668-indirect ELISA to detect the 16 human serum samples which were identified as negative for S. japonicum-infection by PCR using cfDNA extracted from human sera as templates ( Figure 5A ). The average and standard deviation (SD) of absorbance at 450 nm was calculated, the cut-off value was considered as x – + 3 S D . Besides, to avoid false positive results, a suspicious interval ( x – + 2 S D , x – + 4 S D ) was set. Compared with PCR results, 16 samples identified as negative for S. japonicum-infection by PCR were also detected as negative by ELISA, while among 22 samples identified as positive for S. japonicum-infection by PCR, 4 samples were detected as negative, 6 samples were detected as suspected positive and 12 samples were detected as positive by ELISA. The diagnostic potential of the rSJCHGC05668 recognized by human serum was preliminarily evaluated by Receiver Operating Characteristic (ROC) analysis ( Figure 5B ). The Area under Curve (AUC) indicated its excellent diagnostic capability. The positive and negative sera were ratio diluted to test the sensitivity of the human sera for this method was 1:3200 ( Figure 5C ). There are 5 human serum samples were selected randomly to detect and evaluate the repeatability of intra and inter-batch test results ( Table 1 ). The intra and inter-batch coefficient of variation (CV) of the established rSJCHGC05668-indirect ELISA was less than 15%, with good repeatability and stable detection results.