<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2024.1341332</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Establishment of two serological methods for detecting IgG and neutralizing antibodies against Crimean-Congo hemorrhagic fever virus glycoprotein</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Qi</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2014053"/>
<role content-type="https://credit.niso.org/contributor-roles/formal-analysis/"/>
<role content-type="https://credit.niso.org/contributor-roles/software/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Shen</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1526190"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shi</surname>
<given-names>Zhikang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2664383"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Li</surname>
<given-names>Zhengrong</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Yongkun</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Feng</surname>
<given-names>Na</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1545604"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Tiecheng</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2201523"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Yan</surname>
<given-names>Feihu</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/857290"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Xia</surname>
<given-names>Xianzhu</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1576176"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-review-editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Animal Science and Technology, Shihezi University</institution>, <addr-line>Shihezi</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Jilin Province for Zoonosis Prevention and Control, Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences</institution>, <addr-line>Changchun</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>College of Veterinary Medicine, Jilin University</institution>, <addr-line>Changchun</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Heribert Stoiber, Innsbruck Medical University, Austria</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Asisa Volz, University of Veterinary Medicine Hannover, Germany</p>
<p>Aykut Ozdarendeli, Erciyes University, T&#xfc;rkiye</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Feihu Yan, <email xlink:href="mailto:yanfh1990@163.com">yanfh1990@163.com</email>; Xianzhu Xia, <email xlink:href="mailto:xiaxzh@cae.cn">xiaxzh@cae.cn</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>30</day>
<month>04</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>14</volume>
<elocation-id>1341332</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>11</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>18</day>
<month>03</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Wang, Wang, Shi, Li, Zhao, Feng, Wang, Yan and Xia</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Wang, Wang, Shi, Li, Zhao, Feng, Wang, Yan and Xia</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>The Crimean-Congo hemorrhagic fever virus (CCHFV), the most geographically widespread tick-borne virus, is endemic in Africa, Eastern Europe and Asia, with infection resulting in mortality in up to 30% of cases. Currently, there are no approved vaccines or effective therapies available for CCHF. The CCHFV should only be manipulated in the BSL-4 laboratory, which has severely hampered basic seroprevalence studies. </p>
</sec>
<sec>
<title>Methods</title>
<p>In the present study, two antibody detection methods in the forms of an enzyme-linked immunosorbent assay (ELISA) and a surrogate virus neutralization test (sPVNT) were developed using a recombinant glycoprotein (rGP) and a vesicular stomatitis virus (VSV)-based virus bearing the CCHFV recombinant glycoprotein (rVSV/CCHFV) in a biosafety level 2 (BSL-2) laboratory, respectively. </p>
</sec>
<sec>
<title>Results</title>
<p>The rGP-based ELISA and rVSV/CCHFV-based sVNT were established by using the anti-CCHFV pre-G<sub>C</sub> mAb  11E7, known as a broadly cross-reactive, potently neutralizing antibody, and their applications as diagnostic antigens were validated for the specific detection of CCHFV IgG and neutralizing antibodies in experimental animals. In two tests, mAb clone 11E7 (diluted at 1:163840 or 512) still displayed positive binding and neutralization, and the presence of antibodies (IgG and neutralizing) against the rGP and rVSV/CCHFV was also determined in the sera from the experimental animals. Both mAb  11E7 and animal sera showed a high reactivity to both antigens, indicating that bacterially expressed rGP and rVSV/CCHFV have good immunoreactivity. Apart from establishing two serological testing methods, their results also demonstrated an imperfect correlation between IgG and neutralizing antibodies. </p>
</sec>
<sec>
<title>Discussion</title>
<p>Within this limited number of samples, the rGP and rVSV/CCHFV could be safe and convenient tools with significant potential for research on specific antibodies and serological samples.</p>
</sec>
</abstract>
<kwd-group>
<kwd>CCHFV</kwd>
<kwd>rGP</kwd>
<kwd>rVSV/CCHFV</kwd>
<kwd>ELISA and sVNT</kwd>
<kwd>specific antibodies and serological samples</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="46"/>
<page-count count="14"/>
<word-count count="9272"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Virus and Host</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonosis that affects many countries in Africa, Europe, the Middle East, and Central Asia (<xref ref-type="bibr" rid="B3">Bente et&#xa0;al., 2013</xref>). As the causative agent of CCHF, Crimean-Congo hemorrhagic fever virus (CCHFV) belongs to the genus <italic>Orthonairovirus</italic>, family <italic>Nairoviridae</italic>, and order <italic>Bunyavirales</italic> (<xref ref-type="bibr" rid="B18">Garrison et&#xa0;al., 2020</xref>). Hard-bodied ticks belonging to the genus <italic>Hyalomma</italic> are the primary vectors of the CCHFV (<xref ref-type="bibr" rid="B17">Gargili et&#xa0;al., 2017</xref>). In addition to the major route of the CCHFV, which is the bite of infected ticks, contact with animals in the viremic phase and the blood of an infected patient in the acute phase of infection (<xref ref-type="bibr" rid="B14">Ergonul, 2012</xref>), vertical transmission, sexual contact, and laboratory-acquired accidental cases when handling viral material have been reported (<xref ref-type="bibr" rid="B30">Portillo et&#xa0;al., 2021</xref>). The CCHFV can infect humans and a wide range of wild or livestock animals (<xref ref-type="bibr" rid="B9">Capua, 1998</xref>). Clinical diseases like viral sepsis accompanied by bleeding from the gums, skin, nose, and gastrointestinal tract are restricted to humans, and their case fatality rates vary from 3% to 100% (<xref ref-type="bibr" rid="B13">Dzikwi-Emennaa et&#xa0;al., 2022</xref>). Moreover, there are also cases of transmission from wild and domestic animals to humans (<xref ref-type="bibr" rid="B29">Papa et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B7">Boushab et&#xa0;al., 2020</xref>). However, there is currently no approved vaccine, and treatment and control strategies include only avoiding direct or indirect contact with infected animals or humans. The potential seriousness of the CCHFV in people emphasizes the importance of human and veterinary surveillance and the need for safe serological antibody diagnoses. The traditional serological antibody diagnoses of CCHF can be achieved by enzyme-linked immunosorbent assay (ELISA) and the plaque reduction neutralization test (PRNT) to detect anti-CCHFV-specific antibodies. IgG ELISA is the most common technique for CCHFV antibody detection, which has been confirmed to have high sensitivity and specificity (<xref ref-type="bibr" rid="B32">Saijo et&#xa0;al., 2002</xref>). The virus neutralization assay is known as the &#x201c;gold standard&#x201d; sero-diagnostic assay to evaluate the antibody response to infection and vaccination of a wide variety of viruses associated with human diseases (<xref ref-type="bibr" rid="B16">Fukushi et&#xa0;al., 2012</xref>), and a neutralizing antibody is a reliable indicator of protective immunity against the CCHFV (<xref ref-type="bibr" rid="B31">Rodriguez et&#xa0;al., 2019</xref>). However, IgG ELISAs frequently use antigens derived from inactivated viruses that are propagated in the cells or brain tissues of suckling mice, and PRNT involves the manipulation of live CCHFV, which requires professional operators under biosafety level 4 (BSL-4) containment available in only a limited number of laboratories. Therefore, basic studies in serology on the CCHFV have been severely hampered by biosafety requirements. In 2019, the World Health Organization&#x2019;s &#x201c;WHO R&amp;D Blueprint: Priority Diagnostics for CCHF&#x201d; documentation prioritized the need for the development and validation of new serological tests (<xref ref-type="bibr" rid="B44">WHO, 2019</xref>). ELISAs based on recombinant proteins and neutralization assays using the pseudo virus may be advantageous in detecting serum samples and inhibitors in a biosafety level 2 (BSL-2) laboratory because they readily meet the need for a simple, inexpensive, reliable system for serological detections of viral hemorrhagic fevers (VHFs) (<xref ref-type="bibr" rid="B8">Bukbuk et&#xa0;al., 2014</xref>). Affordable, suitable alternatives to serological detections may be used for testing large numbers of serum samples, evaluating antibody response to vaccination, and even exploring the relation between IgG and the neutralizing antibody.</p>
<p>The CCHFV is a negative-sense single-stranded RNA virus, and its genome comprises three particular fragments, named small (S), medium (M), and large (L), that encode nucleocapsid protein (NP), glycoprotein (GP), and RNA-dependent RNA polymerase, respectively (<xref ref-type="bibr" rid="B4">Bergeron et&#xa0;al., 2010</xref>). The glycoprotein precursor (GPC) is cleaved and modified to generate the structural proteins G<sub>N</sub> and Gc and three other domains: a variable mucin-like domain, a GP38 domain, and an NS<sub>M</sub> domain (<xref ref-type="bibr" rid="B5">Bergeron et&#xa0;al., 2007</xref>). Structural glycoproteins (G<sub>N</sub> and Gc) form spikes on the envelope and interact with host receptors to initiate infection. Glycoprotein is the primary target of the neutralizing antibodies (<xref ref-type="bibr" rid="B6">Bertolotti-Ciarlet et&#xa0;al., 2005</xref>) and is considered to be the immunodominant protein of the CCHFV. IgG antibody detection tests based on the glycoproteins of members of <italic>Bunyaviridae</italic> family, such as the Rift Valley fever (RVF) and Toscana virus, were conducted (<xref ref-type="bibr" rid="B11">Di Bonito et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B23">Jackel et&#xa0;al., 2013</xref>), and the Gn based ELISA against Rift Valley fever virus (RVFV) displayed a high and reliable specificity of more than 95% in the high number of tested field samples (<xref ref-type="bibr" rid="B23">Jackel et&#xa0;al., 2013</xref>). Therefore, glycoproteins are also important immunogens in ELISA methods, and there are few descriptions of the ELISA method based on the only glycoprotein of the CCHFV. High yields of protein are necessary for the preparation of serological reagents, and our initial attempts to express a recombinant CCHFV glycoprotein from a bacterial expression system using an entire GP gene were not successful. The truncated GP fragment (at aa 1443&#x2013;1566 in the M segment of the IbAr10200 strain) has been identified as a highly conserved antibody-binding site in many virus strains and could bind to monoclonal antibody (mAb) 11E7 (<xref ref-type="bibr" rid="B1">Ahmed et&#xa0;al., 2005</xref>), which was a broadly cross-reactive, potently neutralizing antibody and protected suckling mice from a lethal CCHFV challenge (<xref ref-type="bibr" rid="B6">Bertolotti-Ciarlet et&#xa0;al., 2005</xref>). Thus, this region is very promising in having good reactogenicity and can be considered for detection.</p>
<p>As one simple and economical surrogate virus system, a reverse genetics system based on the vesicular stomatitis virus (VSV) has a high packaging efficiency and strong amplification ability (<xref ref-type="bibr" rid="B15">Fukushi et&#xa0;al., 2005</xref>), and types of recombinant VSVs (rVSVs) including replication-competent and replication-incompetent rVSVs can be used safely in BSL-2 laboratories (<xref ref-type="bibr" rid="B27">Liu et&#xa0;al., 2021</xref>). Moreover, a series of rVSVs expressing exogenous proteins have the properties of a receptor-mediated membrane fusion reaction similar to those of the enveloped GP of wild-type VSV. They have been constructed and replaced the traditional assays based on live viruses for the diagnosis and serological study of VHFs with high sensitivity (<xref ref-type="bibr" rid="B20">Haglund et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B24">Kohl et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B8">Bukbuk et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B28">Marzi et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B31">Rodriguez et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B26">Li et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B21">He et&#xa0;al., 2023</xref>). Therefore, developing a surrogate virus neutralization test (sVNT) using a VSV-based virus bearing the CCHFV recombinant glycoprotein is promising and needed.</p>
<p>Following these lines of thought, the aim of our study was to express and purify a truncated recombinant glycoprotein (rGP) and establish a recombinant VSV bearing the CCHFV recombinant glycoprotein. The truncated rGP and recombinant virus could be used as antigens to establish a novel indirect ELISA and an sVNT for serological detections, as well as to explore the relation between IgG and neutralizing antibodies. For this purpose, the immunoreactivity of two recombinant antigens was determined using mAb 11E7; meanwhile, two established tests were applied to study specific antibody responses induced by two CCHFV vaccine candidates currently undergoing research and development.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Biosafety and ethics statement</title>
<p>The studies on the sVNT using the recombinant virus (rVSV/CCHFV) were performed under BSL-2 conditions. All rodent experiments were strictly conducted according to the guidance of the animal welfare and ethics committee of the Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences. cDNA encoding the open reading frame of the CCHFV IbAr10200 strain GPC (GenBank ID: AF467768) was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Cells, plasmid, antibodies, and serum samples</title>
<p>BSR-T7 cells (ATCC, CCL-10), VeroE6 cells (ATCC CRL-1586) were cultured in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium (DMEM, Gibco,Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA), 1% <sc>l</sc>-glutamine and 1% penicillin-streptomycin solution (P/S,Gibco, Grand Island, NY, USA) at 37&#xb0;C with 5%  CO<sub>2.</sub> The full-length plasmid (p3.1-VSV-eGFP) and supporting plasmids (p3.1-VSV-N, p3.1-VSV-P, p3.1-VSV-L, and p3.1-VSV-G) were prepared and stored in our laboratory, and all construction of plasmids were confirmed by sequencing in Comate Bioscience Co., Ltd. (Changchun, Jinlin, China). The mouse monoclonal antibody clone 11E7 anti-CCHFV pre-Gc was bought from BEI Resources (Manassas, VA, USA), and mouse serum anti-CCHFV-eGN was prepared and stored in our laboratory.</p>
<p>Fifty experimental serum samples (prepared and stored in our laboratory) were used in the present study. The experimental animal samples were derived from two vaccine candidates [G<sub>C</sub> subunit vaccine (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2022a</xref>) and CCHFV candidate vaccine based on VSV (<xref ref-type="bibr" rid="B31">Rodriguez et&#xa0;al., 2019</xref>)], which have been reported. Ten experimental serum samples from BALB/c mice (at 6&#x2013;8 weeks of age, five per group) were vaccinated with A-G-eG<sub>C</sub> (5 &#x3bc;g) through subcutaneous (s.c.) injection two and three times. Twenty experimental serum samples from BALB/c mice (at 6&#x2013;8 weeks of age, five per group) were vaccinated with CCHFV candidate vaccine based on VSV (0.5 &#xd7; 10<sup>6</sup> TCID<sub>50</sub>/mouse) through subcutaneous (i.s.) or intraperitoneal (i.p.) injection for one and two times. Ten experimental serum samples from Syrian hamsters (at 6&#x2013;8 weeks of age, n = 5) were intraperitoneally (i.p.) immunized with CCHFV candidate vaccine based on VSV (2&#xd7;10<sup>6</sup> TCID<sub>50</sub>/Syrian hamster) one and two times. In addition, there were five experimental serum samples in the control groups [mice were inoculated with phosphate-buffered saline (PBS), 500 &#x3bc;L/mouse]. Five experimental serum samples in the control groups (Syrian hamsters) were inoculated with PBS (2 mL/Syrian hamster). Serum samples were incubated at 56&#xb0;C for 30&#xa0;min to inactivate potential viruses.</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Establishment of recombinant glycoprotein-based ELISA</title>
<sec id="s2_3_1">
<label>2.3.1</label>
<title>Construction of plasmids, expression, and purification of truncated rGP</title>
<p>The constructions of plasmids and expression, purification, and identification of the rGP were conducted. During PCR, gene-specific primers as listed in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>, with restriction enzyme sites <italic>Bam</italic>HI and <italic>Xho</italic>I added upstream and downstream, respectively, were used for the amplification of the target gene, which was a 372-bp nucleotide segment between aa 1443 and 1566 (124aa) of the CCHFV IbAr10200 strain GPC (GenBank ID: AF467768) genome. The amplified gene fragment was connected by restriction enzyme sites to the linearized pET30a(+) vector with poly-histidine (His) tags, and the recombinant plasmid was sequenced and transformed into <italic>Escherichia coli</italic> BL21 Star (DE3) pLysS chemically competent cells. Finally, 500 mL <italic>E. coli</italic> containing the pET30a(+) vector-rGP plasmid was induced with 0.5 mM isopropyl-&#x3b2;-<sc>d</sc>-thiogalactoside (IPTG; Sigma, St. Louis, MO, USA), vigorously shaken overnight at 37&#xb0;C for 6&#xa0;h, and then harvested by centrifugation at 6,000 &#xd7; <italic>g</italic> for 30&#xa0;min. According to the manufacturer&#x2019;s protocol of the HisPur Ni-NTA Spin Column (Thermo Fisher Scientific Inc., Waltham, MA, USA), recombinant protein was harvested and concentrated with a Vivaspin filter unit (Sartorius, G&#xf6;ttingen, Germany) at 4&#xb0;C. The collected rGP was resuspended in 1&#xd7; PBS buffer to reach a final concentration of 1 mg/mL and stored at &#x2212;80&#xb0;C.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Oligonucleotide primers used in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center" colspan="2">Oligonucleotide primer sequence (5&#x2032;&#x2013;3&#x2032;)</th>
<th valign="top" align="left">Enzyme site</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">F<sup>1&#x2003;</sup>
</td>
<td valign="top" align="left">CGC<italic>
<underline>GGATCC</underline>
</italic>TCAGGCTTAAAATTTGCAAGC</td>
<td valign="top" align="center">
<italic>Bam</italic>HI&#x2003;</td>
</tr>
<tr>
<td valign="top" align="left">R<sup>1</sup>
</td>
<td valign="top" align="left">CCG<italic>
<underline>CTCGAG</underline>
</italic>GCAAGTGCTGTTTTGCTTTCCG<break/>
</td>
<td valign="top" align="center">
<italic>Xho</italic>I</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<sup>1</sup>Restriction enzyme sites are underlined and italicized.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_3_2">
<label>2.3.2</label>
<title>SDS-PAGE and Western blotting analyses</title>
<p>The molecular weight of the truncated rGP was determined using sodium dodecyl sulfate&#x2013;polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting and described as follows. Two BeyoGel&#x2122; Plus PAGE 12% tris-acetate protein gels (Beyotime, Shanghai, China) were run at a constant 130&#xa0;V for 90&#xa0;min: one was stained with Coomassie brilliant blue (Beyotime, Shanghai, China), and the other was transferred onto the nitrocellulose membrane (Beyotime, Shanghai, China) according to the manufacturer&#x2019;s instructions. After the immobilization and blocking of the bands, the membrane was incubated overnight at 4&#xb0;C with the anti-CCHFV pre-G<sub>C</sub> mAb clone 11E7 (BEI Resources, Manassas, VA, USA). After washing three times with PBST, the membrane was treated with horseradish peroxidase (HRP)-conjugated anti-mouse-specific IgG antibody (Bioworld, Minnesota, MN, USA; diluted 1:5,000) at room temperature for 1&#xa0;h. After another three washes with PBST, the bands were visualized after incubation with DAB reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2_3_3">
<label>2.3.3</label>
<title>Establishment of truncated rGP-based IgG ELISA</title>
<p>In this study, IgG ELISA using recombinant rGP was developed, and checkerboard titrations of rGP were used to optimize the ELISA protocol (<xref ref-type="bibr" rid="B34">Samudzi et&#xa0;al., 2012</xref>). Briefly, serial dilutions of antigen (2, 4, 8, and 10 &#x3bc;g/mL) were tested with ELISA using anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (BEI Resources, Manassas, VA, USA) to determine the concentration of rGP to be used as antigen. Then, MaxiSorp 96-well plates (Corning-Costar, Corning, NY, USA) were coated overnight at 4&#xb0;C with 100 &#x3bc;L of purified rGP at a final concentration of 4 &#xb5;g/mL. The next day, each well of the plates was washed three times with 200 &#x3bc;L PBS containing 0.05% Tween 20 (PBST) and then blocked with 150 &#x3bc;L of ddH<sub>2</sub>O containing 3% bovine serum albumin (BSA; Sigma, St. Louis, MO, USA) for 1&#xa0;h at 37&#xb0;C. The plates were washed three times with PBST and then incubated with the mAb clone 11E7 and control serum (mouse serum anti-PBS, prepared and stored in our laboratory) in duplicate, which were serially diluted twofold starting at a dilution of 1:80 with 1% BSA buffer. After a 1.5-h incubation period, the plates were washed three times with PBST and then were incubated with anti-mouse IgG-HRP antibody (1:20,000 dilution; Bioworld, St. Louis, MO, USA). After a further 1.5-h incubation period, the plates were washed, and 100 &#x3bc;L tetramethyl benzidine substrate (TMB; Sigma, St. Louis, MO, USA) was added to each well. The plates were incubated for 5&#x2013;10 min at room temperature, and the reaction was stopped by adding 0.5 M H<sub>2</sub>SO<sub>4</sub> (Sigma, St. Louis, MO, USA); the plates were read at 450 nm using an ELISA reader (Bio-Rad, Hercules, CA, USA). For data analyses, at the maximal ratio of P/N (OD<sub>positive-mAb clone 11E7</sub>/OD<sub>negative-control</sub>), the corresponding antigen concentration was identified as the optimum concentration of the rGP with the highest level of binding. The IgG response was considered to be positive if the mean absorbance of the mAb clone 11E7 was twofold greater than the mean absorbance of the same dilution of control serum, and titers were determined as the highest dilution at which the mean absorbance of the mAb clone 11E7 was twofold greater than the mean absorbance of the same dilution of control serum.</p>
</sec>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Development of a neutralization assay-based recombinant vesicular stomatitis virus bearing the CCHFV recombinant glycoprotein</title>
<sec id="s2_4_1">
<label>2.4.1</label>
<title>Construction of full-length cDNA clones and rescue of recombinant virus</title>
<p>The reverse genetic operating system of the vesicular stomatitis virus Indiana strain (GenBank ID: nc_001560.1) has been described previously (<xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2022b</xref>). In the full-length plasmid p3.1-VSV-eGFP, a removable transcription unit encoding an enhanced green fluorescence protein (eGFP) (GenBank ID: hv192862.1) was added between the N and P genes of the VSV genome. In the present study, the plasmid p3.1-VSV-eGFP was used as the backbone, and cDNA encoding the open reading frame of the CCHFV IbAr10200 strain GPC (GenBank ID: AF467768) was synthesized and cloned into the p3.1-VSV-eGFP plasmid to generate the recombinant plasmid named p3.1-&#x394;GVSV-GPC-eGFP (rVSV/CCHFV). To increase the titer of the recombinant virus rVSV/CCHFV, the 53 amino acids of the C-terminal tail (aa 1632&#x2013;1684) in CCHFV GPC were truncated. Finally, the coding sequence of VSV spike G was replaced by the CCHFV GPC&#x394;53aa (GPC&#x394;) in the recombinant plasmid-rVSV/CCHFV (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Schematic representation of the design and rescue of the rVSV-eGFP and &#x394;GrVSV-CCHFV-GPC&#x394;-eGFP (rVSV/CCHFV). <bold>(A)</bold> Genome organization comparing the VSV (wild-type) genome (rVSV-eGFP) and the rVSV vector expressing the CCHFV-GPC&#x394; open reading frame (rVSV/CCHFV). N: nucleoprotein, P: phosphoprotein, M: matrix protein, and L: large polymerase protein, eGFP; enhanced green fluorescent protein. The rVSV-eGFP had the VSV glycoprotein open reading frame (blue rectangle), which was exchanged with the open reading frame coding for the truncated glycoprotein precursor gene (GPC&#x394;, red rectangle) of CCHFV in the rVSV/CCHFV. <bold>(B)</bold> Generating a replication-competent virus: BSR-T7 cells were transfected with the p3.1-&#x394;GVSV-GPC&#x394;-eGFP plasmid and four supporting plasmids of VSV in-cluding p3.1-VSV-N, p3.1-VSV-P, p3.1-VSV-L and p3.1-VSV-G. The VSV-G*-rVSV/CCHFV particle was rescued with the VSV-G* (VSV-G*-rVSV/CCHFV (P1), and multiple passages (P2~P5) of the VSV-G*-rVSV/CCHFV on Vero E6 cells without VSV-G* resulted in a replication- competent rVSV/CCHFV (P5), in which the VSV-G gene was replaced by the GPC&#x394; gene of CCHFV. Finally, this replication-competent virus could effectively replicate on Vero E6 cells without VSV-G*. We used the P5 generation as the seed virus for the mass production of rVSV/CCHFV, and the P6 was used in the present study.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g001.tif"/>
</fig>
<p>The rVSV/CCHFV was recovered as described previously (Wang, Zhang et&#xa0;al., 2022). Briefly, BSR-T7 cells were transfected with 1.25 &#x3bc;g of the p3.1-&#x394;GVSV-GPC&#x394;-eGFP plasmid and four supporting plasmids of VSV comprising p3.1-VSV-N (0.75 &#x3bc;g), p3.1-VSV-P (1.25 &#x3bc;g), p3.1-VSV-L (0.25 &#x3bc;g), and p3.1-VSV-G (2&#x3bc;g). The procedure was performed according to the calcium phosphate transfection kit instructions (Invitrogen, Waltham, MA, USA), and the recovery of the virus was determined using cytopathic effects and eGFP reporter expression. A total of 48&#xa0;h after transfection, the recombinant virus in the supernatant was harvested [first generation (P1)], which was passaged on Vero E6 cells from P2 to P5 (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). The P5 generation of the virus supernatant was used as a seed virus and was stored at &#x2212;80&#xb0;C for future use.</p>
</sec>
<sec id="s2_4_2">
<label>2.4.2</label>
<title>Identification of the replication-competent recombinant virus (rVSV/CCHFV)</title>
<sec id="s2_4_2_1">
<label>2.4.2.1</label>
<title>Electron microscopy analysis</title>
<p>To investigate whether the ultrastructure of rVSV-eGFP (&#x201c;wild-type&#x201d; VSV electron microscopy control) and rVSV/CCHFV displayed some differences, transmission electron microscopy studies were conducted. Freeze-thawed rVSV-eGFP and rVSV/CCHFV (P6) were centrifugated at 3,000 r/min for 10&#xa0;min to remove the cell fragments. The collecting supernatants were negatively stained with uranyl acetate (Sigma, St. Louis, MO, USA) and then examined using an electron microscope.</p>
</sec>
<sec id="s2_4_2_2">
<label>2.4.2.2</label>
<title>Growth kinetics of the rVSV/CCHFV</title>
<p>To assess the growth kinetics of the rVSVs (rVSV-eGFP or rVSV/CCHFV), Vero E6 cells with 80% confluence were incubated with rVSV/CCHFV (P6) at a multiplicity of infection (MOI) of 0.1, as well as rVSV-eGFP (as a positive control). After virus adsorption for 1&#xa0;h at 37&#xb0;C, the culture media were replaced with DMEM containing 5% FBS. The rVSV/CCHFV and rVSV-eGFP-containing supernatants were collected every 12&#xa0;h after infection, serially diluted 10-fold in DMEM, and added together with Vero E6 cells into 96-well plates. The 96-well plates were incubated for 12&#x2013;48 h at 37&#xb0;C and observed under a fluorescence microscope (Zeiss, Oberkochen, Germany). Titrations of viruses in the supernatant infected with rVSVs from 12 to 96&#xa0;h were calculated using the Reed and Muench method and expressed as TCID<sub>50</sub>/mL of stock.</p>
</sec>
<sec id="s2_4_2_3">
<label>2.4.2.3</label>
<title>RT-PCR</title>
<p>The recombinant virus rVSV/CCHFV in the supernatant from P5 to P10 was harvested, and the expression of the CCHFV GPC&#x394; gene in the recombinant virus was identified by RT-PCR. The genome of the virus was extracted according to the manufacturer&#x2019;s instructions (TIANGEN, Beijing, China). An RT-PCR was performed using TransGen<sup>&#xae;</sup> II One-Step RT-PCR Super Mix Premix Ex Taq (TransGen Biotech, Beijing, China) with the following primers and probes: GF (5&#x2032;-ATGCATATATCATTAATGTATGC-3&#x2032;); GR (5&#x2032;-CTAGCCTCTGGTTCTTCTACAACATT T-3&#x2032;). The RT-PCR system and conditions are shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>RT-PCR system.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">Component</th>
<th valign="top" align="left">Volume</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">RNA template</td>
<td valign="top" align="center">8.8 &#x3bc;L</td>
</tr>
<tr>
<td valign="top" align="center">Forward primer (10 &#x3bc;M)</td>
<td valign="top" align="center">0.4 &#x3bc;L</td>
</tr>
<tr>
<td valign="top" align="center">Reverse primer (10 &#x3bc;M)</td>
<td valign="top" align="center">0.4 &#x3bc;L</td>
</tr>
<tr>
<td valign="top" align="center">2&#xd7;TS One-Step Reaction Mix</td>
<td valign="top" align="center">10 &#x3bc;L</td>
</tr>
<tr>
<td valign="top" align="center">
<italic>TransScript</italic>
<sup>&#xae;</sup> One-Step Enzyme Mix</td>
<td valign="top" align="center">0.4 &#x3bc;L</td>
</tr>
<tr>
<td valign="top" align="center">Total volume</td>
<td valign="top" align="center">20 &#x3bc;L</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>Reaction conditions: 45&#xb0;C 30&#xa0;min; 94&#xb0;C 5&#xa0;min (94&#xb0;C 30 s, 57&#xb0;C 30 s, 72&#xb0;C 5&#xa0;min; 35 cycles); 72&#xb0;C 10&#xa0;min.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_4_2_4">
<label>2.4.2.4</label>
<title>Western blotting</title>
<p>In order to examine the expression of the CCHFV GPC&#x394; protein, Vero E6 cells infected with rVSV-eGFP (control) and rVSV/CCHFV for 72&#xa0;h were centrifugated at 3,000 &#xd7; <italic>g</italic> for 10&#xa0;min, and the rVSVs (rVSV-eGFP and rVSV/CCHFV) in the supernatant were harvested. The collections were denatured in 5&#xd7; loading buffer (Beyotime, Shanghai, China) and incubated at 95&#xb0;C for 10&#xa0;min before loading onto BeyoGel&#x2122; Plus PAGE 10% tris-acetate protein gels (Beyotime, Shanghai, China). According to the manufacturer&#x2019;s instructions, the molecular weight of the GPC&#x394; protein was determined using Western blotting with two antibodies, which were a mouse serum anti-G<sub>N</sub> (prepared and stored in our laboratory; diluted 1:200) and the anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (BEI Resources, Manassas, VA, USA, diluted 1:2,000).</p>
</sec>
<sec id="s2_4_2_5">
<label>2.4.2.5</label>
<title>Immunofluorescence assay</title>
<p>To assess the expression of the CCHFV-GPC&#x394; gene in the rVSV/CCHFV, an immunofluorescence assay (IFA) was performed using specific antibodies. Briefly, Vero E6 cells were infected with rVSV/CCHFV and rVSV-eGFP (control) at a MOI of 0.1 and cultured in 24-well plates for 48&#xa0;h at 37&#xb0;C with 5% CO<sub>2</sub>. Then, the cells cultured in 24-well plates were fixed with 4% paraformaldehyde (Beyotime, Shanghai, China) at room temperature for 30&#xa0;min and washed three times with PBS (containing 0.05% Tween 20, PBST). After being blocked with 3% bovine serum albumin (Sigma, St. Louis, MO, USA), cells were labeled with the primary antibody [a mouse serum anti-CCHFV-eG<sub>N</sub>, prepared and stored in our laboratory, 1:200 dilution; anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (BEI Resources, Manassas, VA, USA), 1:1,000 dilution] for 1&#xa0;h at 37&#xb0;C. After washing three times with PBST, cells were then incubated with the secondary antibody (Cy3-labeled anti-mouse IgG (H+L), Beyotime, Shanghai, China; 1:1,000 dilution) for 1&#xa0;h at 37&#xb0;C. After repeated washings, the cell nucleus was stained with 4&#x2032;,6-diamidino-2-phenylindole (DAPI; Beyotime, Shanghai, China; 1:1,000 dilution) for 10&#xa0;min. Finally, each well was washed three times with PBST and visualized using a fluorescence microscope.</p>
</sec>
</sec>
<sec id="s2_4_3">
<label>2.4.3</label>
<title>Establishment of neutralization assays based on rVSV/CCHFV</title>
<p>Handling of the CCHFV requires high-containment facilities of biosafety level 3 (BSL-3) and BSL-4 in endemic and non-endemic areas, respectively. In a certified BSL-2 laboratory, the rVSV/CCHFV particle was used to test the neutralizing antibody activity of anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (BEI Resources, Manassas, VA, USA), which was previously determined to have potently neutralizing activity (Zivcec, Metcalfe et&#xa0;al., 2015). First, twofold serial dilutions of anti-CCHFV pre-G<sub>C</sub> mAb 11E7 and a mouse serum in the PBS group (initial dilution of 1:4, each dilution was performed in duplicate) were mixed with equal volumes of rVSV/CCHFV and rVSV/eGFP (a final concentration of 200 TCID<sub>50</sub>/mL), respectively, which were incubated at 37&#xb0;C for 1&#xa0;h as well as cell and viral controls. Second, the mixtures were loaded onto Vero E6 cells in a 96-well plate and incubated at 37&#xb0;C for 48&#x2013;72 h in a 5% CO<sub>2</sub> environment. Finally, the fluorescence signal was observed using a fluorescence microscope, and 100% inhibition was considered positive in the sVNT.</p>
</sec>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Application of ELISA-based rGP and neutralization assay-based rVSV/CCHFV in experimental serum samples</title>
<p>Whether the ELISA-based rGP and neutralization assay-based &#x394;G rVSV-CCHFV-GPC-eGFP could be applied in the determination of IgG and neutralizing antibodies (NAbs) in animal sera was evaluated.</p>
<p>In the present study, 400 ng/well of the rGP and 200 TCID<sub>50</sub> rVSV/CCHFV were used as the antigens in the IgG ELISA and sVNT, respectively. Twofold serial dilutions of animal sera (with 80-fold in the IgG ELISA and with fourfold in the initial dilution in the sVNT) were reacted with antigens in 96-well plates. Meanwhile, anti-CCHFV pre-G<sub>C</sub> mAb clone 11E7 (BEI Resources, Manassas, VA, US) and sera in control groups in different dilutions were set as the positive and negative antibodies, respectively. Titration by endpoint dilutions was performed in serum samples. IgG response was considered to be positive if the mean absorbance of the sample was twofold greater than the mean absorbance of the same dilution of control serum. A total of 100% inhibition was considered positive in the sVNT. Data were analyzed as previously reported using GraphPad Prism 8.0. Data are shown as the mean &#xb1; SD and were analyzed using one-way ANOVA or the unpaired t-test (* p &lt; 0.05, ** p &lt; 0.01, *** p &lt; 0.001, and **** p &lt; 0.0001).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Establishment of IgG ELISA assay based on truncated rGP</title>
<sec id="s3_1_1">
<label>3.1.1</label>
<title>Purification and identification of truncated rGP</title>
<p>A schematic representation of the open reading frame (ORF) of CCHFV (Negeria- IbAr10200 strain) was clearly shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>. The result of the SDS-PAGE analysis showed that the truncated rGP was successfully expressed and purified through the HisPur Ni-NTA Spin Column (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>), presenting the apparent molecular weight of approximately 23 kDa (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>). The result of Western blotting analysis demonstrated that rGP could specifically react with the monoclonal antibody 11E7 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>-3), and no expression of any immunoreactive protein was detected in mock preparations (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>-1, 2).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Expression of the truncated recombinant glycoprotein (rGP) and establishment of an IgG ELISA based on rGP. <bold>(A)</bold> A schematic representation of the glycoprotein open reading frame (ORF) of Crimean-Congo hemorrhagic fever virus (CCHFV) Ibar10200 strain. <bold>(B)</bold> Schematic diagram of expression, purification, and identification of recombinant protein in the prokaryotic expression system. <bold>(C)</bold> Sodium dodecyl sulfate&#x2013;polyacrylamide gel electrophoresis (SDS-PAGE) identification of the rGP. The rGP was detected at 23 kDa boxed out in red. <bold>(D)</bold> Western blotting analysis of the rGP protein expression in <italic>Escherichia coli</italic>. Expression was detected with a mouse anti-CCHFV pre-GC monoclonal antibody (mAb) clone 11E7. (D-1) Uninduced IPTG-pET30a(+) empty carrier control. (D-2) Induced IPTG-pET30a(+) empty carrier control. (D-3) Target protein expressed in induced IPTG-pET30a(+) boxed out in red. <bold>(E)</bold> ELISA analysis of the binding ability of truncated GP (purified rGP, 2-4-8-10 &#x3bc;g/mL) to mAb clone 11E7.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g002.tif"/>
</fig>
</sec>
<sec id="s3_1_2">
<label>3.1.2</label>
<title>Truncated GP-based IgG ELISA</title>
<p>A concentration of 4 &#x3bc;g/mL was selected for the detection work (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2E</bold>
</xref>), as the result of the maximal ratio of P/N (OD <sub>positive-mAb clone 11E7</sub>/OD <sub>negative-control</sub>). MAb clone 11E7 still showed a positive result (P/N &gt; 2) when diluted in 163840 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>), indicating that this truncated GP could be used as an antigen in the ELISA with a sensitive and specific binding activity.</p>
</sec>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Establishment of neutralization assays based on rVSV/CCHFV</title>
<sec id="s3_2_1">
<label>3.2.1</label>
<title>Generation and identification of CCHFV GP&#x394;53aa gene expression in the rVSV/CCHFV</title>
<p>Vero E6 cells infected with rVSV-eGFP were used as control (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>). After the recombinant plasmid-p3.1-&#x394;GVSV-GPC&#x394;-eGFP and four helper plasmids were co-transfected into BSR-T7 cells for 48&#xa0;h, a replication-competent VSV-G*-rVSV/CCHFV (P1) was successfully rescued, with syncytial lesions and eventual cytopathic effect (CPE) in cell culture foci/plaque formations appearing on the monolayers, as well as green fluorescence under a fluorescent microscope (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>). Passaging of recombinant virus on Vero E6 cells (P2&#x2013;P5) successfully resulted in a replication-competent virus rVSV/CCHFV. Vero E6 cells inoculated with rVSV/CCHFV (P6) supernatant presented green fluorescence under a fluorescent microscope and eventual CPE in cell culture foci/plaque formations on the monolayers (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3C</bold>
</xref>). These phenomena demonstrated that the replication-competent virus (rVSV/CCHFV) was successfully rescued, and the rVSV/CCHFV could effectively replicate on Vero E6 cells, which was consistent with the description that Vero E6 cells were susceptible to rVSV in a previous study (<xref ref-type="bibr" rid="B21">He et&#xa0;al., 2023</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Identification analysis of recombinant vesicular stomatitis virus/Crimean-Congo hemorrhagic fever virus (rVSV/CCHFV). <bold>(A)</bold> The fluorescence and cytopathic effect (CPE) of rVSV-enhanced green fluorescence protein (eGFP) on Vero E6 cells. <bold>(B)</bold> The fluorescence and CPE of rVSV/CCHFV-P1 on BSR cells. <bold>(C)</bold> rVSV/CCHFV-P6 on Vero E6 cells at 48&#xa0;h post-infection visualized under microscope. The fluorescence and CPE in panels <bold>(A&#x2013;C)</bold> are indicated by a yellow arrowhead. <bold>(D, E)</bold> Electron microscopy (EM) detection of rVSVs. Transmission electron micrographs of rVSV-GFP <bold>(D)</bold> and replication-competent rVSV/CCHFV <bold>(E)</bold>. Supernatants were negatively stained with 2% aqueous uranyl acetate, and scale bars represent 200 nm. <bold>(F)</bold>&#xa0;Titer comparison of Vero E6 cells infected with rVSV-eGFP or rVSV/CCHFV at a multiplicity of infection (MOI) of 0.1 at hours 12, 24, 36, 48, 60, 72, 84, 96, 108, and 120. <bold>(G)</bold> Identification of CCHFV GPC&#x394;53aa gene in the rVSV/CCHFV (5th&#x2013;10th generation) by RT-PCR. <bold>(H, I)</bold> Western blotting of approximately 30 &#x3bc;L rVSVs (10<sup>6</sup> TCID<sub>50</sub>/mL) mixed with 5&#xd7; loading buffer on 10% gradient TGX gels. 1, rVSV-eGFP; 2, rVSV/CCHFV. Particle preparations were incubated with a mouse serum anti-CCHFV-eG<sub>N</sub> <bold>(H)</bold>, anti-CCHFV pre-G<sub>r</sub> monoclonal antibody (mAb) clone 11E7 <bold>(I)</bold>, and a horseradish peroxidase (HRP)-conjugated secondary.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g003.tif"/>
</fig>
<p>In the electron microscopy analysis, both rVSV-eGFP (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3D</bold>
</xref>) and rVSV/CCHFV particles (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>) were observed between 170 and 200 nm and maintained rhabdovirus morphology, a classical bullet shape with coiled intra-virion structure. At a MOI = 0.1, the growth kinetics of the rVSV/CCHFV and rVSV-eGFP showed that rVSV-eGFP (wild-type control) peaked in the titer of 10<sup>8.667</sup> TCID<sub>50</sub>/mL at approximately 36 hpi, while the peak titer of rVSV/CCHFV was 10<sup>6.667</sup> TCID<sub>50</sub>/mL at 72 hpi (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3F</bold>
</xref>). The growth titer of rVSV/CCHFV was lower than that of rVSV-GFP due to the recombination of a larger foreign gene (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3F</bold>
</xref>). Viral genomes were extracted from the 5th to 10th generation of rVSV/CCHFV and assessed by RT-PCR. The result showed that there was a specific band at 4,896 bp in every generation, suggesting the expression of CCHFV GPC&#x394; (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3G</bold>
</xref>).</p>
<p>Western blotting analysis was performed to determine the status of CCHFV GPC&#x394;53aa expression using antibodies against CCHFV-G<sub>N</sub> or Gc. The IbAr10200 strain of CCHFV structural glycoproteins G<sub>N</sub> and G<sub>C</sub> present as bands of approximately 37 kDa and 75 kDa, and the precursor molecule CCHFV-PreG<sub>N</sub> and PreG<sub>C</sub> present as bands of approximately 140 kDa and 85 kDa, respectively (<xref ref-type="bibr" rid="B36">Sanchez et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B41">Vincent et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B35">Sanchez et&#xa0;al., 2006</xref>). In the present study, the Western blotting data demonstrated that non-specific binding proteins were observed in rVSV-eGFP (lane 1, <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3I</bold>
</xref>), and there was a strong band at 70&#x2013;100 kDa recognized by the specific CCHFV-G<sub>C</sub> antibody (anti-CCHFV pre-G<sub>C</sub> mAb 11E7, BEI Resources, Manassas, VA, USA) in rVSV/CCHFV (lane 2, <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3I</bold>
</xref>). This indicated that the specific expression of CCHFV GP was incorporated in rVSV/CCHFV virions presenting in the forms of the mature CCHFV-G<sub>C</sub> and PreG<sub>C</sub>. However, the Western blotting using the antibody against CCHFV-G<sub>N</sub> (a mouse serum anti-CCHFV-eG<sub>N</sub>, prepared and stored in our laboratory) showed that there were no specifically evident bands at approximately 37 kDa for the mature G<sub>N</sub> or 140 kDa for the PreG<sub>N</sub> (lane 2, <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3H</bold>
</xref>). The phenomenon may be related to their expression concentrations, as only unconcentrated and purified rVSV/CCHFV was currently available. Our study demonstrated that the rVSV/CCHFV could express CCHFV-GP&#x394; <italic>in vitro</italic> and strongly express CCHFV-G<sub>C</sub> or PreG<sub>C</sub> in the virion, which was consistent with the description in a previous study (<xref ref-type="bibr" rid="B31">Rodriguez et&#xa0;al., 2019</xref>).</p>
<p>To assess the expression of the CCHFV-GPC&#x394; in the vector, an immunofluorescence assay was performed with antibodies against the CCHFV-G<sub>C</sub> or CCHFV-G<sub>N</sub>. The result showed that rVSV/CCHFV was recognized by two CCHFV GP-specific antibodies (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, Cy3-rVSV/CCHFV), while rVSV-eGFP did not react with two CCHFV GP-specific antibodies (the reaction with mAb clone 11E7 was only shown here, <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, Cy3-rVSV-eGFP). The assay revealed strong <italic>in vitro</italic> expression of both proteins. Moreover, the cell cytomembrane stained with Cy3 appeared red (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, Cy3-rVSV/CCHFV), the cell nuclei stained with DAPI appeared blue (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, DAPI-rVSV/CCHFV), and the surface of rVSV/CCHFV-infected cells appeared red (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, Merge-rVSV/CCHFV), suggesting that both proteins have efficiently packaged on the surface of rVSV/CCHFV.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Indirect immunofluorescence staining to detect the expression of Crimean-Congo hemorrhagic fever virus (CCHFV) GP (100&#xd7;). After being infected with recombinant vesicular stomatitis virus (rVSV) for 48&#xa0;h, Vero E6 cells were permeabilized and immunostained with specific antibodies (anti-CCHFV-eG<sub>N</sub> and anti-CCHFV pre-G<sub>C</sub> monoclonal antibody (mAb) clone 11E7) and the control antibody [serum in phosphate-buffered saline (PBS) group]. Then, Vero E6 cells were stained with the anti-mouse Cy3-conjugated secondary antibody and 4&#x2032;,6-diamidino-2-phenylindole (DAPI). Merge: DAPI + Cy3. DAPI, 4&#x2032;,6-diamidino-2-phenylindole; Cy3, cyanine. Cytomembranes were stained with Cy3 (red for cytomembrane localization). Nuclei were stained with DAPI (blue for nuclear localization).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g004.tif"/>
</fig>
<p>In summary, the replication-competent virus (rVSV/CCHFV) was successfully rescued, and CCHFV-GPC&#x394; was strongly expressed <italic>in vitro</italic>.</p>
</sec>
<sec id="s3_2_2">
<label>3.2.2</label>
<title>Establishment of rVSV/CCHFV-based neutralization assay</title>
<p>The functionality of the rVSV/CCHFV particle was also evaluated using anti-CCHFV pre-G<sub>C</sub> mAb 11E7 in a neutralization assay (BEI Resources, Manassas, VA, USA). No inhibition was observed after the reaction between rVSV-eGFP and the anti-CCHFV pre-G<sub>C</sub> mAb clone 11E7 (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>), and sera in the control group (mice were vaccinated with PBS) were not able to inhibit rVSV/CCHFV particles in Vero E6 cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>), indicating the specificity of the responses. Inhibition of 100% was observed when rVSV/CCHFV particles were treated with anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (at a dilution of 1:512, BEI Resources, Manassas, VA, USA; <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>), while the mAb 11E7 (at a dilution of 1,024) did not completely inhibit the infection of rVSV/CCHFV particle in Vero E6 cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>). The results indicated that the rVSV/CCHFV-based neutralization assay was effective in the neutralization test.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Establishment of recombinant vesicular stomatitis virus/Crimean-Congo hemorrhagic fever virus (rVSV/CCHFV)-based neutralization assay by evaluating the neutralization infectivity of monoclonal antibody (mAb) 11E7. <bold>(A)</bold> MAb 11E7 was unable to block rVSV-enhanced green fluorescence protein (eGFP) infection in Vero E6 cells [fluorescence, bottom; cytopathic effect (CPE), top]. <bold>(B)</bold> Sera in control group [serum in phosphate-buffered saline (PBS) group] were not able to inhibit the infection of rVSV/CCHFV particles in Vero E6 cells (fluorescence, bottom; CPE, top). <bold>(C)</bold> MAb 11E7 (at a dilution of 1:512) was able to completely inhibit the infectivity of rVSV/CCHFV particles (fluorescence, bottom; CPE, top). <bold>(D)</bold> MAb 11E7 (at a dilution of 1:1,024) cannot completely inhibit the infectivity of rVSV/CCHFV particles in Vero E6 cells (fluorescence, bottom; CPE, top); magnification of microscopy images, 100&#xd7;.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Application of the rGP-based ELISA and rVSV/CCHFV-based neutralization assay in experimental serum samples</title>
<p>rGP-based ELISA and the rVSV/CCHFV-based neutralization assays were used to determine the titers of anti-CCHFV-GP IgG and neutralizing antibodies in experimental serum samples. Meanwhile, the antigenicity (binding and neutralization capacity) of the rGP and rVSV/CCHFV particles was validated again by these experimental serum samples.</p>
<p>As expected, the IgG antibody titers of five experimental serum samples in the control group (M-PBS) were below the limit of detection (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). In the detection of mouse sera vaccinated with subunit vaccine, the second immunization of mice with the A-G-eG<sub>C</sub> vaccine (G<sub>C subunit i.s.-2</sub>) through i.s. route produced significantly detectable IgG and NAbs than that in the M-PBS group, and the third immunization of mice with the A-G-eG<sub>C</sub> vaccine (G<sub>C subunit i.s.-3</sub>) through i.s. route produced significantly detectable IgG and NAbs than that in the G<sub>C subunit i.s.-2</sub> group (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). In the testing of animal sera vaccinated with the CCHFV candidate vaccine based on VSV, the first immunization of mice with the rVSV/CCHFV vaccine by either i.s. or i.p. pathway (subcutaneous or intraperitoneal injection, M-V-G<sub>i.s.-1</sub> or M-V-G<sub>i.p.-1</sub>, respectively) did not generate any detectable IgG antibodies (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). Interestingly, these negative samples (M-V-G<sub>i.s.-1</sub> or M-V-G<sub>i.p.-1</sub>) in the ELISA results were demonstrated as truly positive in the detection of NAbs (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>), with the geometric mean titer (GMT) reaching 25.6 &#xb1; SD (M-V-G<sub>i.s.-1</sub>), and the GMT was 160 &#xb1; SD in M-V-G<sub>i.p.-1</sub>. IgG antibody titers after the booster vaccination showed relatively high levels and were significantly higher than that after the first vaccination with two inoculation methods (*** p &lt; 0.001), with GMT reaching 98,304 &#xb1; SD in the M-V-G<sub>i.s.-2</sub> group and reaching 131,072 &#xb1; SD in the M-V-G<sub>i.P.-2</sub> group (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). In addition, NAbs after the booster vaccination (GMT was 614.4 &#xb1; SD) showed relatively high levels and were significantly higher than that after the first vaccination (160 &#xb1; SD) by intraperitoneal injection (** p &lt; 0.01). Compared with the GMT of NAbs (192 &#xb1; SD) in the M-V-G<sub>i.s.-2</sub> group, the GMT of NAbs in the M-V-G<sub>i.P.-2</sub> group was significantly enhanced, reaching 614.4 &#xb1; SD (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). Furthermore, the results also showed that the IgG antibody titers of the five experimental serum samples in the control group (S-PBS) were below the limit of detection (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>). There were no detected IgG antibodies in five experimental serum samples from the first immunization of Syrian hamsters with the rVSV/CCHFV vaccine by i.p. pathway (intraperitoneal injection, S-V-G<sub>i.p.-1</sub>; <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref>), while the GMTs of NAbs reached 358.4 &#xb1; SD, which were significantly higher than those in the control group (S-PBS, unpaired t-test, *** p &lt; 0.001; <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). Compared with S-V-G<sub>i.p.-1</sub>, IgG antibody titers and NAbs of sera in S-V-G<sub>i.p.-2</sub> were significantly enhanced, with the endpoint GMT of IgG titers and NAbs reaching 89,512 &#xb1; SD (unpaired t-test, **p &lt; 0.01) and 716.8 &#xb1; SD (unpaired t-test, * p &lt; 0.05) (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>). As the immunizing doses of mice and Syrian hamsters were different, no comparison was made about the serum antibody levels between the two animals.</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>
<italic>In vivo</italic> experiment humoral immune responses and correlation between surrogate virus neutralization test (sVNT) and indirect IgG ELISA. Sera from mice or Syrian hamsters vaccinated with G<sub>C</sub> subunit candidate vaccine and Crimean-Congo hemorrhagic fever virus (CCHFV) candidate vaccine based on vesicular stomatitis virus (VSV). <bold>(A)</bold> Enzyme-linked immunosorbent assay (ELISA) using plates coated with 400 ng/well of purified recombinant glycoprotein (rGP) and diluted sera from mice or Syrian hamsters vaccinated with G<sub>C</sub> subunit candidate vaccine and CCHFV candidate vaccine based on VSV. <bold>(B)</bold> Surrogate virus neutralization test (sVNT) from diluted endpoint mouse or Syrian hamster sera with G<sub>C</sub> subunit candidate vaccine and CCHFV candidate vaccine based on VSV incubated on Vero E6 cells. Anti-CCHFV pre-GC monoclonal antibody (mAb) clone 11E7 (11E7) was used as a positive control and diluted in duplicate, together with mouse and Syrian hamster sera serially diluted twofold with DMEM. Data are shown as the mean &#xb1; SD and were analyzed using an unpaired t-test (* p &lt; 0.05, ** p &lt; 0.01, *** p &lt; 0.001, and **** p &lt; 0.0001). G<sub>Csubunit i.s.-2/i.s.-3</sub>: mice were vaccinated with subunit vaccine by subcutaneous injection after the second and third vaccinations. M-V-G<sub>i.s.-1</sub> and M-V-G<sub>i.s.-2</sub>, M-V-G<sub>i.P.-1</sub> and M-V-G<sub>i.P.-2</sub>: Mice were vaccinated with CCHFV candidate vaccine based on VSV by subcutaneous or intraperitoneal injection after the first and second vaccinations. S-V-G<sub>i.p.-1</sub> and S-V-G<sub>i.p.-2</sub>: Syrian hamsters were vaccinated with CCHFV candidate vaccine based on VSV by intraperitoneal injection after the first and second vaccinations. S-PBS/M-PBS: mice or Syrian hamsters were vaccinated with phosphate-buffered saline (PBS). <bold>(C)</bold>&#xa0;ELISA results with serum dilutions (x-axis) and the sVNT result/serum dilution (y-axis). There is an imperfect correlation (R<sup>2&#xa0;</sup>=&#xa0;0.5058) between the titer of indirect IgG ELISA and neutralizing antibodies.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-14-1341332-g006.tif"/>
</fig>
<p>Moreover, the overall results of the two serological assays remained consistent in that the highest neutralization efficiency was observed in the mouse serum sample with the highest IgG titer, which was also mentioned in a previous study (<xref ref-type="bibr" rid="B40">Vasmehjani et&#xa0;al., 2020</xref>). However, comparing the results of rGP-based ELISA and sVNT, we also found that some sera were positive in sVNT, whereas these sera were negative in the rGP-based ELISA. Because of the lack of testing with field samples, we could not make a perfect correlation (R<sup>2</sup>&#xa0;=&#xa0;0.5058) between the titer of CCHF IgG and neutralizing antibodies (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>), and this phenomenon demonstrated an inconsistent correlation between IgG and neutralizing antibodies. All controversial serum samples should be additionally tested with traditional detection methods, such as inactivated virus-based ELISA and live virus-based PRNT in the future.</p>
<p>Therefore, rGP and rVSV/CCHFV can be used to detect antigens to determine the titers of anti-CCHFV-GP IgG and neutralizing antibodies in experimental serum samples from two kinds of animals (mice and Syrian hamsters).</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Various serological assays including the detection of antibodies by ELISA (IgG and IgM), indirect IFA, hemagglutination inhibition test, and the virus neutralization test (VNT) can be used for the detection of CCHFV antibodies in human and animal sera. However, live CCHFV must be manipulated in BSL-4 laboratories, and basic seroprevalence studies on the CCHFV have been severely hampered by biosafety requirements. Seroprevalence studies, such as ELISAs based on recombinant proteins and VNTs based on surrogate viruses, are safe and comparably inexpensive detecting tools. NP is highly conserved and the immunodominant protein of CCHFV. However, even though NP is highly immunogenic, antibodies against the NP do not exhibit neutralizing activities. Currently, ELISAs based on CCHFV NP have been used for detecting IgG antibodies and not neutralizing antibodies in humans and animals (<xref ref-type="bibr" rid="B32">Saijo et&#xa0;al., 2002</xref>; <xref ref-type="bibr" rid="B39">Tang et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B33">Saijo et&#xa0;al., 2005</xref>). GP is a dominant protein that causes IgG and neutralizing antibodies, and more and more researchers have realized the role of GP in the detection of antibodies. Recently, some ELISAs based on GP and NP have been published, such as a multiplex assay for simultaneous detection of antibodies against CCHFV NP and glycoproteins (G<sub>N</sub> ectodomain and GP38) in ruminants (<xref ref-type="bibr" rid="B22">Hoste et al., 2023</xref>), an ELISA (Rec-ELISA) based on a purified recombinant nucleocapsid protein (rNP) and mucin-like variable domain (rMLD) for detection of antibodies in CCHF-suspected patient sera (<xref ref-type="bibr" rid="B19">Gulce-Iz et&#xa0;al., 2021</xref>), and a Gc and NP-specific ELISA for detection of antibodies in domestic animal sera (<xref ref-type="bibr" rid="B2">Belij-Rammerstorfer et&#xa0;al., 2022</xref>). However, this sophisticated approach is hardly feasible in a normal lab. Moreover, many vaccine candidates based on glycoprotein have demonstrated variable efficacy in multiple animal models for CCHFV, while there are few descriptions of seroprevalence studies based on only CCHFV GP to evaluate the antibody response after vaccination and even explore the relation between IgG and the neutralizing antibody in the BSL-2 laboratory.</p>
<p>In our present study, we bacterially expressed a truncated glycoprotein to achieve a high yield, whose gene was a highly conserved antibody-binding site in the CCHFV GP. Purified rGP was demonstrated as a 23-kDa protein with antigenicity. Our data support that this region (aa 1443&#x2013;1566 in the M segment of the IbAr10200 strain) is an antibody-binding site to mAb 11E7 and has good reactogenicity (<xref ref-type="bibr" rid="B1">Ahmed et&#xa0;al., 2005</xref>). Our bacterially expressed rGP is more safe and comparably inexpensive compared with traditional inactivated viruses and enables further production on a large scale. In addition, a recombinant virus based on the reverse genetic system of VSV was constructed, with the coding sequence of VSV spike G replaced by the CCHFV GPC and the 53 amino acids of C-terminal tail (aa 1632&#x2013;1684) in CCHFV GPC truncated in the present study. The replication-competent virus (rVSV/CCHFV) was successfully rescued (the peak titer was 10<sup>6.667</sup> TCID<sub>50</sub>/mL), and rVSV/CCHFV particle maintained the rhabdovirus morphology and a classical bullet shape. Our data support that the truncation of this region enables the replication of competent rVSV/CCHFV formation (<xref ref-type="bibr" rid="B38">Suda et&#xa0;al., 2016</xref>). CCHFV-GPC&#x394; was strongly expressed <italic>in vitro</italic>, which we were able to detect by Western blotting and IFA, and a form of CCHFV-G<sub>C</sub> or PreG<sub>C</sub> was present and functional on the surface of the rVSV/CCHFV virion with the tools currently available. Structural CCHFV-G<sub>C</sub> has been known as an important protein for CCHFV and contains a putative receptor binding region for mammalian cell surface nucleolin (<xref ref-type="bibr" rid="B45">Xiao et&#xa0;al., 2011</xref>), the main neutralization epitope (<xref ref-type="bibr" rid="B1">Ahmed et&#xa0;al., 2005</xref>). As the only un-purified rVSV/CCHFV currently was available, the detecting of of the mature CCHFV-G<sub>N</sub> or PreG<sub>N</sub> was limited. Our replication-competent rVSV can propagate and display high infectivity on Vero E6 cells, enabling further explorations about these components at a BSL-2 containment without the need for transfections for in trans expression of CCHFV-GPC onto VSV&#x394;G systems.</p>
<p>Two methods for the detection of antibodies in the forms of an ELISA and an sVNT were developed using a rGP and a recombinant virus rVSV/CCHFV, respectively. The binding and neutralization activity of the rGP and rVSV/CCHFV were also evaluated using anti-CCHFV pre-G<sub>C</sub> mAb 11E7 (BEI Resources, Manassas, VA, USA), which was identified as a broadly neutralizing anti-CCHFV mAb in the study by Marko Zivcec et&#xa0;al (<xref ref-type="bibr" rid="B46">Zivcec et&#xa0;al., 2015</xref>). In two tests, 400 ng/well of the rGP and 200 TCID<sub>50</sub> rVSV/CCHFV were used as the antigens in the IgG ELISA and sVNT. The results showed that mAb clone 11E7 (diluted at 1:163,840 or 512) still displayed positive binding and neutralization, indicating that bacterially expressed rGP and rVSV/CCHFV have good reactogenicity. The use of the broadly cross-reactive and neutralizing antibody mAb clone 11E7 (BEI Resources, Manassas, VA, USA) further strengthens the reliability and specificity of the assays.</p>
<p>As real CCHFV-neutralization assays involve the manipulation of live CCHFV and require professional operators under BSL-4 containment, which are not currently available in our laboratory, CCHFVpv (a pseudotyped VSV bearing the CCHFV envelope GP) showed similar neutralizing activities with the real CCHFV in the detection of six serum samples obtained from patients in Tajikistan with confirmed CCHF, and Chamberlain et&#xa0;al. thought that neutralization assays using CCHFVpv in BSL-2 laboratories can be used as a convenient alternative to assays using infectious CCHFV in BSL-4 facilities (<xref ref-type="bibr" rid="B37">Suda et&#xa0;al., 2018</xref>). In addition, the reliability of using recombinant VSV instead of the authentic virus to detect SARS-CoV-2 specific neutralizing antibodies has been shown in other studies (<xref ref-type="bibr" rid="B10">Case et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B12">Dieterle et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B26">Li et&#xa0;al., 2020</xref>; <xref ref-type="bibr" rid="B21">He et&#xa0;al., 2023</xref>). In the present study, the applications of rGP and rVSV/CCHFV as diagnostic antigens were validated for the specific detection of CCHFV IgG and neutralizing antibodies in experimental animals, indicating that the bacterially expressed rGP and rVSV/CCHFV have good immunoreactivity with animal sera. By analyzing and comparing the detection results of two vaccine candidates between this study and methods mentioned in the literature of Jeroen Kortekaas et&#xa0;al. and Sergio E. Rodriguez et&#xa0;al (<xref ref-type="bibr" rid="B25">Kortekaas et&#xa0;al., 2015</xref>). (<xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2022a</xref>), we found some similarity in the test results in the evaluation of the CCHFV candidate vaccine based on VSV, which can introduce high-titer antibody in mice, especially the neutralizing antibody. In addition, the immunizing dose did influence the neutralizing antibody produced by this VSV vector candidate vaccine. In the study of Sergio E. Rodriguez et&#xa0;al., they intraperitoneally administered 10<sup>7</sup> pfu/dose of &#x394;G rVSV-CCHFV-GPC&#x394; to prime and boosted groups of five STAT-1<sup>&#x2212;/&#x2212;</sup> mice; the result showed that the prime-only group had neutralizing antibody titers with a PRNT50 of &lt;1:1,280 and that the boosted group had a PRNT50 of &lt;1:320 at the study endpoint. In our study, we intraperitoneally administered 0.5 &#xd7; 10<sup>6</sup> TCD<sub>50</sub>/dose of (&#x394;G rVSV-CCHFV-GPC&#x394;) to prime and boosted groups of five BABL/c mice; NAbs after the booster vaccination (GMT was 614.4 &#xb1; SD) showed relatively high levels and were significantly higher than those after the first vaccination (160 &#xb1; SD) by intraperitoneal injection. Moreover, we found that the titer of antibodies produced by VSV-CCHFV-GP via the intraperitoneal route was significantly increased than that via the subcutaneous route, with the GMT of NAbs (192 &#xb1; SD) in the M-V-G<sub>i.s.-2</sub> group and the GMT of NAbs (614.4 &#xb1; SD) in the M-V-G<sub>i.P.-2</sub> group. The immunization route may be a possible explanation for the difference in neutralizing antibody titers between the previous G<sub>C</sub> protein subunit vaccine (Jeroen Kortekaas et&#xa0;al.) via the intraperitoneal route (an average 80% endpoint titer of 333) and our GEM-PA-based subunit vaccine (G-eG<sub>C</sub>) of CCHFV via the subcutaneous route (an average neutralizing antibody titer of 1:70.4; <xref ref-type="bibr" rid="B42">Wang et&#xa0;al., 2022a</xref>). Currently, Syrian hamsters are a good animal model for evaluating the immunogenicity of the SARS-CoV-2 candidate vaccine based on VSV, and sVNT based on recombinant VSV is usually used for detecting the titers of neutralizing antibodies in Syrian hamster sera (<xref ref-type="bibr" rid="B43">Wang et&#xa0;al., 2022b</xref>; <xref ref-type="bibr" rid="B21">He et&#xa0;al., 2023</xref>). However, there have been no reports of this CCHFV candidate vaccine based on VSV being administered to Syrian hamsters, and we used the sVNT to detect specific antibodies in Syrian hamster sera vaccinated with CCHFV candidate vaccine based on VSV for the first time.</p>
<p>Two serological assays consistently had the highest neutralization efficiency observed in the serum sample with the highest IgG titer, which was also mentioned in a previous study (<xref ref-type="bibr" rid="B40">Vasmehjani et&#xa0;al., 2020</xref>). However, comparing the IgG antibody titers and NAbs in the activated animal sera involved in this study, we found that some sera after the first vaccination were positive in sVNT, whereas these sera were negative in the rGP-based ELISA, indicating an inconsistent correlation between IgG and neutralizing antibodies. Because of the lack of testing with field samples, we could not make a perfect correlation (R<sup>2&#xa0;</sup>=&#xa0;0.5058) between the titer of CCHF IgG and neutralizing antibodies. Using the truncated recombinant GPC antigen does have its limitations, which may be the explanation for the different outcomes of the titers of specific IgG antibodies compared to the pseudo-neutralization assay. All controversial serum samples should be additionally tested in the future using traditional detection methods, such as inactivated virus-based ELISA and live virus-based PRNT. In addition, the relationship between IgG and neutralizing antibodies should be investigated to research the immune response dynamics and contribute to a better understanding of CCHFV infection in the future. Moreover, infected animals would have positive results in both proteins (NP and GP), whereas those immunized with a vaccine based on GP animals would have positive GP ELISAs and pseudo-neutralization assay. Therefore, the two assays represent a useful tool for vaccination strategies following the differentiating infected from vaccinated animals (DIVA) concept.</p>
<p>However, our research also has several limitations. First, even though the admittedly commercial antibody mAb 11E7 and some experimental samples were used to evaluate our two serological methods, the lack of testing with field samples is a notable limitation of this study. Our future work will validate the developed tests using clinical samples collected from CCHFV-endemic regions, particularly in areas in China where sheep and ruminants have been reported to be positive for the virus. Second, the two serological methods to detect the specific antibody against CCHFV GP in serum samples were developed, but the reliability and usefulness of the two assays should be evaluated by comparing the results of widely used traditional ELISA and &#x201c;gold-standard&#x201d; neutralization assay using inactivated or infectious CCHFV. Further research should focus on obtaining field samples and conducting extensive validation studies to assess the sensitivity, specificity, and reliability of the rGP-based ELISA and rVSV/CCHFV-based sVNT. Third, choosing the truncated recombinant GP as an antigen may have its limitations, which may not allow the detection of antibodies targeting other GPC epitopes. A comparison of the detection efficiency between truncated recombinant GP and recombinant full-length Gc antigen protein is needed. Finally, as the glycoprotein of different CCHFV strains exhibits genetic variability, with the mucin-like domain in G<sub>N</sub> in particular being highly divergent and even the highly conserved G<sub>C</sub> showing antigenic variability, whether the rGP and rVSV/CCHFV in the present study can detect samples of different CCHFV strains is the direction of our future efforts. We are always working to find highly conserved antibody-binding sites and establish surrogate viruses of different strains to develop universal detection methods for IgG and neutralizing antibodies.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>Our bacterially expressed glycoprotein and recombinant virus based on vesicular stomatitis virus have good antigenicity, and the novel rGP-based IgG ELISA and surrogate virus (rVSV/CCHFV)-based neutralization assays can be safe tools for detecting antibodies against CCHFV GP including commercial inhibitors and inactivated animal sera in a BSL-2 laboratory. The use of the broadly cross-reactive and neutralizing antibody clone 11E7 further strengthens the reliability and specificity of the assays. Therefore, the rGP and rVSV/CCHFV are promising alternatives to the CCHFV for research on specific antibody and serological samples.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The studies on the sVNT using the recombinant virus (rVSV/CCHFV) were performed under BSL-2 conditions. All rodent experiments were strictly conducted according to the guidance of the Animal Welfare and Ethics Committee of the Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences(approval number: IACUC of AMMS-11-2020 -020). cDNA encoding the open reading frame of the CCHFV IbAr10200 strain GPC (GenBank ID: AF467768) was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China).</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>QW: Formal analysis, Software, Writing &#x2013; original draft. SW: Methodology, Writing &#x2013; review &amp; editing. ZS: Methodology, Writing &#x2013; review &amp; editing. ZL: Methodology, Writing &#x2013; review &amp; editing. YZ: Conceptualization, Writing &#x2013; review &amp; editing. NF:&#xa0;Conceptualization, Writing &#x2013; review &amp; editing. TW: Conceptualization, Writing &#x2013; review &amp; editing. FY:&#xa0;Conceptualization, Funding acquisition, Project administration, Writing &#x2013; review &amp; editing. XX: Conceptualization, Supervision, Writing &#x2013; review &amp; editing.</p>
</sec>
</body>
<back>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This research was supported by the National Key Research and Development Program of China (2021YFF0703600).</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>Thanks to Bo Liang and Wenwen He, Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences, for their exceptional contributions to the writing of the article.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
<p>The author(s) declared that they were an editorial board member of Frontiers, at the time of submission. This had no impact on the peer review process and the final decision.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ahmed</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>McFalls</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Hoffmann</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Filone</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Stewart</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Paragas</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Presence of broadly reactive and group-specific neutralizing epitopes on newly described isolates of Crimean-Congo hemorrhagic fever virus</article-title>. <source>J. Gen. Virol.</source> <volume>86</volume>, <fpage>3327</fpage>&#x2013;<lpage>3336</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/vir.0.81175-0</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Belij-Rammerstorfer</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Limon</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Maze</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Hannant</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Tchakarova</surname> <given-names>S. R.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Development of anti-Crimean-Congo hemorrhagic fever virus Gc and NP-specific ELISA for detection of antibodies in domestic animal sera</article-title>. <source>Front. Veterinary Sci.</source> <volume>9</volume>, <elocation-id>913046</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fvets.2022.913046</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bente</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Forrester</surname> <given-names>N. L.</given-names>
</name>
<name>
<surname>Watts</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>McAuley</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Whitehouse</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Bray</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical syndrome and genetic diversity</article-title>. <source>Antiviral Res.</source> <volume>100</volume>, <fpage>159</fpage>&#x2013;<lpage>189</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.antiviral.2013.07.006</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bergeron</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Albarino</surname> <given-names>C. G.</given-names>
</name>
<name>
<surname>Khristova</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Nichol</surname> <given-names>S. T.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Crimean-Congo hemorrhagic fever virus-encoded ovarian tumor protease activity is dispensable for virus RNA polymerase function</article-title>. <source>J. Virol.</source> <volume>84</volume>, <fpage>216</fpage>&#x2013;<lpage>226</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.01859-09</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bergeron</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Vincent</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Nichol</surname> <given-names>S. T.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Crimean-Congo hemorrhagic fever virus glycoprotein processing by the endoprotease SKI-1/S1P is critical for virus infectivity</article-title>. <source>J. Virol.</source> <volume>81</volume>, <fpage>13271</fpage>&#x2013;<lpage>13276</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.01647-07</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bertolotti-Ciarlet</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Strecker</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Paragas</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Altamura</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>McFalls</surname> <given-names>J. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Cellular localization and antigenic characterization of crimean-congo hemorrhagic fever virus glycoproteins</article-title>. <source>J. Virol.</source> <volume>79</volume>, <fpage>6152</fpage>&#x2013;<lpage>6161</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.79.10.6152-6161.2005</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boushab</surname> <given-names>B. M.</given-names>
</name>
<name>
<surname>Kelly</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kebe</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Bollahi</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Basco</surname> <given-names>L. K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Crimean-congo hemorrhagic fever, Mauritania</article-title>. <source>Emerg. Infect. Dis.</source> <volume>26</volume>, <fpage>817</fpage>&#x2013;<lpage>818</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3201/eid2604.191292</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bukbuk</surname> <given-names>D. N.</given-names>
</name>
<name>
<surname>Fukushi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tani</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yoshikawa</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Taniguchi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Iha</surname> <given-names>K.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Development and validation of serological assays for viral hemorrhagic fevers and determination of the prevalence of Rift Valley fever in Borno State, Nigeria</article-title>. <source>Trans. R Soc. Trop. Med. Hyg</source> <volume>108</volume>, <fpage>768</fpage>&#x2013;<lpage>773</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/trstmh/tru163</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Capua</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Crimean-Congo haemorrhagic fever in ostriches: A public health risk for countries of the European Union</article-title>? <source>Avian Pathol.</source> <volume>27</volume>, <fpage>117</fpage>&#x2013;<lpage>120</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/03079459808419311</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Case</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Rothlauf</surname> <given-names>P. W.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>R. E.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>A. S.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Neutralizing antibody and soluble ACE2 inhibition of a replication-competent VSV-SARS-CoV-2 and a clinical isolate of SARS-CoV-2</article-title>. <source>Cell Host Microbe</source> <volume>28</volume>, <fpage>475</fpage>&#x2013;<lpage>485.e475</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chom.2020.06.021</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Di Bonito</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Bosco</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mochi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Accardi</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ciufolini</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Nicoletti</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2002</year>). <article-title>Human antibody response to Toscana virus glycoproteins expressed by recombinant baculovirus</article-title>. <source>J. Med. Virol.</source> <volume>68</volume>, <fpage>615</fpage>&#x2013;<lpage>619</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jmv.10227</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dieterle</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Haslwanter</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bortz</surname> <given-names>R. H.</given-names>
</name>
<name>
<surname>Wirchnianski</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Lasso</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Vergnolle</surname> <given-names>O.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>A replication-competent vesicular stomatitis virus for studies of SARS-CoV-2 spike-mediated cell entry and its inhibition</article-title>. <source>Cell Host Microbe</source> <volume>28</volume>, <fpage>486</fpage>&#x2013;<lpage>496.e486</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.chom.2020.06.020</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dzikwi-Emennaa</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Meseko</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Emennaa</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Adeyinka</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Adamu</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Adegboye</surname> <given-names>O. A.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Detection of crimean-congo hemorrhagic fever virus antibodies in cattle in plateau state, Nigeria</article-title>. <source>Viruses</source> <volume>14</volume>, <fpage>2618</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v14122618</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ergonul</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Crimean-Congo hemorrhagic fever virus: new outbreaks, new discoveries</article-title>. <source>Curr. Opin. Virol.</source> <volume>2</volume>, <fpage>215</fpage>&#x2013;<lpage>200</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.coviro.2012.03.001</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukushi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mizutani</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Matsuyama</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Miyajima</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Taguchi</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Vesicular stomatitis virus pseudotyped with severe acute respiratory syndrome coronavirus spike protein</article-title>. <source>J. Gen. Virol.</source> <volume>86</volume>, <fpage>2269</fpage>&#x2013;<lpage>2274</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/vir.0.80955-0</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fukushi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tani</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Yoshikawa</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Morikawa</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Serological assays based on recombinant viral proteins for the diagnosis of arenavirus hemorrhagic fevers</article-title>. <source>Viruses</source> <volume>4</volume>, <fpage>2097</fpage>&#x2013;<lpage>2114</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v4102097</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gargili</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Estrada-Pea</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Spengler</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Lukashev</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Nuttall</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>Bente.</surname> <given-names>D. A.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>The role of ticks in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus: A review of published field and laboratory studies</article-title>. <source>Antiviral Res.</source> <volume>144</volume>, <fpage>93</fpage>&#x2013;<lpage>119</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.antiviral.2017.05.010</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garrison</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Alkhovsky &#x410;&#x43b;&#x44c;&#x445;&#x43e;&#x432;&#x441;&#x43a;&#x438;&#x439; &#x421;&#x435;&#x440;&#x433;&#x435;&#x439; &#x412;&#x43b;&#x430;&#x434;&#x438;&#x43c;&#x438;&#x440;&#x43e;&#x432;&#x438;&#x447;</surname> <given-names>S. V.</given-names>
</name>
<name>
<surname>Avsic-Zupanc</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Bente</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Bergeron</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Burt</surname> <given-names>F.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>ICTV virus taxonomy profile: Nairoviridae</article-title>. <source>J. Gen. Virol.</source> <volume>101</volume>, <fpage>798</fpage>&#x2013;<lpage>799</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/jgv.0.001485</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gulce-Iz</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Elaldi</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Can</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Sahar</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Karakavuk</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Gul</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Development of a novel recombinant ELISA for the detection of Crimean-Congo hemorrhagic fever virus IgG antibodies</article-title>. <source>Sci. Rep.</source> <volume>11</volume>, <fpage>5936</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-021-85323-1</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haglund</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Forman</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Krausslich</surname> <given-names>H. G.</given-names>
</name>
<name>
<surname>Rose</surname> <given-names>J. K.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Expression of human immunodeficiency virus type 1 Gag protein precursor and envelope proteins from a vesicular stomatitis virus recombinant: high-level production of virus-like particles containing HIV envelope</article-title>. <source>Virology</source> <volume>268</volume>, <fpage>112</fpage>&#x2013;<lpage>121</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1006/viro.1999.0120</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Cui</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2023</year>). <article-title>Characterization of a vesicular stomatitis virus-vectored recombinant virus bearing spike protein of SARS-CoV-2 delta variant</article-title>. <source>Microorganisms</source> <volume>11</volume>, <fpage>431</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/microorganisms11020431</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoste</surname> <given-names>A. C. R.</given-names>
</name>
<name>
<surname>Djadjovski</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Angel Jimenez-Clavero</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Rueda</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Barr</surname> <given-names>J. N.</given-names>
</name>
<name>
<surname>Sastre</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Multiplex assay for simultaneous detection of antibodies against crimean-congo hemorrhagic fever virus nucleocapsid protein and glycoproteins in ruminants</article-title>. <source>Microbiol. Spectr.</source> <volume>11</volume>(<issue>2</issue>), <elocation-id>e02600-22</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/spectrum.02600-22</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jackel</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Eiden</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Balkema-Buschmann</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ziller</surname> <given-names>M.</given-names>
</name>
<name>
<surname>van Vuren</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Paweska</surname> <given-names>J. T.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>A novel indirect ELISA based on glycoprotein Gn for the detection of&#xa0;IgG antibodies against Rift Valley fever virus in small ruminants</article-title>. <source>Res. Vet. Sci.</source> <volume>95</volume>, <fpage>725</fpage>&#x2013;<lpage>730</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.rvsc.2013.04.015</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kohl</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Grone</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Moennig</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Herrler</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Expression of the surface glycoprotein E2 of Bovine viral diarrhea virus by recombinant vesicular stomatitis virus</article-title>. <source>J. Gen. Virol.</source> <volume>88</volume>, <fpage>157</fpage>&#x2013;<lpage>165</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/vir.0.81972-0</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kortekaas</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Vloet</surname> <given-names>R. P.</given-names>
</name>
<name>
<surname>McAuley</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Shen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Bosch</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>de Vries</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Crimean-congo hemorrhagic fever virus subunit vaccines induce high levels of neutralizing antibodies but no protection in STAT1 knockout mice</article-title>. <source>Vector Borne Zoonotic Dis.</source> <volume>15</volume>, <fpage>759</fpage>&#x2013;<lpage>764</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1089/vbz.2015.1855</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Yuan</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>X.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Establishment of replication-competent vesicular stomatitis virus-based recombinant viruses suitable for SARS-CoV-2 entry and neutralization assays</article-title>. <source>Emerg. Microbes Infect.</source> <volume>9</volume>, <fpage>2269</fpage>&#x2013;<lpage>2277</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/22221751.2020.1830715</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Cao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Salawudeen</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Emeterio</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Safronetz</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Vesicular stomatitis virus: from agricultural pathogen to vaccine vector</article-title>. <source>Pathogens</source> <volume>10</volume> (<issue>9</issue>), <fpage>1092</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/pathogens10091092</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marzi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kercher</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Marceau</surname> <given-names>J.</given-names>
</name>
<name>
<surname>York</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Callsion</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Gardner</surname> <given-names>D. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Stat1-deficient mice are not an appropriate model for efficacy testing of recombinant vesicular stomatitis virus-based filovirus vaccines</article-title>. <source>J. Infect. Dis.</source> <volume>212 Suppl 2</volume>, <fpage>S404</fpage>&#x2013;<lpage>S409</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/infdis/jiv188</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papa</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sidira</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Kallia</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ntouska</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zotos</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Doumbali</surname> <given-names>E.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Factors associated with IgG positivity to Crimean-Congo hemorrhagic fever virus in the area with the highest seroprevalence in Greece</article-title>. <source>Ticks Tick Borne Dis.</source> <volume>4</volume>, <fpage>417</fpage>&#x2013;<lpage>420</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ttbdis.2013.04.003</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Portillo</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Palomar</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Santib&#xe1;ez</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Oteo</surname> <given-names>J. A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Epidemiological aspects of crimean-congo hemorrhagic fever in western europe: What about the future</article-title>? <source>Microorganisms</source> <volume>9</volume>, <fpage>649</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/microorganisms9030649</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rodriguez</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Cross</surname> <given-names>R. W.</given-names>
</name>
<name>
<surname>Fenton</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Bente</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Mire</surname> <given-names>C. E.</given-names>
</name>
<name>
<surname>Geisbert</surname> <given-names>T. W.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Vesicular stomatitis virus-based vaccine protects mice against crimean-congo hemorrhagic fever</article-title>. <source>Sci. Rep.</source> <volume>9</volume>, <fpage>7755</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-019-44210-6</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Qing</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Niikura</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Maeda</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ikegami</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Prehaud</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2002</year>). <article-title>Recombinant nucleoprotein-based enzyme-linked immunosorbent assay for detection of immunoglobulin G antibodies to Crimean-Congo hemorrhagic fever virus</article-title>. <source>J. Clin. Microbiol.</source> <volume>40</volume>, <fpage>1587</fpage>&#x2013;<lpage>1591</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.40.5.1587-1591.2002</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Shimayi</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Asiguma</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Recombinant nucleoprotein-based serological diagnosis of Crimean-Congo hemorrhagic fever virus infections</article-title>. <source>J. Med. Virol.</source> <volume>75</volume>, <fpage>295</fpage>&#x2013;<lpage>299</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/jmv.20270</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Samudzi</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Leman</surname> <given-names>P. A.</given-names>
</name>
<name>
<surname>Paweska</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Swanepoel</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Burt</surname> <given-names>F. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Bacterial expression of Crimean-Congo hemorrhagic fever virus nucleoprotein and its evaluation as a diagnostic reagent in an indirect ELISA</article-title>. <source>J. Virol. Methods</source> <volume>179</volume>, <fpage>70</fpage>&#x2013;<lpage>76</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jviromet.2011.09.023</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanchez</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Vincent</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Erickson</surname> <given-names>B. R.</given-names>
</name>
<name>
<surname>Nichol</surname> <given-names>S. T.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Crimean-congo hemorrhagic fever virus glycoprotein precursor is cleaved by Furin-like and SKI-1 proteases to generate a novel 38-kilodalton glycoprotein</article-title>. <source>J. Virol.</source> <volume>80</volume>, <fpage>514</fpage>&#x2013;<lpage>525</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.80.1.514-525.2006</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanchez</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Vincent</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Nichol</surname> <given-names>S. T.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Characterization of the glycoproteins of Crimean-Congo hemorrhagic fever virus</article-title>. <source>J. Virol.</source> <volume>76</volume>, <fpage>7263</fpage>&#x2013;<lpage>7275</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.76.14.7263-7275.2002</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chamberlain</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Dowall</surname> <given-names>S. D.</given-names>
</name>
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Horimoto</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hewson</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>The development of a novel diagnostic assay that utilizes a pseudotyped vesicular stomatitis virus for the detection of neutralizing activity against crimean-congo hemorrhagic fever virus</article-title>. <source>Japanese J. Infect. Dis.</source> <volume>71</volume>, <fpage>205</fpage>&#x2013;<lpage>208</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.7883/yoken.JJID.2017.354</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Fukushi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tani</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Murakami</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Horimoto</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Analysis of the entry mechanism of Crimean-Congo hemorrhagic fever virus, using a vesicular stomatitis virus pseudotyping system</article-title>. <source>Arch. Virol.</source> <volume>161</volume>, <fpage>1447</fpage>&#x2013;<lpage>1454</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-016-2803-1</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Saijo</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Asiguma</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tianshu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>A patient with Crimean-Congo hemorrhagic fever serologically diagnosed by recombinant nucleoprotein-based antibody detection systems</article-title>. <source>Clin. Diagn. Lab. Immunol.</source> <volume>10</volume>, <fpage>489</fpage>&#x2013;<lpage>491</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/CDLI.10.3.489-491.2003</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vasmehjani</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Salehi-Vaziri</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Azadmanesh</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Nejati</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Pouriayevali</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Gouya</surname> <given-names>M. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Efficient production of a lentiviral system for displaying Crimean-Congo hemorrhagic fever virus glycoproteins reveals a broad range of cellular susceptibility and neutralization ability</article-title>. <source>Arch. Virol.</source> <volume>165</volume>, <fpage>1109</fpage>&#x2013;<lpage>1120</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00705-020-04576-9</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vincent</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Sanchez</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Erickson</surname> <given-names>B. R.</given-names>
</name>
<name>
<surname>Basak</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chretien</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Seidah</surname> <given-names>N. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2003</year>). <article-title>Crimean-Congo hemorrhagic fever virus glycoprotein proteolytic processing by subtilase SKI-1</article-title>. <source>J. Virol.</source> <volume>77</volume>, <fpage>8640</fpage>&#x2013;<lpage>8649</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JVI.77.16.8640-8649.2003</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>a). <article-title>GEM-PA-based subunit vaccines of crimean congo hemorrhagic fever induces systemic immune responses in mice</article-title>. <source>Viruses</source> <volume>14</volume>, <fpage>1664</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v14081664</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>b). <article-title>Characterization of immune response diversity in rodents vaccinated with a vesicular stomatitis virus vectored COVID-19 vaccine</article-title>. <source>Viruses</source> <volume>14</volume>, <fpage>1127</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/v14061127</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>WHO</collab>
</person-group>. (<year>2019</year>) <source>WHO R&amp;D Blueprint: Priority Diagnostics for CCHF Use Scenarios and Target Product Profles</source>. Available online at: <uri xlink:href="http://www.searo.who.int/docs/default-source/blue-print/call-for-comments/whocchf-tpp-dx-draf-v1-0.pdf?sfvrsn=a5b8580_2">http://www.searo.who.int/docs/default-source/blue-print/call-for-comments/whocchf-tpp-dx-draf-v1-0.pdf?sfvrsn=a5b8580_2</uri> (Accessed <access-date>November 20, 2023</access-date>).</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xiao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Feng</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Dimitrov</surname> <given-names>D. S.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Identification of a putative Crimean-Congo hemorrhagic fever virus entry factor</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>411</volume>, <fpage>253</fpage>&#x2013;<lpage>258</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2011.06.109</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zivcec</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Metcalfe</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Albarino</surname> <given-names>C. G.</given-names>
</name>
<name>
<surname>Guerrero</surname> <given-names>L. W.</given-names>
</name>
<name>
<surname>Pegan</surname> <given-names>S. D.</given-names>
</name>
<name>
<surname>Spiropoulou</surname> <given-names>C. F.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Assessment of inhibitors of pathogenic crimean-congo hemorrhagic fever virus strains using virus-like particles</article-title>. <source>PLoS Negl. Trop. Dis.</source> <volume>9</volume>, <elocation-id>e0004259</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0004259</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>