A flowchart is shown in Figure S1 (Behzadi and Gajdacs, 2021). A. johnsonii AYTCM strain was isolated from sputum in China in 2018. Isolate identification was conducted using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS, Bruker Daltonik GmbH, Bremen, Germany) and further confirmed by PCR and 16S rRNA (GenBank ID: NR_164627.1) gene-based sequencing with specific primers 27F (5′-agagtttgatcctggctcag-3′) and 1492R (5′-ggttaccttgttacgactt-3′) (Zong et al., 2020).

Antimicrobial susceptibility testing (AST) was performed by the broth microdilution method and interpreted based on the recommendations of Clinical and Laboratory Standards Institute (CLSI) 2021 guidelines and European Committee on Antimicrobial Susceptibility Testing (EUCAST) 2021 breakpoint tables for tigecycline. The antimicrobial agents used in this study were shown as follows: ceftazidime (CAZ), cefoperazone/sulbactam (CFS), imipenem (IPM), meropenem (MEM), ciprofloxacin (CIP), amikacin (AMI), colistin (COL), tigecycline (TGC), and cefiderocol (CFDC). Escherichia coli ATCC 25922 served as the quality control strain.

To determine whether the plasmids carrying bla _NDM-1, bla _OXA-58, and bla _PER-1 were transferable, conjugation experiments using E. coli J53 (sodium azide resistant) as the recipient strain were carried out using the filter mating method (Yang et al., 2021). Transconjugants were screened on Mueller–Hinton (MH) agar plates containing sodium azide (100 mg/L) and meropenem (2 mg/L). The identity of putative transconjugants was confirmed via PCR and MALDI-TOF MS.

A. johnsonii AYTCM strain was grown overnight at 37°C in 2 mL of Luria broth (LB) without antibiotics, followed by serial passage of 2-µL overnight culture into the 2-mL LB (1:1,000) each day, with a yield 10 generations, lasting for 7 days (Tian et al., 2022). On the last day, samples were collected and streaked onto antibiotic-free MHA plates. Colonies were selected randomly, and the presence of bla _NDM-1, bla _OXA-58, or bla _PER-1 genes was confirmed by PCR with specific primers.

Genomic DNA was extracted from A. johnsonii AYTCM strain using Qiagen Mini Kit (Qiagen, Germany) and Gentra^® Puregene^® Yeast/Bact. Kit (Qiagen, Germany) for Illumina and Nanopore sequencing, respectively. For trimming, quality control, and quality assessment of raw reads, fastp v 0.20.1 was used (Chen et al., 2018). De novo assembly of the reads of Illumina and MinION was constructed using Unicycler v0.4.8 (Wick et al., 2017). The assembly sequence was assessed via QUAST v 5.0.2 (Gurevich et al., 2013). Genome sequence annotation was conducted using the National Center for Biotechnology Information (NCBI) Prokaryotic Genome Annotation Pipeline (PGAP) (http://www.ncbi.nlm.nih.gov/genome/annotation_prok/) and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST) server (Overbeek et al., 2014; Tatusova et al., 2016). Annotation function was further compared with A. johnsonii C6 (accession no. FUUY00000000) and MB44 (accession no. LBMO00000000) strains (Tian et al., 2016; Kaas et al., 2017).

Antimicrobial resistance genes were identified using the ABRicate program (https://github.com/tseemann/abricate) based on the ResFinder database (http://genomicepidemiology.org/) (Zankari et al., 2012). Bacterial virulence factors were identified using the virulence factor database (VFDB, http://www.mgc.ac.cn/VFs/) (Liu et al., 2022a). Average nucleotide identity (ANI) analysis with A. johnsonii C6 (accession no. FUUY00000000) and MB44 (accession no. LBMO00000000) strains was conducted using an ANI calculator (http://enve-omics.ce.gatech.edu/ani/index) (Luis and Konstantinos, 2016), and genome-based phylogenetic reconstruction with A. johnsonii, A. baumannii, A. pittii, and A. seifertii strains was further performed using the BacWGSTdb server (Marquez-Ortiz et al., 2017; Feng et al., 2021). Insertion sequences (ISs) were identified with ISfinder (Siguier et al., 2006). Conjugation transfer elements, including the origin site of DNA transfer (oriT), type IV secretion system (T4SS), type IV coupling protein (T4CP), and relaxase-related encoding genes, were predicted using oriTfinder with default parameter settings (Li et al., 2018). PHAge Search Tool (PHAST) was utilized for the prediction of bacteriophages (Zhou et al., 2011). Typing of plasmids was performed based on a previous description (Lam et al., 2023). The plasmid structure was visualized using DNAPlotter (https://www.sanger.ac.uk/tool/dnaplotter/) (Carver et al., 2009). Plasmid comparisons were conducted using the Circoletto tool (http://tools.bat.infspire.org/circoletto/) (Darzentas, 2010). Similar plasmids in Acinetobacter spp., Providencia rettgeri, and Klebsiella pneumoniae were tracked using the BacWGSTdb server (Marquez-Ortiz et al., 2017; Feng et al., 2021).

Genome was annotated using PGAP and RAST. Based on PGAP annotation, there are 3,980 genes in total, of which 3,731 are protein-coding genes, 136 are pseudo genes, and the remaining 113 are predicted RNA-coding genes. Compared with the PGAP server, 4,182 genes, including 109 RNA-coding genes, belonged to 293 subsystems when annotated using RAST. The statistics of the subsystem is shown ( Figure 1 ). Most of them belonged to metabolism (427), amino acids and derivatives (252), and carbohydrates (130). Additionally, 14 CDS were sorted into “Phages, transposable elements, plasmids” and only 2 and 1 CDS belonged to “cell division and cell cycle” and “dormancy and sporulation,” respectively. Functional comparison showed that most subsystems were metabolism among three A. johnsonii strains. However, a huge difference was found in “Phages, Prophages, Transposable elements, Plasmids”. There are two CDS that belonged to “Phages, Prophages, Transposable elements, Plasmids” in A. johnsonii C6 and MB44 strains. However, 14 subsystems of this function were identified in A. johnsonii AYTCM strain.

Antimicrobial susceptibility testing revealed that A. johnsonii AYTCM strain possessed a multidrug-resistant (MDR) profile and the meropenem and imipenem MICs are all >128 mg/L. Furthermore, it exhibited resistance to ceftazidime (>128 mg/L), ciprofloxacin (>32 mg/L), and cefoperazone/sulbactam (128 mg/L) but still remained susceptible to tigecycline (1 mg/L) and cefiderocol (<0.03 mg/L). The MICs of colistin and amikacin are 2 mg/L and 32 mg/L, respectively, which were defined as intermediate.

Analysis of the genome of A. johnsonii AYTCM strain revealed that, in addition to co-harboring chromosomal bla _OXA-652 and aadA27, a series of other antibiotic resistance genes were identified, including bla _OXA-58, bla _NDM-1 , bla _PER-1, msr(E), mph(E), aac(3)-IId, aph(3′)-VIa, sul1, arr-3, qnrVC6, ble-MBL, aph(3′)-VI, tet(39), sul2, and bla _MCA ( Table 1 ). However, only two virulence factors, two-component regulatory system bfmRS involved in Csu expression and lpxC-encoding lipopolysaccharide (LPS), were found in AYTCM strain.

According to the ANI analysis, the result showed that 95.82% two-way ANI between A. johnsonii AYTCM and A. johnsonii C6 and 95.86% ANI were found between A. johnsonii AYTCM and A. johnsonii MB44 and only 79.89% two-way ANI between A. johnsonii AYTCM and A. baumannii ATCC 17978. Core-genome phylogeny analysis showed a close genetic relationship among A. johnsonii AYTCM, C6, and MB44 strains. However, a huge diversity was observed among A. baumannii, A. pittii, and other A. seifertii strains based on the phylogenetic tree ( Figure S2A ). Similar results of SNP difference are shown in Figure S2B .

Kaptive revealed that AYTCM strain contains OC locus 1c (OCL-1c), matching the 92.01% nucleotide identity. The K locus in A. johnsonii AYTCM strain is KL19, to which it matches with an overall nucleotide identity of 72.75%.

Mating assays were performed to explore the transfer ability of bla _NDM-1, bla _OXA-58, and bla _PER-1 genes; results showed that only bla _NDM-1 could transfer to the recipient strain. The stability assays revealed that all three resistance genes were quite stable even after 70 passages under antibiotics-free conditions.

Hybrid assembly of the short and long reads generated a 3,567,832-bp size circular chromosome with a GC content of 41.60% ( Table 1 ). One intrinsic resistance gene, bla _OXA-652, was identified in the chromosome. Of note, A. johnsonii AYTCM strain carries 11 plasmids, namely, pAYTCM-1 to pAYTCM-11, with sizes between 2,356 bp and 378,197 bp and GC contents ranging from 34.38% to 42.44% ( Table 1 ). Apart from pAYTCM-2, pAYTCM-5, pAYTCM-9, pAYTCM-10, and pAYTCM-11, various kinds of resistance genes were found in other plasmids. Analysis of rep genes showed that only pAYTCM-7 possessed one identified name with Aci1.

pAYTCM-1 is a huge 378,197-bp multidrug-resistant plasmid with an average GC content of 39.93%. It comprises different regions, including type IV secretion system (T4SS) region, class 1 integron region, and mercury resistance region ( Figure 2A ). bla _OXA-58 and bla _PER-1 genes were located in the pAYTCM-1 plasmid. Concerning the genetic context of bla _OXA-58, three intact and one truncated ISAjo2 were located upstream or downstream. 9-bp TSD sequences were observed in the upstream and downstream of ISAjo2 genetic elements. Nevertheless, the TSD sequences were all different ( Figure 2B ). Importantly, a complex class 1 integron complex consisted of a 5′ conserved segment (5′ CS) and 3′ CS, which was found to carry sul1, arr-3, qnrVC6, and bla _PER-1 cassettes ( Figure 2C ). Of note, 10 XerC and XerD-like binding sites (pdif sites) were found in the pAYTCM-1 plasmid ( Table 2 ). In addition, no oriT was identified in the pAYTCM-1 plasmid and no transconjugants were obtained via conjugation. Moreover, results of the Circoletto tool showed that there were many similar segments between pAYTCM-1 and pXBB1-9 (GenBank accession number: CP010351) plasmids ( Figure 3 ). Genetic structure comparison revealed that 98% coverage and 99.91% identity were identified between pAYTCM-1 and pXBB1-9 plasmids, which was found in the A. johnsonii XBB1 isolate from a hospital sewage in 2010 in Chengdu, western China.

The bla _NDM-1 carbapenem gene was located in 41,087 plasmids with the GC content of 38.32%. Genetic context analysis revealed that bla _NDM-1 was ISAba14-aph(3′)-VI-ISAba125-bla _NDM-1-ble-MBL ( Figure 4 ). Moreover, a T4SS region, T4CP, a gene encoding relaxase, and a 38-bp oriT region (AGGGATTCATAAGGGAATTATTCCCTTATGTGGGGCTT) were identified. pAYTCM-3 could transfer to E. coli J53 via conjugation.

Prophage regions were predicted by the PHASTER tool; results showed two intact, two questionable, and two incomplete regions in the chromosome ( Figure 5A ). Based on the PHASTER tool, regions 4 and 5 were predicted to be intact due to the score of >90. In addition, regions 1 and 6 were classified as questionable due to the scores of 70–90. However, regions 2 and 3 were shown as incomplete due to the low scores. Gene functions of the two intact and two questionable prophage regions are shown, including attachment, phage integration, and cell lysis ( Figure 5B ).

To track the closely related plasmids from different countries, a wide search was performed via the BacWGSTdb server. Data showed that pAYTCM-1 was similar to pXBB1-9, pOXA23_010062, pOXA58_010030, and pAcsw19-2 plasmids ( Table 3 ). Their sizes are all >300 kb, and they were collected from the strains of sewage in China. However, the species were various, including A. johnsonii, A. wuhouensis, and A. defluvii.

Concerning the closely related plasmids of pAYTCM-3, results showed that hosts, also carrying the bla _NDM-1-related plasmid, were collected from several different sources, including feces, blood, sputum, pus, sewage, and hospital environment, from 2005 to 2023. These bla _NDM-1-harboring plasmids were all collected in Acinetobacter spp. and not in P. rettgeri and K. pneumoniae. Their hosts were isolated from various countries, such as China, USA, Japan, Brazil, and Mexico.