SARS-CoV-2 (B.1., Isolate “FI”, hCoV-19/Germany/FI1103201/2020) was taken from the strain repository of the Institute of Virology (IVM), Westfaelische Wilhelms-University Muenster, Germany (Schreiber et al., 2022), and passaged on Vero E6 cells (Cercopithecus aethiops, kidney epithelial cells) in a BSL3 laboratory. Influenza A virus, strain: A/Puerto Rico/8/1934 (H1N1) was obtained from Friedrich-Loeffler-Institute, Federal Research Centre for Virus Diseases of Animals, Tuebingen, Germany, and passaged on MDCK II cells in a BSL 2 laboratory. Calu-3 cells (Homo sapiens lung epithelial cells) and MDCK II cells (Canis familiaris kidney cells) were obtained from the American Type Culture Collection (ATCC). Caco-2 cells (Homo sapiens colon epithelial cells) were provided by the Institute for Medical Virology and Epidemiology of Viral Disease, Department of Molecular Virology, University Hospital Tuebingen, Germany. Cells were maintained in Iscove Modified Dulbecco Media (IMDM) (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Capricorn Scientific GmbH, Ebsdorfergrund, Germany) and 1% penicillin–streptomycin (Sigma Aldrich, St. Louis, MO, USA) at 37°C, 5% CO₂ in a humidified incubator.

The MEK1/2 inhibitor Zapnometinib (PD184264, ATR-002), [2-(2-chloro-4-iodophenylamino)-N-3,4-difluoro benzoic acid], was synthesized at ChemCon, Freiburg, Germany, and provided by Atriva Therapeutics, Tuebingen, Germany.

Calu-3 and Caco-2 cells were seeded in 24-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany) and grown to 90% confluence. The cells were washed once with infection medium [IMDM supplemented with 0.2% bovine serum albumin (BSA) (Carl Roth GmbH + Co. KG, Karlsruhe, Germany) and 1% penicillin–streptomycin] prior to infection with a multiplicity of infection (MOI) of 0.01 of IAV PR8 or SARS-CoV-2 for 1 h in 200 µL of infection medium per well. Afterwards, the virus inoculum was removed completely, and the cells were washed once with infection medium and then treated with 1 mL per well of different concentrations of zapnometinib in infection medium with 1% dimethyl sulfoxide (DMSO) (Merck Millipore, Burlington, MA, USA) for 24 h at 37°C, 5% CO₂. Supernatants were harvested and stored at −80°C for subsequent determination of virus titer and EC₅₀ value. Cell lysates were prepared as described in the “Preparation of cell lysates and WES™ analysis” section for WES™ analysis.

The viral titers of IAV and SARS-CoV-2 viruses were determined using a real-time one-step multiplex RT-qPCR method. Briefly, viral nucleic acid extraction was performed using a QIAamp Viral RNA Mini Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions. A TaqMan-based RT-qPCR assay was carried out using a QuantiNova Pathogen kit (Qiagen, Venlo, Netherlands) with specific primers targeting the SARS-CoV-2 N gene (2019-CoV2-N1F: AACACAAGCTTTCGGCAGAC, 2019-CoV2-N1R: ATTCCGAAGAACGCTGAAGC, 2019-CoV2-N1P [6FAM]: ACATTGGCCGCAAATTGCACAA [BHQ1]) and M gene for IAV according to the WHO guidelines. The viral genome copies per mL (gc/mL) were determined based on a standard curve prepared with 10-fold serial dilutions of the target gene. For quality control, nuclease-free water was included in each set of extractions as a negative control to monitor any possible cross-contamination. Moreover, an artificial exogenous QuantiNova RNA internal control (Qiagen, Venlo, Netherlands) was included during the nucleic acid purification to monitor the RNA purification efficiency and the RT-PCR amplification. A Rotor-Gene Q™ Real-Time PCR detection system (Qiagen, Venlo, Netherlands) was used for amplification, and the data were analyzed using Q-Rex software (Qiagen, Venlo, Netherlands).

For EC₅₀ determination, a virus yield reduction assay was performed. The virus titer in the cell culture supernatant was determined and normalized to the solvent control. The EC₅₀ value was determined using the “log(inhibitor) vs. normalized response - Variable slope” equation in GraphPad Prism version 9.4.0.

Cells were lysed using cold modified RIPA buffer [0.24% (w/v) tris base (Sigma-Aldrich, St. Louis, Missouri, USA), 0.88% (w/v) NaCl (Carl Roth, Karlsruhe, Germany), 0.2% (v/v) 500 mM ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, St. Louis, Missouri, USA), 1% (v/v) Triton X-100 (Sigma-Aldrich, St. Louis, Missouri, USA), 0.5% (w/v) sodium deoxycholate (Sigma-Aldrich, St. Louis, Missouri, USA), 0.1% (w/v) sodium dodecyl sulfate (SDS) (Carl Roth, Karlsruhe, Germany), 10% (v/v) glycerol (Carl Roth, Karlsruhe, Germany), 0.05% phenylmethylsulfonyl fluoride (PMSF) (Carl Roth, Karlsruhe, Germany), 0.01% Benzonase® Nuclease (Sigma-Aldrich, St. Louis, Missouri, USA), protease inhibitor cocktail (Roche, Basel, Switzerland), and phosphatase inhibitor cocktail (Roche, Basel, Switzerland) in water]. Determination of the protein concentration was performed using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions. The samples were analyzed by Wes™ using a total protein concentration of 0.25–0.5 µg/µL for each sample, the Jess/Wes Separation kit (12–230 kDa), primary antibodies against ERK1/2, p44/42 MAPK (137F5) Rabbit mAb (Cell Signaling Technology, Danvers, MA, USA, Cat. No. 4695S) and phospho-ERK1/2 (pERK1/2), Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E), XP® Rabbit mAb (Cell Signaling Technology, Danvers, MA, USA, Cat. no. 4370S) in a 1:50 dilution, anti-Influenza A virus Nucleoprotein (NP) antibody (rabbit MAb) (Sino Biological, Beijing, China Cat.no 40208-R010) in a 1:150 dilution, SARS-CoV-2 nucleocapsid protein antibody (ProSci Inc., Poway, CA, USA, Cat. no. 35-580) in a 1:100 dilution, the anti-goat, anti-rabbit, and anti-mouse detection modules, and the EZ Standard Pack 1 (12–230 kDa), according to the manufacturer’s instructions. Analysis of the obtained data was performed using the Compass for SW 4.1.0 software, Microsoft Excel, and the GraphPad Prism 9.2.0 software. Ratios were calculated from the area under the curve of the respective detected signals.

For determination of the IC₅₀ value in the absence of viral infection, the cells were seeded in 24-well plates and incubated at 37°C, 5% CO₂ until confluent. Twenty-four hours before the experiment, the growth medium was exchanged to medium with respective FBS or BSA concentration. Then, cells were stimulated by the addition of tumor necrosis factor alpha (TNF-α) (Sigma-Aldrich, St. Louis, Missouri, USA) for 30 min at 37°C, 5% CO₂, followed by treatment with different zapnometinib concentrations and a DMSO (solvent) control for 1 h. For determination of the IC₅₀ value in cells infected with IAV PR8 or SARS-CoV-2, cells were infected with the respective virus and treated with zapnometinib for 24 h as described in the “Virus yield reduction assay” section. After incubation, cell lysates were prepared, and the samples were analyzed by WES™ as described in the “Preparation of cell lysates and WES™ analysis” section. The pERK/ERK ratio was calculated and normalized to the solvent control. IC₅₀ values were determined using the “log(inhibitor) vs. response -Variable slope (four parameters)” equation in GraphPad Prism version 9.4.0.

Per well, 2.5 × 10⁴ Caco-2 cells or 4 × 10⁴ Calu-3 cells were seeded in 96-well plates (Greiner Bio-One, Kremsmünster, Austria) and incubated for 24 h at 37°C, 5% CO₂. Cell viability was assessed using a WST-1 assay according to the manufacturer’s recommendations (Roche, Basel, Switzerland). For reference, cell viability was assessed at 0 h and after 24 h of treatment with different concentrations of zapnometinib in medium containing 1% DMSO. The measured cell viability was normalized to the 0-h control. The CC₅₀ value was determined using the “Sigmoidal, 4PL, X is log(concentration)” equation in GraphPad Prism.

For flow cytometry analysis, 6 × 10⁵ Caco-2 cells were seeded per well in six-well plates (Greiner Bio-One, Kremsmünster, Austria) and incubated for 24 h at 37°C, 5% CO₂. Treatment with zapnometinib or a solvent control (1% DMSO) in medium containing 0.2% BSA was applied for 24 h. A single-cell solution was prepared using TrypLE reagent (Thermo Fisher Scientific, Waltham, MA, USA). Prior to staining, cells were treated with an FcR blocking reagent (Miltenyi Biotec, Bergisch Gladbach, Germany) for 10 min at 4°C. The cells were then stained with either a PE Mouse IgG1Isotype control antibody (BioLegend, San Diego, CA, USA) or a PE anti-human TMPRSS2 Antibody (BioLegend, San Diego, CA, USA), followed by a live-dead staining using the LIVE/DEAD™ Fixable Far Red Dead Cell Stain Kit (Thermo Fisher Scientific, Waltham, MA, USA). Cells were analyzed using the BD FACSCanto II flow cytometer (Becton Dickinson, Franklin Lakes, New Jersey, USA) and the FlowJo software (Becton Dickinson, Franklin Lakes, New Jersey, USA).

Caco-2 cells were seeded on glass cover slips in 24-well plates in IMDM medium containing 10% FBS and 1% penicillin/streptomycin and grown for 24 h at 37°C, 5% CO₂. The next day, the cells were washed once with infection medium prior to infection with MOI 4 of SARS-CoV-2 or IAV PR8 for 1 h in infection medium per well. Afterwards, the virus inoculum was removed completely, and the cells were washed once with infection medium and treated with 1 mL per well with either different concentrations of zapnometinib or solvent control (1% DMSO) in infection medium for 10 h at 37°C, 5% CO₂. Wells were washed with PBS and fixed with 4% paraformaldehyde (PFA) (Merck Millipore, Burlington, MA, USA) in PBS for 10 min at room temperature prior to permeabilization by the addition of 1 mL of 0.1% Triton X-100 (Merck Millipore, Burlington, MA, USA) in PBS per well for 5 min. Cells were blocked with 1% BSA in PBS for 1 h at room temperature before incubation with 200 µL of the primary antibody [Anti-SARS-CoV-2 nucleocapsid protein antibody (1:400) (ProSci Inc., Poway, CA, USA, Cat. no. 35-580) or Mouse anti-Influenza A virus Nucleoprotein (NP) antibody (1:500) (Bio-Rad Laboratories, Inc., Hercules, CA, USA, Cat No. MCA 400)] in 1% BSA in PBS overnight. The next day, cells were incubated with the secondary antibody [Alexa Fluor™ 488 goat anti-mouse IgG (1:1,000) (Thermo Fisher Scientific, Waltham, MA, USA)] in 1% BSA in PBS for 45 min at room temperature. Glass cover slips were removed from the wells and mounted on microscope slides using Roti^® mount FluorCare DAPI (Carl Roth GmbH + Co. KG, Karlsruhe, Germany). Slides were let dry at 4°C in the dark. Pictures were taken using a confocal laser scanning microscope with immersion oil and a 40× objective lens (LSM800, Zeiss, Oberkochen, Germany) and the Zen 3.3 software (Zeiss, Oberkochen, Germany).

When the SARS-CoV-2 pandemic started in 2019, it was immediately tested if the replication of the virus was susceptible to treatment with the MEK1/2 inhibitor zapnometinib. Therefore, a virus yield reduction assay was performed on Caco-2 cells in medium containing 5% FBS. We found a concentration-dependent reduction of the virus titer for treatment with zapnometinib ( Figures 2A, B ). Compared to the solvent control, the virus titer was significantly reduced by zapnometinib treatment with 100 µM (reduction >99%), 75 µM (reduction >94%), 50 µM (reduction >60%), and 25 µM (reduction >39%). No significant reduction of the virus titer was achieved with treatment with 12.5 µM and 6.25 µM zapnometinib ( Figure 2B ). To calculate the EC₅₀ value of zapnometinib, the measured virus titer in the different treatment conditions was normalized to the solvent control. The EC₅₀ value of zapnometinib against SARS-CoV-2 was found to be 34.17 µM ( Figure 2C ), which is in line with the result obtained by other laboratories, e.g., 31.33 µM (SARS-CoV-2 B.1 isolate “FI”) by Schreiber and colleagues (Schreiber et al., 2022). In contrast to the previously determined EC₅₀ values for IAV and influenza B virus (IBV) [6.36 µM (IAV RB1), 4.50 µM (IAV Fukui), and 4.19 µM (IBV Lee)] by Laure and colleagues (Laure et al., 2020), the EC₅₀ value determined here for zapnometinib against SARS-CoV-2 is higher. We therefore wanted to investigate if this indicates that influenza virus is more susceptible to treatment with zapnometinib than SARS-CoV-2.

One factor that could be responsible for the different EC₅₀ values is the plasma protein binding of the drug, which is a major issue in drug development. While a medium containing 5% FBS was used for SARS-CoV-2 infectivity assays ( Figure 2 ), the EC₅₀ values of zapnometinib against IAV and IBV were assessed using a medium containing 0.2% BSA instead (Laure et al., 2020). Thus, we aimed to investigate the influence of different FBS concentrations and 0.2% BSA in the absence of virus on the IC₅₀ value of zapnometinib in vitro and thereby explore if the difference in the serum content of the media might have influenced zapnometinib’s efficacy in reducing ERK phosphorylation and thus led to the different EC₅₀ values of zapnometinib seen for IAV and SARS-CoV-2. Furthermore, two different cell lines were tested to determine if the IC₅₀ value may also be dependent on the cell line being used. Here, Calu-3 and Caco-2 cells were chosen, as both cell lines are susceptible to infection with SARS-CoV-2 as well as IAV PR8 and therefore provide a suitable basis for a direct comparison of these viruses. To determine the IC₅₀ values, briefly the cells were stimulated with TNF-α for 30 min followed by treatment with zapnometinib or a solvent control. For both cell lines, we found a concentration-dependent increase of IC₅₀ values for the different FBS concentrations with an IC₅₀ value of 0.06 µM with 0% FBS, 6.64 µM with 5% FBS, and 8.25 µM with 10% FBS in the medium in Calu-3 cells. In Caco-2 cells, the IC₅₀ values were in a similar range, with 0.04 µM with 0% FBS, 4.46 µM with 5% FBS, and 9.15 µM with a content of 10% FBS in the medium. Medium containing 0.2% BSA resulted in an IC₅₀ of 5.33 µM in Calu-3 and 4.32 µM in Caco-2 cells ( Figure 3 ). The present data demonstrate that the FBS concentration in the medium has a strong effect on the IC₅₀ of zapnometinib. Overall, the determined IC₅₀ values were similar for both cell lines in each condition. We therefore conclude that Caco-2 and Calu-3 cells respond to treatment with zapnometinib in a similar manner.

Next, to exclude the potential influence of different media compositions, we tested if infection of Caco-2 and Calu-3 cells with SARS-CoV-2 using cell culture medium containing 0.2% BSA, which is routinely used for IAV infections, would also support successful replication of SARS-CoV-2. We found that SARS-CoV-2 replication was not affected by the medium change, and virus titers of approximately 1 × 10⁹ gc/mL, as observed in medium containing 5% FBS, were achieved after 24 h (see SARS-CoV-2 solvent control, Figures 2 , 4 ). These results allowed the conduct of EC₅₀ experiments with IAV PR8 and SARS-CoV-2 using the same experimental conditions, meaning the same cell lines and medium composition. We performed virus yield reduction assays on Caco-2 and Calu-3 cells using IMDM medium containing 0.2% BSA. Briefly, cells were infected with MOI 0.01 of IAV PR8 or SARS-CoV-2 followed by treatment with different zapnometinib concentrations of up to 100 µM for 24 h. The concentrations used have been shown to cause no cytotoxic effects on Calu-3 and Caco-2 cells ( Supplementary Figure 1 ). After 24 h of treatment, the virus titer was determined in the supernatant ( Figures 4A, D, G, J ). For both viruses, we found a concentration-dependent reduction of the virus titer under zapnometinib treatment compared to the solvent control on both cell lines. The virus titers were normalized to the respective solvent controls ( Figures 4B, E, H, K ), followed by the determination of the respective EC₅₀ values ( Figures 4C, F, I, L ). For IAV PR8, we found a reduction of the virus titer of >90% under treatment with 100 µM and a reduction of the virus titer of ≥50% for treatment with 25 µM and 12.5 µM zapnometinib. For SARS-CoV-2, the reduction of the virus titer was >90% for treatment with 100 µM and 75 µM zapnometinib and ≥50% for treatment with 50 µM and 25 µM zapnometinib. For IAV PR8, the determined EC₅₀ value was 7.13 µM in Calu-3 cells and 5.72 µM on Caco-2 cells ( Figures 4C, F ). The EC₅₀ values determined for SARS-CoV-2 (FI) were 19.70 µM on Calu-3 cells and 22.91 µM on Caco-2 cells ( Figures 4I, L ). EC₅₀ values below 10 µM for IAV PR8, and EC₅₀ values of approximately 20 µM for SARS-CoV-2 in both cell lines, clearly demonstrate that IAV and SARS-CoV-2 differ in their dependency on an active Raf/MEK/ERK signaling pathway.

Furthermore, we investigated if the reduction seen in the virus titer under treatment with zapnometinib is also reflected in the amount of viral protein in the cells. Therefore, we analyzed the SARS-CoV-2 nucleocapsid protein (N) and IAV nucleoprotein (NP) content in the lysates of infected Caco-2 and Calu-3 cells after 24 h of zapnometinib treatment. The detected amount of both proteins was related to ERK2 as reference protein ( Figures 5A, C, E, G ) and normalized to the solvent control ( Figures 5B, D, F, H ). Zapnometinib treatment does not affect ERK2 content in the cells ( Supplementary Figure 4 ). In agreement with the reduction seen for the virus titer, we found a concentration-dependent reduction of the SARS-CoV-2 N and IAV PR8 NP under zapnometinib treatment in both cell lines by >80% with 100 µM and >70% with 50 µM zapnometinib, respectively. A reduction of approximately 50% was reached under treatment with 12.5 µM zapnometinib. A difference in the reduction of the SARS-CoV-2 N and IAV NP was observed at lower concentrations. The IAV PR8 NP was significantly reduced compared to the solvent control under treatment with up to 0.39 µM zapnometinib while the SARS-CoV-2 N was significantly reduced only under treatment with up to 12.5 µM zapnometinib ( Figures 5B, D, F, H ). The fact that the IAV NP is still reduced at lower concentrations of zapnometinib further supports the results from the EC₅₀ experiment that IAV is more susceptible to zapnometinib treatment than SARS-CoV-2.

Next, we determined the IC₅₀ value of zapnometinib in virus-infected cells to investigate the activation level of the Raf/MEK/ERK signaling pathway in infected cells under treatment with zapnometinib. Therefore, Caco-2 and Calu-3 cells were infected for 1 h with MOI 0.01 of IAV PR8 or SARS-CoV-2, respectively, followed by treatment with different concentrations of zapnometinib for 24 h. The ratio of pERK1/2 to ERK1/2 was calculated ( Figures 6A, D, G, J ) and normalized to the solvent control to determine the IC₅₀ value ( Figures 6B, E, H, K ). Compared to the non-infected mock control, we found an activation of the Raf/MEK/ERK pathway in IAV PR8-infected Calu-3 cells with an increase in the pERK/ERK ratio by 0.23 in the solvent control ( Figure 6A and Table 1 ). Normalized to the solvent control, this results in an activation by 52% ( Figure 6B ). In SARS-CoV-2-infected Calu-3 cells, the pERK/ERK ratio increased by 0.28 in the solvent control compared to mock, which translates into an activation by 31% ( Figures 6G, H and Table 1 ). Interestingly, we did not observe an increase in ERK1/2 phosphorylation in the solvent control of infected Caco-2 cells compared to mock. Looking at the level of ERK phosphorylation in the Caco-2 mock control, the MEK activity was already at a level that was reached in Calu-3 cells only after virus infection (ratio pERK/ERK Caco-2 IAV-PR8 mock: 0.55, Calu-3 IAV PR8 solvent ctrl: 0.45, Caco-2 SARS-CoV-2 mock: 0.81, Calu-3 SARS-CoV-2 solvent ctrl: 0.7) ( Figure 6 and Table 1 ). This preactivation of the pathway might explain why there is no further increase in ERK phosphorylation upon infection. Zapnometinib treatment led to a concentration-dependent reduction in ERK1/2 phosphorylation in all set ups. The IC₅₀ value of zapnometinib was 1.01 µM in IAV PR8-infected Calu-3 cells and 2.24 µM in Caco-2 cells. In SARS-CoV-2-infected cells, the IC₅₀ value was 1.99 µM in Calu-3 and 5.65 µM in Caco-2 cells ( Figures 6C, F, I, L, M ). In Figure 6M , the IC₅₀ values are summarized. For both viruses, the IC₅₀ value of zapnometinib was lower in Calu-3 cells compared to Caco-2 cells, indicating that lower amounts of zapnometinib are needed to achieve 50% MEK inhibition in virus-infected Calu-3 cells. Furthermore, the IC₅₀ value in IAV PR8-infected cells was lower compared to SARS-CoV-2-infected cells, demonstrating that 50% MEK inhibition is reached at lower concentrations in IAV PR8-infected cells, which might explain why the EC₅₀ value of zapnometinib against IAV PR8 is lower compared to the EC₅₀ value against SARS-CoV-2. Curve fitting to determine the IC₅₀ values allowed us to interpolate the level of MEK activation at the respective EC₅₀ values determined in Figure 4 . The MEK activity at the EC₅₀ concentration of zapnometinib against IAV PR8 and SARS-CoV-2 was 25% and 10% in Calu-2 cells and 37% and 25% in Caco-2 cells, respectively ( Table 2 ). These results show that higher levels of MEK inhibition are needed to reduce the virus titer by 50% for SARS-CoV-2 compared to IAV in both cell lines.

SARS-CoV-2 and IAV can use TMPRSS2 to facilitate entry. Thus, we investigated if MEK inhibition influences TMPRSS2 expression as a potential common mechanism of action for the antiviral activity against SARS-CoV-2 and IAV PR8. Therefore, Caco-2 cells were analyzed by flow cytometry for their TMPRSS2 expression with either zapnometinib or a solvent control. Surprisingly, the TMPRSS2 expression in Caco-2 cells increased by 14% and 17% under treatment with 50 µM and 100 µM zapnometinib, respectively ( Figure 7 ).

To visualize the different localization of the SARS-CoV-2 N and IAV NP, an immunofluorescence analysis was performed. Caco-2 cells were either infected with IAV PR8 or SARS-CoV-2 for 1 h followed by treatment with 100 µM zapnometinib or a solvent control for 10 h. The cells were fixed and stained for the nucleus and the respective viral protein. In the solvent control of the IAV PR8-infected Caco-2 cells ( Figure 8A ), the NP is distributed throughout the whole cell (nucleus and cytoplasm), while the SARS-CoV-2 NP ( Figure 8B ) is located exclusively in the cytoplasm; the nuclear area is clear. Treatment with zapnometinib led to the retention of the IAV NP in the nucleus, as observed earlier with other MEK inhibitors (Pleschka et al., 2001; Schreiber et al., 2020). In contrast, the distribution of the SARS-CoV-2 N did not change. However, the amount of SARS-CoV-2 N was reduced, and fewer SARS-CoV-2 N-positive cells were detected, compared to IAV PR8 NP-positive cells post-treatment ( Figure 8 ; Supplementary Figure 3 ).