A six-year-old female who was suffering from B-cell precursor lymphoblastic leukemia was hospitalized from May 2022 at a university hospital for a remission induction therapy. She had repeated fevers and showed high levels of C-reactive protein (CRP) with cervical lymphadenopathies. The treatment with piperacillin/tazobactam (3.0 g/day) and linezolid (450 mg/day) was started and improved her symptoms in June. Though blood cultures were tested 5 times at the time of fever, which were negative, a set of blood culture was positive after 62 h of incubation in July. The isolate was initially identified as Candida species. A similar specimen was obtained three days later. A treatment of micafungin (3 mg/kg/day) was started. The blood culture became negative eight days after the treatment.

A W. tropicalis JUWT001 strain was isolated from a patient treated at Juntendo University Hospital in Japan in July 2022. The type strain of W. tropicalis TBRC 11426^T was obtained from Thailand Bioresource Research Center (TBRC, Thailand) and the type strains of W. sorbophila NBRC 1583^T and W. spandovensis NBRC 10249^T (= PYCC 8431^T) were obtained from the Biological Resource Center, National Institute of Technology and Evaluation (NITE) (Tokyo, Japan). W. tropicalis TBRC 11426^T was imported into Japan with permission from the Minister of Agriculture, Forestry and Fisheries under the Plant Protection Act. The isolates were cultured in Sabouraud dextrose agar (SDA) plate (Becton, Dickinson-Diagnostic Systems, Sparks, MD, USA), Potato Dextrose Agar (PDA) (Becton, Dickinson-Diagnostic Systems), and/or CHROM agar Candida medium (Kanto Chemical Co., Tokyo, Japan) at 25°C or 35°C under aerobic conditions for 48 hours. The minimum inhibitory concentrations (MICs) of the isolate were determined using the broth microdilution method, as described by the guidelines of the Clinical and Laboratory Standards Institute (CLSI) (CLSI, 2017).

Drug susceptibility was tested by microdilution assay according to the guidelines of the Clinical and Laboratory Standard Institute (CLSI) (CLSI, 2017) using the Yeast-Like Fungus DP (Eiken Chemical Co., Ltd., Tokyo). The ranges of antibiotic concentrations tested were: 5-fluorocytosine 0.12 to 64 μg/mL, amphotericin B 0.03 to 16 μg/mL, fluconazole 0.12 to 64 μg/mL, itraconazole 0.015 to 8 μg/mL, micafungin 0.015 to 16 μg/mL, miconazole 0.03 to 16 μg/mL, and voriconazole 0.015 to 8 μg/mL ( Table 1 ).

DNA of the clinical isolate for sanger sequencing was extracted using DNeasy UltraClean Microbial kit (QIAGEN, Tokyo, Japan). The ITS region of ribosomal DNA (rDNA) was amplified using fungal universal primers Its1 (5’- TCCGTAGGTGAACCTGCGG -3’) and Its4 (5’- TCCTCCGCTTATTGATATGC -3’) (Zhai et al., 2021). The PCR products were sequenced using 3500 XL genetic analyzer (ABI-Hitachi, Tokyo, Japan). Sequence data were analyzed using BLAST on the National Center for Biotechnology Information (NCBI) database.

Genomic DNA of the clinical isolate for whole genome sequencing was extracted as described previously (Mizukoshi et al., 2021). The genome was sequenced by Illumina MiSeq platform using v3 chemistry (600 cycles). Raw reads were trimmed and assembled using CLC Genomic Workbench version 10.0.1 (CLC bio, Aarhus, Denmark). The genome completeness and contamination were assessed using Eukcc v2.1.0 with default settings (Saary et al., 2020). Species identification of the isolate was also determined by ITS using BLAST. Amino acid substitutions in BCR1, BRG1, CBK1, EFG1, and IRE1 (Talapko et al., 2021) associated with virulence, in ERG3, ERG11, PDR1, and TAC1 associated with azole resistance, and in FKS1, FKS2, and GSC1 (Spettel et al., 2019) associated with echinocandin resistance in Candida species were analyzed based on whole genome sequencing.

Phylogenetic trees were constructed based on concatenated single-copy marker protein sequences predicted from genomes using GTDB-Tk v2.2.6 software (Chaumeil et al., 2022) and visualized using iTol ver.6. The following type strains were used for a phylogenic tree among Wickerhamiella species: W. alocasiicola PYCC 8427^T (GenBank accession number GCA_022577715), W. azyma PYCC 8333^T (GCA_022577855), W.cacticola NRRL Y-27362^T (GCA_003705615), W. dianesei PYCC 8330^T (GCA_022577725), W. domercqiae JCM 9478^T (GCA_001599275), W. galacta NRRL Y-17645^T (GCA_003045245), W. hasegawae JCM 12559^T (GCA_004125105), W. infanticola NRRL Y-17858^T (GCA_004125145), W. kurtzmanii PYCC 8437^T (GCA_022577765), W. nectarea PYCC 8436^T (GCA_022577815), W. occidentalis NRRL Y-27364^T (GCA_004125095), W. pararugosa PX1910^T (GCA_023628975), W. parazyma PYCC 8426^T (GCA_022577825), W. sorbophila NBRC 1583^T (GCF_002251995), W. spandovensis NBRC 10249^T (GCA_022577695), W. vanderwaltii PYCC 3671^T (GCA_022577775), and W. versatilis JCM 5958^T (GCA_001600375).

The whole-genome sequences of W. tropicalis JUWT001 have been deposited in GenBank as accession number DRR488519 (https://www.ncbi.nlm.nih.gov/sra/DRR488519).

Alpha-cyano-4-hydroxycinnamic acid (CHCA) was used as a matrix. Ten mg of 4-CHCA was dissolved in 1 mL of the solvent consisting of 1% (v/v) trifluoroacetic acid, 35% (v/v) ethanol, 15% (v/v) acetonitrile, and milliQ water. For the analysis using cell lysate, a full loop of fungal cells was dispersed to 200 μL of distilled water in a microtube and mixed with 800 μL of ethanol with zirconia beads. The suspensions were vortexed briefly and centrifuged at 15,000 g for 2 min. The pellets were dried for 5 min. After freezing the tubes at -80 °C, the pellets were suspended in 100 μL of 70% formic acid, crushed using a micro tube mixer (MT-400, Tomy Seiko, Tokyo, Japan) for 5 min, suspended in 100 μL of acetonitrile, and centrifuged at 15,000 g for 2 min. The analysis using protein fraction was performed as described previously (Teramoto et al., 2019). Briefly, a full loop of fungal cells was dispersed in 500 μL of distilled water in a microtube with zirconia beads. After freezing the tubes at -80 °C, the suspensions were centrifuged at 10,000 g for 2 min, 200 μL of supernatants were removed, crushed using a Fast Prep 24 apparatus (Funakoshi Co., Ltd.) for a total of 3 min (9 times for 20 s), and centrifuged at 10,000 g for 2 min. The suspensions were washed in milliQ water and centrifuged at 15,000 g for 5 min. The supernatants were ultrafiltered using Amicon® Ultra-0.5ml (Merck Millipore, Germany), with cut-off points at 100 kDa, centrifuged at 14,000 g for 5 min, and the devices set upside down at 2,000 g for 2 min to remove any residual solutions contained in the filter. Supernatants were analyzed by MALDI-MS according to the manufacturer’s instruction.

MALDI-MS measurements were performed in positive linear mode using MALDI-8020 RUO (Shimadzu Corporation, Kyoto, Japan) equipped with a 200 Hz Nd : YAG laser (355 nm). Mass calibration was performed using 6 peaks with m/z 4365.4, 5381.4, 6411.6, 7274.0, 8369.8, and 10300.1 from Escherichia coli DH5α. Five individual mass spectra were acquired for each fungal extract in the range from m/z 2,000 to 20,000. Biomarker search and peak matching were carried out using eMSTAT Solution™ software (Shimadzu Corp., Kyoto, Japan).

Samples of the positive blood culture were Gram stained and revealed the presence of yeast-like cells ( Figure 1 ). The positive blood culture samples were inoculated on Sabouraud Dextrose Agar (SDA) plate, Potato Dextrose Agar (PDA), and CHROM agar Candida medium at 35°C. After 48h of incubation, a large number of monomorphic, cream-colored smooth colonies were observed on the SDA and PDA. Purple-colored colonies were observed on the CHROM agar Candida medium ( Figure 2 ). The smear of the colony showed yeasts that were observed by the direct smear of the blood culture specimen. The isolate was identified as Candida species. The MICs of the isolate to fluconazole and micafungin were 4 μg/mL and 0.5 μg/mL, respectively ( Table 1 ). According to the breakpoints of fluconazole and micafungin in Candida species, the isolate showed intermediate resistance.

The ITS sequence of the isolate was 98.8% identical to the sequence of W. tropicalis (GenBank accession number MN218416). Therefore, the isolate was confirmed to be W. tropicalis and designated as W. tropicalis JUWT001.

The W. tropicalis JUWT001 harbored two virulence genes encoding protein kinase regulators, IRE1 and CBK1, that cause pathogenic fungal infections (Talapko et al., 2021). The IRE1 protein had 69.4% and 94.5% identity to that in C. albicans SC 5314 (GenBank accession no. GCF_000182965) and W. sorbophila NBRC 1583^T (accession no. GCF_002251995), respectively. The CBK1 protein had 40.3% and 90.7% identity to that in C. albicans SC 5314 (accession no. GCF_000182965) and W. sorbophila NBRC 1583^T (accession no. GCF_002251995), respectively.

The isolate had amino acid substitutions in ERG11 and FKS1 associated with azole and echinocandin resistance, respectively. Twenty-one amino-acid substitutions in ERG11 and 9 amino-acid substitutions in FKS1 were detected in hot spot regions which were highly conserved antimicrobial-binding domain in fungi (Favre et al., 1999; Papp et al., 2018) ( Figure 3 ). Of the nine amino acid substitutions of FKS1, an amino acid substitution from Met to Leu at the 696 position was reported in C. parapsilosis in 2018 (Papp et al., 2018; Spettel et al., 2019). There is no report on the remaining mutations in these resistant factors in the hot spot regions ( Figure 3 ).

As shown in Figure 4 , the phylogenetic tree revealed three clades: A, B, and C. W. tropicalis JUWT001 belonged to clade A, along with W. sorbophila (GenBank accession no. GCA_023629035) and W. infanticola (accession no. GCA_004125145), which have already been reported to be isolated from humans. Another previously reported clinical isolate, W. pararugosa (accession no. JAMAJR000000000), belonged to clade C. The other species were mostly isolated from plant (Lachance et al., 1998; Nakase et al., 2007; Barata et al., 2008; Wang et al., 2008; Lachance et al., 2010; de Vega et al., 2017).

We investigated the feasibility in identifying W. tropicalis using MALDI-MS. The protein fraction and cell lysate mass spectra of W. tropicalis JUWT001 were examined by MALDI-MS along with the type strains of W. tropicalis, W. sorbophila, and W. spandovensis. The numbers of mass peaks detected in the protein fractions were higher than in the cell lysates for all strains tested ( Supplementary Figure 1 ). Therefore, the protein fractions were used in the following study. As shown in Figure 5 , we observed that the protein fraction mass spectra of W. tropicalis JUWT001 were almost identical to W. tropicalis type strain, but different from W. sorbophila and W. spandovensis type strains. In order to find useful biomarker peaks, we used the eMSTAT Solution software. Biomarker peaks were selected from those with a relative peak intensity ratio of 0.5% or higher which was detected in all five replicates. The number of major peaks were 19 for the W. tropicalis type strain, 18 for W. tropicalis JUWT001, 17 for W. sorbophila type strain and 16 for W. spandovensis type strain (data not shown). The 19 peaks of the W. tropicalis type strain were then used as biomarker peaks, and the matching peaks of the observed masses to the biomarker masses were judged from a tolerance within 500 ppm. Then, the homology to the reference peaks of W. tropicalis type strain were evaluated for W. tropicalis JUWT001, W. sorbophila type strain, and W. spandovensis type strain ( Figure 5 ). As shown in Table 2 , 15 mass peaks (79%) of W. tropicalis JUWT001, 6 mass peaks (32%) of W. sorbophila type strain, and 2 mass peaks (11%) of W. spandovensis type strain were detected at the same mass as the 19 mass peaks of W. tropicalis type strain. Compared with the W. tropicalis type strain and JUWT001, W. sorbophila and W. spandovensis type strain had unique peaks shown in Figure 5 and Table 2 . The same peak (less than 500 ppm) at m/z 6,040 (peak No. 2) were observed in W. tropicalis JUWT001 and W. tropicalis type strain, whereas the different peaks at m/z 6,024 (peak No. 2-1) and m/z 6,031 (peak No. 2-2) were observed in W. sorbophila and W. spandovensis type strains, respectively. The same peaks at m/z 6,128 (peak No. 3) were observed in W. tropicalis and W. sorbophila, whereas the different peaks of m/z 6,157 (peak number 3-1) was observed in W. spandovensis. The same peaks at m/z 6,399 (Peak No. 4) were observed in W. tropicalis, whereas the different peaks at m/z 6,426 (peak No. 4-1) and m/z 6,487 (No. 4-2) were observed in W. sorbophila and W. spandovensis, respectively. These specific peaks were observed not only in the protein fraction, but also in the mass spectra of cell lysates cultured on SDA, PDA, and CHROM agar Candida medium (data not shown).