<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2024.1386462</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Rutin prevents EqHV-8 induced infection and oxidative stress via Nrf2/HO-1 signaling pathway</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Chen</surname>
<given-names>Li</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Li</surname>
<given-names>Shuwen</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author" equal-contrib="yes">
<name>
<surname>Li</surname>
<given-names>Wenjing</given-names>
</name>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yu</surname>
<given-names>Yue</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Qi</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Wenjing</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Huaqi</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Changfa</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Liangliang</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Xu</surname>
<given-names>Meng</given-names>
</name>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Khan</surname>
<given-names>Muhammad Zahoor</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1008597"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Li</surname>
<given-names>Yubao</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Tongtong</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/visualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/resources/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>Liaocheng Research Institute of Donkey High-Efficiency Breeding and Ecological Feeding, Liaocheng University</institution>, <addr-line>Liaocheng</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Clement Adebajo Meseko, National Veterinary Research Institute (NVRI), Nigeria</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Ahmed Esmat Abdel Moneim, Helwan University, Egypt</p>
<p>Zhigang Zhang, Northeast Agricultural University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Muhammad Zahoor Khan, <email xlink:href="mailto:zahoorcau@cau.edu.cn">zahoorcau@cau.edu.cn</email>; Yubao Li, <email xlink:href="mailto:liyubao@lcu.edu.cn">liyubao@lcu.edu.cn</email>; Tongtong Wang, <email xlink:href="mailto:wangtongtong@lcu.edu.cn">wangtongtong@lcu.edu.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>25</day>
<month>04</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>14</volume>
<elocation-id>1386462</elocation-id>
<history>
<date date-type="received">
<day>15</day>
<month>02</month>
<year>2024</year>
</date>
<date date-type="accepted">
<day>10</day>
<month>04</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Chen, Li, Li, Yu, Sun, Chen, Zhou, Wang, Li, Xu, Khan, Li and Wang</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Chen, Li, Li, Yu, Sun, Chen, Zhou, Wang, Li, Xu, Khan, Li and Wang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>The Nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) signaling pathway has been extensively studied for its role in regulating antioxidant and antiviral responses. The Equid herpesvirus type 8 (EqHV-8) poses a significant threat to the equine industry, primarily manifesting as respiratory disease, abortions, and neurological disorders in horses and donkeys. Oxidative stress is considered a key factor associated with pathogenesis of EqHV-8 infection. Unfortunately, there is currently a dearth of therapeutic interventions available for the effective control of EqHV-8. Rutin has been well documented for its antioxidant and antiviral potential. In current study we focused on the evaluation of Rutin as a potential therapeutic agent against EqHV-8 infection.</p>
</sec>
<sec>
<title>Methods</title>
<p>For this purpose, we encompassed both in-vitro and in-vivo investigations to assess the effectiveness of Rutin in combatting EqHV-8 infection.</p>
</sec>
<sec>
<title>Results and Discussion</title>
<p>The results obtained from <italic>in vitro</italic> experiments demonstrated that Rutin exerted a pronounced inhibitory effect on EqHV-8 at multiple stages of the viral life cycle. Through meticulous experimentation, we elucidated that Rutin&#x2019;s antiviral action against EqHV-8 is intricately linked to the Nrf2/HO-1 signaling pathway-mediated antioxidant response. Activation of this pathway by Rutin was found to significantly impede EqHV-8 replication, thereby diminishing the viral load. This mechanistic insight not only enhances our understanding of the antiviral potential of Rutin but also highlights the significance of antioxidant stress responses in combating EqHV-8 infection. To complement our <italic>in vitro</italic> findings, we conducted <italic>in vivo</italic> studies employing a mouse model. These experiments revealed that Rutin administration resulted in a substantial reduction in EqHV-8 infection within the lungs of the mice, underscoring the compound&#x2019;s therapeutic promise <italic>in vivo</italic>.</p>
</sec>
<sec>
<title>Conclusion</title>
<p>In summation, our finding showed that Rutin holds promise as a novel and effective therapeutic agent for the prevention and control of EqHV-8 infections.</p>
</sec>
</abstract>
<kwd-group>
<kwd> Rutin</kwd>
<kwd>EqHV-8</kwd>
<kwd>antiviral agent</kwd>
<kwd>oxidative stress</kwd>
<kwd>Nrf2/HO-1 signaling pathway</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="44"/>
<page-count count="12"/>
<word-count count="5374"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Molecular Viral Pathogenesis</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Equid herpesvirus type 8 (EqHV-8), also referred to as asinine herpesvirus 3 (ASH-3), has been implicated in a range of clinical manifestations in equines, including abortions, respiratory diseases, and viral encephalitis. Taxonomically, EqHV-8 belongs to the genus Varicellovirus within the subfamily Alphaherpesvirinae of the family Herpesviridae (<xref ref-type="bibr" rid="B10">Ficorilli et&#xa0;al., 1995</xref>; <xref ref-type="bibr" rid="B8">Davison et&#xa0;al., 2009</xref>). Notably, donkeys have been identified as the natural hosts for EqHV-8, with the virus originally isolated from the nasal cavity of donkeys in Australia in 1987 (<xref ref-type="bibr" rid="B4">Browning et&#xa0;al., 1988</xref>). Furthermore, EqHV-8, specifically the EqHV-8 Wh strain, has been isolated from horses exhibiting fever and nasal discharge in China in 2010 (<xref ref-type="bibr" rid="B23">Liu et&#xa0;al., 2012</xref>). In recent years, EqHV-8 has emerged as a cause for concern due to its rapid spread across several countries, leading to significant economic losses in donkey and horse farming operations (<xref ref-type="bibr" rid="B34">Schvartz et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B43">Yoon et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B41">Wang et&#xa0;al., 2023</xref>). Regrettably, effective therapeutic interventions or vaccines for EqHV-8 have remained elusive thus far.</p>
<p>Rutin, a member of the flavonoid class, is widely distributed in nature and has garnered attention for its diverse pharmacological properties, including antioxidant, anti-inflammatory, antiviral, antitumor, and antibacterial effects (<xref ref-type="bibr" rid="B11">Ganeshpurkar and Saluja, 2017</xref>; <xref ref-type="bibr" rid="B30">Negahdari et&#xa0;al., 2021</xref>; <xref ref-type="bibr" rid="B17">Lai et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B28">Miklasinska-Majdanik et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B9">de Jesus et&#xa0;al., 2024</xref>). Recent research has unveiled Rutin&#x2019;s broad-spectrum antiviral activity against various viruses (<xref ref-type="bibr" rid="B31">Ninfali et&#xa0;al., 2020</xref>). For instance, Rutin has demonstrated antioxidant activity in animals infected with influenza virus, mitigating oxidative damage in the target organs of mice afflicted with influenza virus infection (<xref ref-type="bibr" rid="B33">Savov et&#xa0;al., 2006</xref>). Notably, Nrf2, a pivotal transcription factor, plays a central role in orchestrating antioxidant and antiviral responses by regulating the expression of downstream target genes (<xref ref-type="bibr" rid="B36">Seminotti et&#xa0;al., 2021</xref>). Concurrently, HO-1, recognized as a cytoprotective protein, assumes a critical role in mediating oxidative stress responses and modulating immune responses (<xref ref-type="bibr" rid="B16">Kovacsics et&#xa0;al., 2017</xref>). Significantly, Rutin has recently been found to alleviate oxidative stress induced by ferroptosis in aging chicken small white follicles through the Nrf2/HO-1 pathway (<xref ref-type="bibr" rid="B42">Wu et&#xa0;al., 2023</xref>). Furthermore, Rutin has been extensively researched for its medicinal properties, showing promising results across various studies. Initially, its role as an antioxidant was explored, with a notable study by Mohamed et&#xa0;al. demonstrating its efficacy in mitigating the effects of iron oxide nanoparticles in rats (<xref ref-type="bibr" rid="B29">Mohamed et&#xa0;al., 2024</xref>). This foundational antioxidant property of Rutin sets the stage for its broader antiviral applications. Han et&#xa0;al., reported Rutin&#x2019;s antiviral activity against plant viruses such as tobacco mosaic virus (TMV) and cucumber mosaic virus, showcasing its potential beyond antioxidant activity (<xref ref-type="bibr" rid="B13">Han et&#xa0;al., 2015</xref>). The scope of Rutin&#x2019;s antiviral effects was further broadened by research conducted by Agrawal et&#xa0;al. and Ch&#xe9;ron et&#xa0;al., which extended its application to combating significant human pathogens, including the replication of SARS-CoV-2, the virus responsible for COVID-19, and norovirus, known for causing gastroenteritis (<xref ref-type="bibr" rid="B6">Ch&#xe9;ron et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B2">Agrawal et&#xa0;al., 2021</xref>). These studies collectively highlight Rutin&#x2019;s versatile therapeutic potential, from antioxidative to antiviral applications. However, the specific antiviral effects of Rutin and the underlying mechanisms in the context of EqHV-8 infection remain inadequately understood. The present study represents an endeavor to elucidate the anti-EqHV-8 activity of Rutin and explore the potential antiviral mechanisms involved. Our research showed that Rutin exerts a robust anti-EqHV-8 effect in both susceptible cells and a murine model. Furthermore, we have demonstrated that this anti-EqHV-8 effect of Rutin is contingent upon the Nrf2/HO-1-mediated antioxidant stress response pathway. These findings collectively suggest that Rutin holds promise as a potential effective therapeutic agent for the control of EqHV-8 infections.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Cells, reagents, viruses, and antibodies</title>
<p>Rabbit kidney cells (RK-13) and Madin-Darby Bovine Kidney (MDBK) cells were purchased from the China Center for Type Culture Collection (CCTCC, Wuhan, China) and maintained in 10% fetal bovine serum (FBS) Minimum Eagle&#x2019;s medium (MEM) or Dulbecco&#x2019;s minimal essential medium (DMEM) at 37&#xb0;C and 5% CO<sub>2</sub>. Rutin was purchased from Shandong Sparkjade Biotechnology Co., Ltd (Jinan, China) and dissolved with DMSO. CoPP (HO-1 inducer) was purchased from Sigma-Aldrich (St. Louis, Missouri, USA). The EqHV-8 isolates were used for this study as follows: SDLC66 (GenBank: MW816102.1), SD2020113 (GenBank: MW822570.1), donkey/Shandong/10/2021 (GenBank: OL856098.1). These EqHV-8 strains were proliferated in MDBK cells, and titrated by a plaque formation assay as previous reported (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2023</xref>). The anti-EqHV-8-positive serum and mouse anti-gD polyclonal antibody were prepared in our lab. Anti-Nrf2 rabbit pAb, Anti-HO-1 mouse mAb and Anti-&#x3b1;-Tubulin mouse mAb were obtained from Servicebio (Wuhan, China), and horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (H+L) and horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG (H+L) were purchased from Jackson (Lancaster, Pennsylvania, USA).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Cell viability assay</title>
<p>RK-13 and MDBK cells were seeded into 96-well plates (1&#xd7;10<sup>4</sup>/well) overnight respectively. These cells were incubated with Rutin at various concentrations (10 &#x3bc;M, 20 &#x3bc;M, 40 &#x3bc;M, 80 &#x3bc;M, 160 &#x3bc;M and 200 &#x3bc;M) for 24 h. then, these cells were incubated with the CCK-8 reagent (10 &#x3bc;L/well) for 2 h. The number of viable cells was determined by the EpochTM Microplate spectrophotometer (BioTek, USA) at 450 nm. Finally, these data were analyzed using GraphPad Prism 8.0.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>EqHV-8 inhibition assay</title>
<p>RK-13 and MDBK cells were seeded into 12-wells plates respectively and cultured overnight at 37&#xb0;C and 5% CO<sub>2</sub>. These cells were pre-incubated with Rutin at different concentrations (40 &#x3bc;M, 80 &#x3bc;M, or 160 &#x3bc;M) for 1 h, then infected with EqHV-8 SDLC66(MOI=0.1). The cell samples and cellular supernatant were collected to analyze EqHV-8 replication at 24 h post-infection (hpi) by western blotting and qPCR. Further, the inhibition experiments also performed as follows, the RK-13 and MDBK cells pre-treated with Rutin (160 &#xb5;M) for 1 h, then infected with EqHV-8 SDLC66 at various MOI (0.1, 0.5, and 1). The cell samples and cellular supernatant were collected to analyze EqHV-8 replication at 24 hpi by qPCR.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Direct inactivation assay and time course analysis of Rutin against EqHV-8</title>
<p>To test whether Rutin could inactivate the EqHV-8, the RK-13 cells were seeded into 12-well cell plates overnight. The EqHV-8 SDLC66 (0.1 MOI, and 0.5 MOI) was incubated with Rutin (160 &#xb5;M) at 37&#xb0;C for 1&#x2009;h, the mixture EqHV-8 and Rutin was incubated in those cells for 1 h. Finally, these cells were harvested to analyze glycoprotein D protein (gD) expression by qPCR and western blotting at 24 hpi. To further determine the stage of the EqHV-8 life cycle interfered with by Rutin, RK-13 cells were cultured into 12-well plates and termed as pre-treated, co-treated, and post-treated with Rutin (160 &#xb5;M) relative to the EqHV-8 (MOI=0.1) inoculation groups. After 24 h, the cells were collected to examine the gD expression of EqHV-8 by qPCR and western blotting.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Real-time quantitative PCR</title>
<p>The total RNA of cells samples was extracted by TriQuick Reagent (Solarbio, China), and 1 &#x3bc;g of the total RNA was converted to cDNA using the PrimeScript&#x2122; RT Master Mix kit (Takara, Japan) according to the manufacturer&#x2019;s instructions. The qPCR was performed using a StepOnePlus<sup>&#xae;</sup> Real-Time PCR applied biosystems (Thermo, USA), the gene expressions of gD, Nrf2, and HO-1 were detected and normalized against those of GADPH using the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> threshold cycle (CT) method as previously described (<xref ref-type="bibr" rid="B20">Li et&#xa0;al., 2022</xref>). All primers are listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The absolute quantification (qPCR) was performed to detect the copy number of EqHV-8 genome DNA as described previously (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2023</xref>). The recombinant plasmid of pMD18-T-<italic>ORF72</italic> served as the template to calculate the EqHV-8 genome DNA copies.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>The primers in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primers</th>
<th valign="top" align="left">Primer sequences (5&#xb4;-3&#xb4;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">HO-1-F</td>
<td valign="top" align="left">AGTTCATGAAGAACTTTCA</td>
</tr>
<tr>
<td valign="top" align="left">HO-1-R<break/>Nrf2-F<break/>Nrf2-R</td>
<td valign="top" align="left">TACCAGAAGGCCATGTCC<break/>ATTCAATGATTCTGACTCTG<break/>CGTATCCCCAGAAGAATGTA</td>
</tr>
<tr>
<td valign="top" align="left">ORF72-F</td>
<td valign="top" align="left">CCCACGTGTGCAACGCCTAT</td>
</tr>
<tr>
<td valign="top" align="left">ORF72-R</td>
<td valign="top" align="left">ATACAGTCCCGAGGCAGAGT</td>
</tr>
<tr>
<td valign="top" align="left">EHV8-gD-F</td>
<td valign="top" align="left">GATGCCAAACCGAATCAGCC</td>
</tr>
<tr>
<td valign="top" align="left">EHV8- gD-R</td>
<td valign="top" align="left">TAGGCGAGTCAAGCCGTTTT</td>
</tr>
<tr>
<td valign="top" align="left">GAPDH-F</td>
<td valign="top" align="left">CCTTCCGTGTCCCTACTGCCAAC</td>
</tr>
<tr>
<td valign="top" align="left">GAPDH-R</td>
<td valign="top" align="left">GACGCCTGCTTCACCACCTTCT</td>
</tr>
<tr>
<td valign="top" align="left">siRNA-HO-1</td>
<td valign="top" align="left">GGTCCTCACACTCAGCTTT</td>
</tr>
<tr>
<td valign="top" align="left">siRNA-Nrf2</td>
<td valign="top" align="left">CTCCTTAAGAAGCAACTCA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Western blotting</title>
<p>All cell samples were harvested, and lysed with NP-40 lysis buffer (Solarbio, China) and mixed with 5&#xd7; sample loading buffer. Next, the proteins were loaded onto 12% sodium dodecyl sulfate&#x2013;polyacrylamide gel electrophoresis (SDS&#x2013;PAGE) gels with equal amounts and transferred onto polyvinylidene fluoride (PVDF) membranes as described previously (<xref ref-type="bibr" rid="B38">Wang et&#xa0;al., 2019</xref>). The PVDF membranes were blocked with 2.5% skimmed milk and incubated with anti-Nrf2, anti-HO-1 mAb, anti-&#x3b1;-Tubulin mAb (Servicebio, China), or anti-EqHV-8 gD polyclonal antibody. HRP-conjugated goat anti-mouse or goat anti-rabbit IgG was used as the secondary antibody. Then, the protein band signals were detected by ChemiDoc XRS imaging system (Bio-Rad) with an Enhanced Chemiluminescent (ECL) kit (Bio-Rad, USA).</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>ROS, MDA, SOD, and GSH-PX detection</title>
<p>Dichlorofluorescein (DCF) ROS detection kits were purchased from Beyotime Biotechnology (Nanjing, China), MDA detection kit, SOD detection kit, and GSH-PX detection kit were obtained from Jiancheng Bioengineering Institute (Nanjing, China). These kits were used to determine the expression of ROS, MDA, SOD and GSH-PX in RK-13 cells according to the manufacturer instructions respectively. ROS production were observed using Leica DMi8. Meanwhile, the fluorescent intensity was measured by Spark microplate reader (Tecan, Switzerland).MDA, SOD and GSH-PX generation were detected by Epoch microplate spectrophotometer (BIOTEK, USA). The levels were normalized to protein concentrations measured by Pierce&#x2122; BCA Protein Assay Kit (Thermo, Massachusetts, USA).</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>RNAi assay</title>
<p>The siRNAs targeting the Nrf2 and HO-1 genes were synthesized by Ribo Biotechnology Co., Ltd. (Guangdong, China). The siRNA knockdown assay was performed as previously described (<xref ref-type="bibr" rid="B20">Li et&#xa0;al., 2022</xref>). In brief, the RK-13 cells were transfected with these siRNAs according to the Lipo 6000 protocol (Beyotime, China), respectively, and non-targeting siRNA served as a negative control. The total RNA of these cells was extracted using TRizol reagent. The mRNA levels of the Nrf2, HO-1, and EqHV-8 gD gene were determined by qPCR and normalized against those of GAPDH by the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> threshold cycle (CT) method. All the samples were performed in three independent experiments.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Animal experiments</title>
<p>The EqHV-8 challenge assay was performed as previously described (<xref ref-type="bibr" rid="B39">Wang et&#xa0;al., 2022a</xref>). Briefly, fifteen specific pathogen-free, 6-week-old male BALB/c mice were obtained from the Pengyue Experimental Animal Breeding Co., Ltd (Jinan, China) and divided into three groups randomly (n =5 mice/group). Group 1 mice were inoculated intranasally with 100 &#x3bc;L of DMEM and served as Mock group, Group 2 mice were inoculated intraperitoneally with 100 &#x3bc;L of DMSO solution (at final concentration 0.1%), and Group 3 were incubated Rutin (35 mg/kg) intraperitoneally. Mice of Group 2, Group 3 were challenged intranasally with 100 &#x3bc;L of EqHV-8 SDLC66 (1&#xd7;10<sup>5</sup> Pfu/mice), then inoculated intraperitoneally with DMSO or Rutin at -1, 1 and 2 day post infection (dpi). Mice in each group were housed separately to prevent cross-infection. Notably, the incubation of EqHV-8, DMEM, Rutin or DMSO into mice was performed under deep anesthesia by Zoletil 50 (Virbac, Nice, France). The clinical symptoms of mice were monitored daily. Blood was collected at 3, 5, 7 dpi, and the lungs of all mice were obtained via euthanizing by cervical dislocation at 8 dpi, which was used to assess viremia and histopathology change.</p>
<sec id="s2_9_1">
<label>2.9.1</label>
<title>Viremia detection</title>
<p>The viral DNA of serum was extracted by viral DNA extraction kit (Omega Bio-Tek, USA) according to the manufacturer&#x2019;s protocol. The EqHV-8 genome copies in the serum were calculated by absolute qPCR based on part <italic>ORF72</italic> gene as previously described (<xref ref-type="bibr" rid="B19">Li et&#xa0;al., 2023</xref>).</p>
</sec>
<sec id="s2_9_2">
<label>2.9.2</label>
<title>Histopathology evaluation</title>
<p>The hematoxylin and eosin (HE) assay were performed to evaluate histopathological changes in lungs from different groups mice at 8 dpi as previously described (<xref ref-type="bibr" rid="B39">Wang et&#xa0;al., 2022a</xref>). Briefly, lungs of each group were fixed into 10% formalin solution, underwent dehydration by alcohol, transparentized in xylene, and then embedded in paraffin wax. further sliced in a microtome (Leica, Nussloch, Germany) to 4 &#xb5;m, affixed onto slides, followed by deparaffinization, clearance, then, diluted with 75% and 95% alcohols, and hematoxylin solution stains. The tissue slices were differentiated, using 95% or 100% alcohol directly after the eosin stain, and, after cleared, placed on a coverslip to be observed by light microscopy.</p>
</sec>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Statistical analysis</title>
<p>Statistical analysis was performed using GraphPad Prism software. Differences among the groups were analyzed by unpaired Student&#x2019;s t-test. Significance is indicated as follows: *, P &lt; 0.05; **, P &lt; 0.01; and ***, P &lt; 0.001.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Chemical structure and cytotoxicity of Rutin</title>
<p>The chemical structure of Rutin is illustrated in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>. The cytotoxicity of Rutin in RK-13 and MDBK cells was determined using the CCK-8 kit. Our data showed that the maximum safe concentration of Rutin in these cells is 160 &#x3bc;M (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Chemical structure and cytotoxicity of Rutin; <bold>(A)</bold> The chemical structure of Rutin. <bold>(B)</bold> The cytotoxicity of Rutin in RK-13 and MDBK cells. Cells were seeded in 96-well cell plates and treated with different concentrations of Rutin (10 &#x3bc;M, 20 &#x3bc;M, 40 &#x3bc;M, 80 &#x3bc;M, 160&#x3bc;M and 200 &#x3bc;M) for 24 h. The viability of cells was determined using the CCK-8 assay. These data are representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Rutin decreases EqHV-8 replication in susceptible cell</title>
<p>To assess the potential anti-EqHV-8 activity of Rutin <italic>in vitro</italic>, RK-13 and MDBK cells were pre-treated with varying concentrations of Rutin (0 &#x3bc;M, 40 &#x3bc;M, 80 &#x3bc;M, and 160 &#x3bc;M) for 1 h and subsequently infected with EqHV-8 SDLC66 at 0.1 MOI. The CPE of different concentrations Rutin treated group were observed and imaged at 24 hpi (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). Then, both cellular samples and cellular supernatants were subjected to analysis for EqHV-8 replication through western blotting and qPCR. As depicted in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>, Rutin exhibited a dose-dependent reduction in gD protein expression in RK-13 cells. Consistent with the protein analysis results, the production of progeny viruses in the Rutin-treated group showed a significant decrease compared to the group treated with DMSO, as illustrated in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>. Similar outcomes were observed in MDBK cells, as shown in <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2D</bold>
</xref> and <xref ref-type="fig" rid="f2">
<bold>2E</bold>
</xref>. Further, RK-13 and MDBK cells were pre-treated with Rutin (0 &#x3bc;M, or 160 &#x3bc;M) for 1 h and subsequently infected with EqHV-8 SDLC66 at different MOI (0.1, 0.5 and 1MOI). As illustrated in <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2F, G</bold>
</xref>, Rutin reduces progeny virus generation in RK-13 and MDBK cells.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Anti-EqHV-8 activity of Rutin in susceptible cells. RK-13 cells were pre-incubated with different concentrations of Rutin for 1 h and afterward infected with EqHV-8 SDLC66 at 0.1 MOI. The CPE of different groups were observed and imaged by Leica DMi8 microscope <bold>(A)</bold>. The production of gD protein was analyzed by western blotting <bold>(B)</bold>, and the progeny virus&#x2019;s generation was measured by qPCR <bold>(C)</bold>. MDBK cells were pretreated with Rutin using the same protocol, and the EqHV-8 replication was determined by western blotting <bold>(D)</bold>, and qPCR <bold>(E)</bold>. RK-13 <bold>(F)</bold> and MDBK <bold>(G)</bold> cells pre-treated with Rutin (160 &#xb5;M) for 1 h, then infected with EqHV-8 SDLC66 at various MOI (0.1, 0.5, and 1). The progeny virus generation was detected by qPCR at 24 hpi. &#x3b1;-Tubulin as a loading control. The data shown are representatives from three independent experiments and subjected to unpaired student&#x2019;s t-tests. **P &lt; 0.01 (compared with DMSO-treated cells), ***P &lt; 0.001 (compared with DMSO-treated cells). These data are representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Rutin inhibits other EqHV-8 strains&#x2019; infection</title>
<p>We further assessed the antiviral activity of Rutin against other EqHV-8 strains, including SD2020113 and donkey/Shandong/10/2021, in both RK-13 and MDBK cells. EqHV-8 replication was evaluated using western blotting and qPCR. The results demonstrated a significant decrease in gD protein expression in Rutin-treated RK-13 cells compared to the DMSO-treated group, as depicted in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>. Similar outcomes were observed in MDBK cells, as illustrated in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>. In accordance with the western blotting results, the production of EqHV-8 progeny was also significantly reduced in the Rutin-treated group in both RK-13 (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>) and MDBK cells (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>). Our data collectively indicate that Rutin exhibits broad-spectrum anti-EqHV-8 infection activity.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Rutin inhibits other strains of EqHV-8 infection in susceptible cells. The RK-13 and MDBK cells were incubated with the presence or absence of Rutin (160 &#xb5;M) for 1 h, then infected with SDLC66, SD2020113, donkey/Shandong/10/2021 strains 1 h at 37&#xb0;C, respectively. The EqHV-8 replication at 24 hpi was evaluated by western blotting in RK-13 cells <bold>(A)</bold> or MDBK cells <bold>(B)</bold>. The progeny virus generation was tested by qPCR in RK-13 cells <bold>(C)</bold> or MDBK cells <bold>(D)</bold>. ***, P &lt; 0.001 compared with DMSO-treated cells challenged with the same virus. These data are representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Rutin reduces EqHV-8 infection at different stages</title>
<p>To ascertain whether EqHV-8 could be effectively inactivated by Rutin directly, we conducted experiments employing RK-13 cells. These cells were subjected to incubation with a mixture containing Rutin at a concentration of 160 &#x3bc;M and EqHV-8 at varying dosages, specifically 0.1 MOI and 0.5 MOI. As illustrated in <xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>, there was no discernible alteration in gD expression between the DMSO-treated group and the Rutin-treated group. This observation implies that Rutin does not possess the capability to directly inactivate EqHV-8.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Rutin inhibits EqHV-8 infection at multiple stages of the virus life cycle. <bold>(A, B)</bold> Rutin could not inactivate EqHV-8 directly. EqHV-8 SDLC66 with different dose age (0.1 MOI or 0.5 MOI) pre-incubated with Rutin (160 &#xb5;M) for 1 h at 37&#xb0;C, then the mixture was added into RK-13 cells. qPCR and western blotting were used to evaluate gD protein expression at 24 hpi. <bold>(C)</bold> Schematic diagram of Rutin-treated cells, the RK-13 cells were infected with 0.1 MOI EqHV-8 SDLC66 and treated with Rutin (160 &#xb5;M) at different times of infection, including all-stage treatment, pre-treatment, co-treatment, and post-treatment. The expression of gD protein was determined by qPCR <bold>(D)</bold> and western blotting <bold>(E)</bold> at 24 hpi. GAPDH served as an internal control. &#x3b1;-Tubulin acts as a loading control. The data shown are representatives from three independent experiments subjected to unpaired Student&#x2019;s t-tests. ***P &lt; 0.001 (compared with DMSO-treated group cells). These presented data is the representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g004.tif"/>
</fig>
<p>To further elucidate the specific stage of the EqHV-8 replication cycle that may be affected by Rutin, we conducted a time-of-addition experiment, as depicted in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>. In this experiment, S1 represents the DMSO-treated group, which serves as the control. S2 signifies Rutin treatment administered at all stages of EqHV-8 infection. S3 represents the Rutin pre-treated group, while S4 designates the Rutin and EqHV-8 co-treated group. Lastly, S5 denotes the Rutin post-treated group. Subsequently, RK-13 cells were collected at 24 hpi to measure the expression of the gD protein and assess the production of progeny viruses. The results revealed a noteworthy decrease in gD expression, both at the transcriptional and protein levels, in the S2, S3, S4, and S5 groups when compared to the S1 control group (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4D, E</bold>
</xref>). These findings collectively indicate that Rutin exerts inhibitory effects on EqHV-8 infection at multiple stages within the virus&#x2019;s life cycle.</p>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Rutin alleviates EqHV-8&#x2212;stimulated oxidative stress via Nrf2/HO-1 axis</title>
<p>In order to investigate whether Rutin has the potential to modulate Nrf2/HO-1 expression, we subjected RK-13 cells to various dosages of Rutin treatment for a duration of 24 h. Subsequently, the cells were harvested for the analysis of Nrf2/HO-1 expression using both qPCR and Western blotting techniques. As depicted in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>, the mRNA levels of Nrf2 and HO-1 exhibited a significant increase in response to Rutin treatment when compared to the DMSO-treated group. Concurrently, the changes observed in gD protein levels were consistent with the alterations observed at the mRNA level, as illustrated in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>. To further explore the anti-EqHV-8 effect of Rutin in association with Nrf2/HO-1 activation, we conducted experiments involving RK-13 cells. These cells were pre-incubated with Rutin, siNrf2, or siHO-1, followed by infection with EqHV-8. Subsequently, the expression of Nrf2, HO-1, and gD genes was analyzed. Our results clearly demonstrated that Rutin reduced the expression of the gD gene by inducing Nrf2 and HO-1. This effect was reversed upon treatment with siNrf2 or siHO-1, as observed at both the transcriptional level (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5C, D</bold>
</xref>) and the protein level (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5E</bold>
</xref>).</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Rutin decrease EqHV-8 infection via Nrf2/HO-1 activation. The RK-13 cell was treated by Rutin with different concentrations (40 &#x3bc;M, 80 &#x3bc;M, and 160 &#x3bc;M) or CoPP (100 &#x3bc;M) for 24 h, then collected to analyze Nrf2/HO-1 expression by RT-qPCR <bold>(A)</bold> and western blotting <bold>(B)</bold> ***, P &lt; 0.001, compared with DMSO treated cells. <bold>(C&#x2013;E)</bold> The RK-13 cell were transfected by siNrf2 or siHO-1 for 12 h, and treated by Rutin (160 &#x3bc;M) for 1 h, the cells were infected with 0.1 MOI EqHV-8 SDLC66 for 1 h, the Nrf2, HO-1, and gD expression were determined by qPCR and western blotting at 24 hpi. GAPDH served as an internal control. &#x3b1;-Tubulin acts as a loading control. **, P &lt; 0.01, ***, P &lt; 0.001, compared with DMSO or siNC treated cells. These data are representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g005.tif"/>
</fig>
<p>In order to further investigate and analyze whether the anti-EqHV-8 activity of Rutin is associated with its antioxidant properties, we subjected RK-13 cells to pre-treatment with varying concentrations of Rutin, and infected with EqHV-8. As depicted in <xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>. EqHV-8 infection increases significantly the ROS generation in DMSO-treated group. However, Rutin treatment obviously attenuates the ROS production in EqHV-8 infected cells. Subsequently, the levels of MDA within the RK-13 cells were quantified using MDA detection kit. Our findings revealed that EqHV-8 infection led to a notable increase in MDA levels, while Rutin treatment effectively reduced MDA levels in EqHV-8 infected cells when compared to the DMSO-treated group (as shown in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). In contrast, Rutin treatment also resulted in the upregulation of other important biomarkers, specifically SOD and GSH-PX expression, as illustrated in <xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6D, E</bold>
</xref>. Importantly, these effects of Rutin were found to be reversible upon the administration of specific siHO-1 or siNrf2. Collectively, our data strongly suggest that the anti-EqHV-8 activity of Rutin is largely contingent upon the Nrf2/HO-1-mediated antioxidant stress response.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Rutin lessen oxidative stress induced by EqHV-8 infection. The RK-13 cells were transfected by siNrf2 or siHO-1 for 10 h, and pre-incubated with Rutin (160 &#xb5;M) for 1 h, then infected with EqHV-8 SDLC66 0.1 MOI for 1 h, and ROS generation in RK-13 cells at 24 hpi was determined using DCFH-DA assay. The fluorescence was observed using Leica DMi8 <bold>(A)</bold> and measured by a Spark microplate reader <bold>(B)</bold>. The effects of Rutin on MDA <bold>(C)</bold>, SOD <bold>(D)</bold>, and GSH <bold>(E)</bold> levels in RK-13 cells were also detected at 24 hpi. **, P &lt; 0.01,***, P &lt; 0.001. These data are representative of three independent experiments.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g006.tif"/>
</fig>
</sec>
<sec id="s3_6">
<label>3.6</label>
<title>Rutin inhibits EqHV-8 infection <italic>in vivo</italic>
</title>
<p>To further corroborate the potential antiviral effect of Rutin against EqHV-8 infection <italic>in vivo</italic>, we conducted an assessment of viremia and histopathological lesions in a mouse model. <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7A</bold>
</xref> provides an overview of the experimental design. In the serum, Rutin treatment led to a significant reduction in EqHV-8 copies when compared to the group infected solely with EqHV-8, as depicted in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7B</bold>
</xref>. Microscopic examination of lung lesions in the group infected only with EqHV-8 revealed several pathological features, including thickened alveolar septa, an increased number of inflammatory cells, hyperemia, and hemorrhage of alveolar septa. Rutin administration conspicuously ameliorated lung damage in the mouse model, as illustrated in <xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7C</bold>
</xref>.</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Rutin has antiviral activity against EqHV-8 <italic>in vivo</italic> analysis. <bold>(A)</bold> The pattern diagram of the animal experiments. <bold>(B)</bold> Viral load in sera of mice from each group were measured by qPCR. The results are presented as the mean &#xb1; SD (error bars). **P&lt;0.01, ***P&lt;0.001. <bold>(C)</bold> Representative images of hematoxylin and eosin (H&amp;E) in the lungs derived from mice in indicated groups. Bar, 100 &#xb5;m.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g007.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>In recent years, the emergence of EqHV-8 in equids, specifically donkeys and horses, has garnered significant attention due to its detrimental impact on the equine industry. EqHV-8 has been identified as a causative agent of abortion, respiratory diseases, and neurological disorders in these animals, resulting in substantial economic losses within the industry (<xref ref-type="bibr" rid="B23">Liu et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B12">Garvey et&#xa0;al., 2018</xref>). Notably, our previous research endeavors have elucidated the severity of EqHV-8 infection, particularly in donkeys from large-scale farms, emphasizing its high prevalence in China and its profound threat to the donkey industry (<xref ref-type="bibr" rid="B39">Wang et&#xa0;al., 2022a</xref>; <xref ref-type="bibr" rid="B40">Wang et&#xa0;al., 2022b</xref>; <xref ref-type="bibr" rid="B41">Wang et&#xa0;al., 2023</xref>). Despite the devastating consequences of EqHV-8 infection, an effective intervention strategy, such as antiviral drugs or vaccines, has remained elusive until the present day. This knowledge gap prompted our investigation into potential therapeutic options against EqHV-8. Our current study has provided compelling evidence that Rutin, a naturally occurring flavonoid, exhibits potent antiviral activity against EqHV-8 infection through the modulation of the Nrf2/HO-1-mediated antioxidant stress response pathway.</p>
<p>In the realm of animal studies, there exists a robust body of research indicating that herpesvirus infection imposes a noteworthy physiological burden in the form of oxidative stress (<xref ref-type="bibr" rid="B7">Costantini et&#xa0;al., 2018</xref>). Specifically, their investigation highlights the correlation between herpesvirus infection and an elevated generation of ROS, resulting in molecular oxidative damage. Furthermore, this pathological process is accompanied by discernible alterations in both non-enzymatic and enzymatic antioxidant defense mechanisms (<xref ref-type="bibr" rid="B35">Sebastiano et&#xa0;al., 2016</xref>). Rutin has garnered increasing attention in recent years due to its diverse biological effects, encompassing antioxidant, anti-inflammatory, antidiabetic, antimicrobial, and anti-cancer properties (<xref ref-type="bibr" rid="B32">Perk et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B5">Budzynska et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B15">Khan et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B26">Mazik, 2022</xref>). Moreover, Rutin has demonstrated broad-spectrum antiviral activity against several viral pathogens, including influenza virus, hepatitis C virus, norovirus, enterovirus A71, and even the notorious SARS-CoV-2 (<xref ref-type="bibr" rid="B21">Lin et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B6">Ch&#xe9;ron et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B44">Zakaryan et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B22">Ling et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B26">Mazik, 2022</xref>). Our investigation extends this repertoire by showcasing the inhibitory effects of Rutin on EqHV-8 infection. To delve into the specifics of our findings, Rutin was found to significantly reduce EqHV-8 infection in RK-13 and MDBK cells in a dose-dependent manner, as illustrated in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>. Subsequent experiments con-firmed the broad-spectrum antiviral activity of Rutin against various EqHV-8 strains, as depicted in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>. Furthermore, our research elucidated that Rutin exerts its antiviral effects by disrupting multiple stages of the EqHV-8 life cycle, as evidenced in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>. Of particular interest is our discovery that Rutin plays a pivotal role in reducing the oxidative stress induced by EqHV-8. Nrf2/HO-1 has been reported to play a critical mediator in regulating antioxidative and antiviral immune response (<xref ref-type="bibr" rid="B24">Loboda et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B25">Ma et&#xa0;al., 2024</xref>). Previous studies have shown that Rutin via Nrf2/HO-1signaling pathway relieve oxidative stress (<xref ref-type="bibr" rid="B27">Mihic et&#xa0;al., 2022</xref>; <xref ref-type="bibr" rid="B42">Wu et&#xa0;al., 2023</xref>; <xref ref-type="bibr" rid="B18">Lee et&#xa0;al., 2024</xref>). In typical physiological conditions, the Nrf2 is primarily located within the cellular cytoplasm and forms a complex with its inhibitory partner, Kelch-like ECH-associated protein 1 (Keap1) (<xref ref-type="bibr" rid="B3">Bellezza et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B1">Abdul-Muneer, 2023</xref>). However, when the cellular environment encounters an elevated presence of ROS, the Keap1-Nrf2 complex undergoes dissociation, leading to the translocation of Nrf2 from the cytoplasm into the cellular nucleus. Once in the nucleus, Nrf2 exerts its regulatory function by promoting the transcription of genes that contain antioxidant response elements (ARE) (NQO1, HO-1), which are crucial components of the antioxidant response system. Furthermore, upon regulation, The products of ARE-linked genes remarkable counteract and neutralize ROS-induced oxidative damage (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>) (<xref ref-type="bibr" rid="B37">Tonelli et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B14">Han et&#xa0;al., 2019</xref>). Our cur-rent findings showed this effect of Rutin may attributed to its the regulation of the Nrf2/HO-1 signaling pathway, as demonstrated in <xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>6</bold>
</xref>, and <xref ref-type="fig" rid="f8">
<bold>8</bold>
</xref>. This mechanistic insight underscores the multifaceted nature of Rutin&#x2019;s antiviral action against EqHV-8, linking it to the modulation of critical cellular pathways involved in the antioxidant response. Moreover, our study extended beyond <italic>in vitro</italic> cell culture models to validate the protective effect of Rutin against EqHV-8 infection in a mouse model. As depicted in <xref ref-type="fig" rid="f7">
<bold>Figures&#xa0;7B, C</bold>
</xref>, Rutin administration effectively mitigated viremia and reduced lung damage induced by EqHV-8 in this <italic>in vivo</italic> setting, providing further support for its therapeutic potential.</p>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Schematic exhibition that Rutin decrease EqHV-8 infection. Rutin inhibits EqHV-8 infection at multiple stages to susceptible cell. Noteworthy, Rutin treatment also activates Nrf2 and its downstream HO-1 and NQO1, which leads to decreases oxidative stress with a suppression of ROS and MDA, and an increase of GSH and SOD in host cellular, resulting in an inhibition of EqHV-8 replication.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1386462-g008.tif"/>
</fig>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>In conclusion, this study provides compelling evidence for Rutin&#x2019;s potential as an effective therapeutic agent against EqHV-8 infections. Rutin&#x2019;s ability to inhibit viral replication and alleviate oxidative stress through the Nrf2/HO-1 pathway highlights its promise as a candidate for future anti-EqHV-8 drug development. This research represents a significant step toward addressing the challenges posed by EqHV-8 in the equine industry. However, further investigations are warranted to elucidate the detailed molecular mechanisms involved in Rutin&#x2019;s antiviral activity and its potential application as a veterinary medicine.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was approved by Animal Welfare and Ethics Committee of Institute of Animal Science, Liaocheng University (protocol number LC2023-09). The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>LC: Software, Resources, Investigation, Formal analysis, Data curation, Writing &#x2013; review &amp; editing, Writing &#x2013; original draft, Methodology. SL: Writing &#x2013; review &amp; editing, Writing &#x2013; original draft, Methodology, Investigation, Formal analysis, Data curation. WL: Software, Writing &#x2013; review &amp; editing, Data curation. YY: Data curation, Methodology, Formal analysis, Validation, Software, Writing &#x2013; review &amp; editing. QS: Writing - review &amp; editing, Data cuartion, Methodology, Formal analysis, Validation. WC: Investigation, Writing &#x2013; review &amp; editing, Data curation. HZ: Software, Writing &#x2013; review &amp; editing, Investigation, Data curation. CW: Writing &#x2013; review &amp; editing, Visualization, Validation, Project administration, Conceptualization. LL: Writing &#x2013; review &amp; editing, Software, Investigation, Data curation. MX: Writing &#x2013; review &amp; editing, Investigation, Data curation. MK: Writing &#x2013; original draft, Validation, Supervision, Methodology, Writing &#x2013; review &amp; editing. YL: Writing &#x2013; review &amp; editing, Writing &#x2013; original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Conceptualization. TW: Writing &#x2013; review &amp; editing, Writing &#x2013; original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Conceptualization.</p>
</sec>
</body>
<back>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by grants from the Project of Shandong Province Higher Educational Science and Technology Program for Youth (2022KJ287), the Innovation and Entrepreneurship Program for College Students (CXCY2023302, CXCY2023275, S202310447042), and the Project of Liaocheng University Animal Husbandry Discipline (31946220701, 31946220726), and the National Natural Science Foundation of China (32002248).</p>
</sec>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdul-Muneer</surname> <given-names>P. M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Nrf2 as a potential therapeutic target for traumatic brain injury</article-title>. <source>J. Integr. Neurosci.</source> <volume>22</volume>, <fpage>81</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.31083/j.jin2204081</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agrawal</surname> <given-names>P. K.</given-names>
</name>
<name>
<surname>Agrawal</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Blunden</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Rutin: A potential antiviral for repurposing as a SARS-CoV-2 main protease (Mpro) inhibitor</article-title>. <source>Natural Product Commun.</source> <volume>16</volume>, <fpage>1934578X21991723</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1177/1934578X21991723</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bellezza</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Giambanco</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Minelli</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Donato</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Nrf2-Keap1 signaling in oxidative and reductive stress</article-title>. <source>Biochim. Biophys. Acta Mol. Cell Res.</source> <volume>1865</volume>, <fpage>721</fpage>&#x2013;<lpage>733</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbamcr.2018.02.010</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Browning</surname> <given-names>G. F.</given-names>
</name>
<name>
<surname>Ficorilli</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Studdert</surname> <given-names>M. J.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>Asinine herpesvirus genomes: comparison with those of the equine herpesviruses</article-title>. <source>Arch. Virol.</source> <volume>101</volume>, <fpage>183</fpage>&#x2013;<lpage>190</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF01310999</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Budzynska</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Faggio</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Kruk-Slomka</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Samec</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Nabavi</surname> <given-names>S. F.</given-names>
</name>
<name>
<surname>Sureda</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Rutin as neuroprotective agent: from bench to bedside</article-title>. <source>Curr. Med. Chem.</source> <volume>26</volume>, <fpage>5152</fpage>&#x2013;<lpage>5164</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/0929867324666171003114154</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ch&#xe9;ron</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Kolawole</surname> <given-names>A. O.</given-names>
</name>
<name>
<surname>Shakhnovich</surname> <given-names>E. I.</given-names>
</name>
<name>
<surname>Wobus</surname> <given-names>C. E.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Repurposing of rutin for the inhibition of norovirus replication</article-title>. <source>Arch. Virol.</source> <volume>160</volume>, <fpage>2353</fpage>&#x2013;<lpage>2358</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-015-2495-y</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Costantini</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Seeber</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>Soilemetzidou</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Azab</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Bohner</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Buuveibaatar</surname> <given-names>B.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Physiological costs of infection: herpesvirus replication is linked to blood oxidative stress in equids</article-title>. <source>Sci. Rep.</source> <volume>8</volume>, <fpage>10347</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-018-28688-0</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Davison</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Eberle</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Ehlers</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Hayward</surname> <given-names>G. S.</given-names>
</name>
<name>
<surname>McGeoch</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Minson</surname> <given-names>A. C.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>The order herpesvirales</article-title>. <source>Arch. Virol.</source> <volume>154</volume>, <fpage>171</fpage>&#x2013;<lpage>177</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-008-0278-4</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Jesus</surname> <given-names>L. B.</given-names>
</name>
<name>
<surname>Frota</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>de Araujo</surname> <given-names>F. M.</given-names>
</name>
<name>
<surname>de Jesus</surname> <given-names>R. L. C.</given-names>
</name>
<name>
<surname>Costa</surname> <given-names>M. F. D.</given-names>
</name>
<name>
<surname>de Vasconcelos</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Effect of the flavonoid rutin on the modulation of the myenteric plexuses in an experimental model of Parkinson's disease</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume>, <fpage>1037</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ijms25021037</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ficorilli</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Studdert</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Crabb</surname> <given-names>B. S.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>The nucleotide sequence of asinine herpesvirus 3 glycoprotein G indicates that the donkey virus is closely related to equine herpesvirus 1</article-title>. <source>Arch. Virol.</source> <volume>140</volume>, <fpage>1653</fpage>&#x2013;<lpage>1662</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF01322539</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ganeshpurkar</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Saluja</surname> <given-names>A. K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The pharmacological potential of rutin</article-title>. <source>Saudi Pharm. J.</source> <volume>25</volume>, <fpage>149</fpage>&#x2013;<lpage>164</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jsps.2016.04.025</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garvey</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Suarez</surname> <given-names>N. M.</given-names>
</name>
<name>
<surname>Kerr</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Hector</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Moloney-Quinn</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Arkins</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Equid herpesvirus 8: Complete genome sequence and association with abortion in mares</article-title>. <source>PloS One</source> <volume>13</volume>, <elocation-id>e0192301</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0192301</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Ding</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Design, synthesis, and antiviral activity of novel rutin derivatives containing 1, 4-pentadien-3-one moiety</article-title>. <source>Eur. J. Medicinal Chem.</source> <volume>92</volume>, <fpage>732</fpage>&#x2013;<lpage>737</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ejmech.2015.01.017</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Han</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Dietary melatonin attenuates chromium-induced lung injury via activating the Sirt1/Pgc-1&#x3b1;/Nrf2 pathway</article-title>. <source>Food Funct.</source> <volume>10</volume>, <fpage>5555</fpage>&#x2013;<lpage>5565</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1039/C9FO01152H</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Pandey</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Upadhyay</surname> <given-names>T. K.</given-names>
</name>
<name>
<surname>Jafri</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Jha</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Mishra</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Anti-cancerous effect of rutin against HPV-C33A cervical cancer cells via G0/G1 cell cycle arrest and apoptotic induction</article-title>. <source>Endocr Metab. Immune Disord. Drug Targets</source> <volume>20</volume>, <fpage>409</fpage>&#x2013;<lpage>418</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2174/1871530319666190806122257</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kovacsics</surname> <given-names>C. E.</given-names>
</name>
<name>
<surname>Gill</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Ambegaokar</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Gelman</surname> <given-names>B. B.</given-names>
</name>
<name>
<surname>Kolson</surname> <given-names>D. L.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Degradation of heme oxygenase-1 by the immunoproteasome in astrocytes: A potential interferon-gamma-dependent mechanism contributing to HIV neuropathogenesis</article-title>. <source>Glia</source> <volume>65</volume>, <fpage>1264</fpage>&#x2013;<lpage>1277</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/glia.23160</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lai</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Rutin attenuates oxidative stress via PHB2-mediated mitophagy in MPP (+)-induced SH-SY5Y cells</article-title>. <source>Neurotox. Res.</source> <volume>41</volume>, <fpage>242</fpage>&#x2013;<lpage>255</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s12640-023-00636-5</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>K. K.</given-names>
</name>
<name>
<surname>Sung</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sung</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2024</year>). <article-title>Antioxidant and antimelanogenic activities of lactobacillus kunkeei NCHBL-003 isolated from honeybees</article-title>. <source>Microorganisms</source> <volume>12</volume>, <fpage>188</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/microorganisms12010188</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Cobalt protoporphyrin blocks EqHV-8 infection via IFN-alpha/beta production</article-title>. <source>Anim. (Basel)</source> <volume>13</volume>, <fpage>2690</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ani13172690</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Identification of MYH9 key domain involved in the entry of PRRSV into permissive cells</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>, <elocation-id>865343</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2022.865343</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>Y. C.</given-names>
</name>
<name>
<surname>Hsiao</surname> <given-names>N. W.</given-names>
</name>
<name>
<surname>Hsieh</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>C. Y.</given-names>
</name>
<name>
<surname>Kung</surname> <given-names>S. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Fisetin and Rutin as 3C protease inhibitors of enterovirus A71</article-title>. <source>J. Virol. Methods</source> <volume>182</volume>, <fpage>93</fpage>&#x2013;<lpage>98</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jviromet.2012.03.020</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ling</surname> <given-names>L. J.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>H. Y.</given-names>
</name>
<name>
<surname>Tu</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Flavonoids from Houttuynia cordata attenuate H1N1-induced acute lung injury in mice via inhibition of influenza virus and Toll-like receptor signalling</article-title>. <source>Phytomedicine</source> <volume>67</volume>, <fpage>153150</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.phymed.2019.153150</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Xiang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Complete genomic sequence of an equine herpesvirus type 8 Wh strain isolated from China</article-title>. <source>J. Virol.</source> <volume>86</volume>, <fpage>5407</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.00445-12</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Loboda</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Damulewicz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Pyza</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Jozkowicz</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Dulak</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism</article-title>. <source>Cell. Mol. Life Sci.</source> <volume>73</volume>, <fpage>3221</fpage>&#x2013;<lpage>3247</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00018-016-2223-0</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Rutin ameliorate PFOA induced renal damage by reducing oxidative stress and improving lipid metabolism</article-title>. <source>J. Nutr. Biochem.</source> <volume>123</volume>, <fpage>109501</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jnutbio.2023.109501</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mazik</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Promising therapeutic approach for SARS-CoV-2 infections by using a rutin-based combination therapy</article-title>. <source>ChemMedChem</source> <volume>17</volume>, <elocation-id>e202200157</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cmdc.202200157</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mihic</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Loinjak</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Maricic</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Smolic</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Sahinovic</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Steiner</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>The relationship between Nrf2 and HO-1 with the severity of COVID-19 disease</article-title>. <source>Medicina (Kaunas)</source> <volume>58</volume>, <fpage>1658</fpage>.</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miklasinska-Majdanik</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kepa</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wasik</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Zapletal-Pudelko</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Klim</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wojtyczka</surname> <given-names>R. D.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>The direction of the antibacterial effect of rutin hydrate and amikacin</article-title>. <source>Antibiotics (Basel)</source> <volume>12</volume>, <fpage>1469</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/antibiotics12091469</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohamed</surname> <given-names>E. K.</given-names>
</name>
<name>
<surname>Fathy</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Sadek</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Eldosoki</surname> <given-names>D. E.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>The effects of rutin coat on the biodistribution and toxicities of iron oxide nanoparticles in rats</article-title>. <source>J. Nanoparticle Res.</source> <volume>26</volume>, <fpage>1</fpage>&#x2013;<lpage>21</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s11051-024-05949-w</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Negahdari</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Bohlouli</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sharifi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Maleki Dizaj</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rahbar Saadat</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Khezri</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Therapeutic benefits of Rutin and its nanoformulations</article-title>. <source>Phytother Res.</source> <volume>35</volume>, <fpage>1719</fpage>&#x2013;<lpage>1738</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/ptr.6904</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ninfali</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Antonelli</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Magnani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Scarpa</surname> <given-names>E. S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Antiviral properties of flavonoids and delivery strategies</article-title>. <source>Nutrients</source> <volume>12</volume>, <fpage>2534</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/nu12092534</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perk</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Shatynska-Mytsyk</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Gercek</surname> <given-names>Y. C.</given-names>
</name>
<name>
<surname>Boztas</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Yazgan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Fayyaz</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Rutin mediated targeting of signaling machinery in cancer cells</article-title>. <source>Cancer Cell Int.</source> <volume>14</volume>, <fpage>124</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12935-014-0124-6</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savov</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Galabov</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Tantcheva</surname> <given-names>L. P.</given-names>
</name>
<name>
<surname>Mileva</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Pavlova</surname> <given-names>E. L.</given-names>
</name>
<name>
<surname>Stoeva</surname> <given-names>E. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2006</year>). <article-title>Effects of Rutin and quercetin on monooxygenase activities in experimental influenza virus infection</article-title>. <source>Exp. Toxicol. Pathol.</source> <volume>58</volume>, <fpage>59</fpage>&#x2013;<lpage>64</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.etp.2006.05.002</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schvartz</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Edery</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Moss</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Hadad</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Steinman</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Karniely</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Equid herpesvirus 8 isolated from an adult donkey in Israel</article-title>. <source>J. Equine Vet. Sci.</source> <volume>94</volume>, <fpage>103247</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jevs.2020.103247</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sebastiano</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chastel</surname> <given-names>O.</given-names>
</name>
<name>
<surname>de Thoisy</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Eens</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Costantini</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Oxidative stress favours herpes virus infection in vertebrates: a meta-analysis</article-title>. <source>Curr. Zool.</source> <volume>62</volume>, <fpage>325</fpage>&#x2013;<lpage>332</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/cz/zow019</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seminotti</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Grings</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tucci</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Leipnitz</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Saso</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Nuclear factor erythroid-2-related factor 2 signaling in the neuropathophysiology of inherited metabolic disorders</article-title>. <source>Front. Cell. Neurosci.</source> <volume>15</volume>, <elocation-id>785057</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fncel.2021.785057</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tonelli</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Chio</surname> <given-names>I. I. C.</given-names>
</name>
<name>
<surname>Tuveson</surname> <given-names>D. A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Transcriptional regulation by Nrf2</article-title>. <source>Antioxid. Redox Signal.</source> <volume>29</volume>, <fpage>1727</fpage>&#x2013;<lpage>1745</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/ars.2017.7342</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Du</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Niu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Cellular p32 is a critical regulator of porcine Circovirus type 2 nuclear egress</article-title>. <source>J. Virol.</source> <volume>93</volume>, <fpage>10</fpage>&#x2013;<lpage>128</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.00979-19</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>a). <article-title>The emergence of viral encephalitis in donkeys by Equid Herpesvirus 8 in China</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>, <elocation-id>840754</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2022.840754</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hu</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>b). <article-title>Identification of equine herpesvirus 8 in donkey abortion: a case report</article-title>. <source>Virol. J.</source> <volume>19</volume>, <fpage>10</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12985-021-01738-2</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Xi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Akhtar</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Characteristics and epidemiological investigation of equid herpesvirus 8 in donkeys in Shandong, China</article-title>. <source>Arch. Virol.</source> <volume>168</volume>, <fpage>99</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-023-05704-x</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mi</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Protective effect of Rutin on ferroptosis-induced oxidative stress in aging laying hens through Nrf2/HO-1 signaling</article-title>. <source>Cell Biol. Int.</source> <volume>47</volume>, <fpage>598</fpage>&#x2013;<lpage>611</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/cbin.11960</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yoon</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Ahn</surname> <given-names>H. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>First report of equine parvovirus-hepatitis and equine hepacivirus coinfection in horses in Korea</article-title>. <source>Transbound Emerg. Dis.</source> <volume>69</volume>, <fpage>2735</fpage>&#x2013;<lpage>2746</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/tbed.14425</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zakaryan</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Arabyan</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Oo</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Zandi</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Flavonoids: promising natural compounds against viral infections</article-title>. <source>Arch. Virol.</source> <volume>162</volume>, <fpage>2539</fpage>&#x2013;<lpage>2551</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-017-3417-y</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>