<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2023.1125079</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A multiplex PCR assay for the differentiation of <italic>Mycobacterium tuberculosis</italic> complex reveals high rates of mixed-lineage tuberculosis infections among patients in Ghana</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Owusu</surname>
<given-names>Wellington</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1773524"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>van Vliet</surname>
<given-names>Arnoud H. M.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/16363"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Riddell</surname>
<given-names>Natalie E.</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/476721"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Stewart</surname>
<given-names>Graham</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/165305"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Akwani</surname>
<given-names>Winifred C.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1300598"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Aryeetey</surname>
<given-names>Sherihane</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2172599"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Arthur</surname>
<given-names>Rejoice Agyeiwaa</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2173872"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Sylverken</surname>
<given-names>Augustina Angelina</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1353565"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Hingley-Wilson</surname>
<given-names>Suzanne M.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/491175"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Microbial Sciences, School of Biosciences, Faculty of Health and Medical Sciences, University of Surrey</institution>, <addr-line>Guildford</addr-line>, <country>United Kingdom</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Faculty of Health and Medical Sciences, University of Surrey</institution>, <addr-line>Guildford</addr-line>, <country>United Kingdom</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Biochemical Sciences, School of Biosciences and Medicine, University of Surrey</institution>, <addr-line>Guildford</addr-line>, <country>United Kingdom</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Kumasi Centre for Collaborative Research in Tropical Medicine, Kwame Nkrumah University of Science and Technology</institution>, <addr-line>Kumasi</addr-line>, <country>Ghana</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Theoretical and Applied Biology, Kwame Nkrumah University of Science and Technology</institution>, <addr-line>Kumasi</addr-line>, <country>Ghana</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Michael McClelland, University of California, Irvine, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Nadine Christine Lemaitre, Centre Hospitalier Universitaire (CHU) d&#x2019;Amiens, France; Yolanda Gonz&#xe1;lez Hern&#xe1;ndez, National Institute for Respiratory Diseases, Mexico</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Suzanne M. Hingley-Wilson, <email xlink:href="mailto:s.hingley-wilson@surrey.ac.uk">s.hingley-wilson@surrey.ac.uk</email>; Augustina Angelina Sylverken, <email xlink:href="mailto:asylverken@knust.edu.gh">asylverken@knust.edu.gh</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Molecular Bacterial Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>03</day>
<month>04</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>13</volume>
<elocation-id>1125079</elocation-id>
<history>
<date date-type="received">
<day>15</day>
<month>12</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>17</day>
<month>03</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Owusu, van Vliet, Riddell, Stewart, Akwani, Aryeetey, Arthur, Sylverken and Hingley-Wilson</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Owusu, van Vliet, Riddell, Stewart, Akwani, Aryeetey, Arthur, Sylverken and Hingley-Wilson</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>In low-resource settings with high tuberculosis (TB) burdens, lack of rapid diagnostic methods for detection and differentiation of <italic>Mycobacterium tuberculosis</italic> complex (MTBC) is a major challenge affecting TB management. This study utilized comparative genomic analyses of MTBC lineages; <italic>M. tuberculosis</italic>, <italic>M. africanum</italic> Lineages 5/6 and <italic>M. bovis</italic> to identify lineage-specific genes. Primers were designed for the development of a Multiplex PCR assay which was successful in differentiating the MTBC lineages. There was no cross-reaction with other respiratory pathogens tested. Validation of the assay using clinical samples was performed with sputum DNA extracts from 341 clinically confirmed active TB patients. It was observed that 24.9% of cases were caused by <italic>M. tuberculosis</italic>, while <italic>M. africanum</italic> L5 &amp; L6 reported 9.0% and 14.4%, respectively. <italic>M. bovis</italic> infection was the least frequently detected lineage with 1.8%. Also, 27.0% and 17.0% of the cases were PCR negative and unspeciated, respectively. However, mixed-lineage TB infections were recorded at a surprising 5.9%. This multiplex PCR assay will allow speciation of MTBC lineages in low-resource regions, providing rapid differentiation of TB infections to select appropriate medication at the earliest possible time point. It will also be useful in epidemiological surveillance studies providing reliable information on the prevalence of TB lineages as well as identifying difficult to treat cases of mixed-lineage tuberculosis infections.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Mycobacterium tuberculosis</italic> complex</kwd>
<kwd>bioinformatic analyses</kwd>
<kwd>multiplex polymerase chain reaction</kwd>
<kwd>mixed-lineage tuberculosis infections</kwd>
<kwd>tuberculosis diagnosis</kwd>
<kwd>Ghana</kwd>
</kwd-group>
<counts>
<fig-count count="5"/>
<table-count count="4"/>
<equation-count count="0"/>
<ref-count count="41"/>
<page-count count="10"/>
<word-count count="4756"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Human tuberculosis (TB) is a communicable disease caused by some members of the Mycobacterium tuberculosis complex (MTBC), mainly; <italic>Mycobacterium tuberculosis</italic> (Mtb)<italic>, Mycobacterium africanum</italic> (Maf) and <italic>Mycobacterium bovis</italic> (Mbo). It is one of the leading causes of death from a single infectious organism, infecting about a quarter of the world&#x2019;s population (<xref ref-type="bibr" rid="B38">WHO, 2020</xref>). It remains a global pandemic, despite the availability of interventional control measures such as the use of a live attenuated vaccine (BCG) and multi-drug therapy. The situation has been further aggravated by the lack of rapid and reliable, point-of-care diagnostic methods for low-resource areas, and the use of various forms of insufficient treatment procedures among poor resource countries (<xref ref-type="bibr" rid="B38">WHO, 2020</xref>).</p>
<p>TB in an individual is often assumed to be caused by a single clonal MTBC lineage, although mixed infections have been previously noted (<xref ref-type="bibr" rid="B20">Hingley-Wilson et&#xa0;al., 2013</xref>). Advances in molecular-based approaches in TB studies also demonstrated multiple lineages causing TB in the same patient (<xref ref-type="bibr" rid="B37">Van Rie et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B21">Huyen et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B41">Zetola et&#xa0;al., 2014</xref>) and the occurrence of mixed-lineage TB infections in high TB endemic regions has been reported (<xref ref-type="bibr" rid="B9">Cohen et&#xa0;al., 2011</xref>). In TB management, mixed-lineage TB infections have been strongly associated with poor treatment outcome (<xref ref-type="bibr" rid="B41">Zetola et&#xa0;al., 2014</xref>).</p>
<p>West-Africa has one of the highest incidences of TB world-wide with a unique set of circulating MTBC species namely: <italic>M. tuberculosis, M. africanum</italic> and <italic>M. bovis</italic>. While <italic>M. tuberculosis</italic> is generally the predominant pathogen for human TB, unusually almost 50% of all TB cases in West Africa are caused by <italic>M. africanum</italic> (<xref ref-type="bibr" rid="B24">Mostowy et&#xa0;al., 2004</xref>). In The Gambia, 39% of TB cases are caused by <italic>M. africanum</italic> (<xref ref-type="bibr" rid="B10">de Jong et&#xa0;al., 2010a</xref>). In Ghana, <italic>M. africanum</italic> rates remain stable at around 20%, with one of the highest rates of infections in the Northern part of Ghana (<xref ref-type="bibr" rid="B11">De Jong et&#xa0;al., 2009</xref>). While the reservoir of infection for <italic>M. tuberculosis</italic> is the latently infected human population, a non-human reservoir of infection for <italic>M. africanum</italic> in Ghana has been postulated, likely to be more concentrated in Northern Ghana (<xref ref-type="bibr" rid="B27">Otchere et&#xa0;al., 2018</xref>).</p>
<p>The gold standard of TB diagnosis is the isolation of MTBC by culture and the use of biochemical tests (<xref ref-type="bibr" rid="B15">Gholoobi et&#xa0;al., 2014</xref>). However, these methods are very laborious and time-consuming which further risk aggravating the condition of patients due to delayed treatment. In addition, with culturing-based techniques in a mixed infection, the fastest growing is often noted as a single infection (<xref ref-type="bibr" rid="B20">Hingley-Wilson et&#xa0;al., 2013</xref>). Species differentiation is often challenged with misidentification. For instance, <italic>M. africanum</italic> Lineage 5 (MafL5) and Lineage 6 (MafL6) exhibit growth characteristics which are intermediates of both <italic>M. tuberculosis</italic> and <italic>M. bovis</italic> (<xref ref-type="bibr" rid="B12">de Jong et&#xa0;al., 2010b</xref>). Since 2010, WHO recommended the use of GeneXpert assay in diagnostic facilities as a first-line TB diagnostic tool (<xref ref-type="bibr" rid="B17">Goig et&#xa0;al., 2019</xref>). It detects MTBC through the identification of insertion sequence (<italic>IS6110)</italic> as well as identifying rifampicin resistant genes. Although an improved modified GeneXpert Ultra version has been produced with high sensitivity and specificity, it is unable to differentiate the individual MTBC lineages to inform selection of appropriate medication.</p>
<p>In low-resource regions, MTBC lineages are often not differentiated prior to treatment due to reasons such as unavailability of high cost, non-portable genome sequencing machines and length of time for culture results. This can lead to inappropriate treatment regimens, for example, <italic>M. bovis</italic> is intrinsically resistant to pyrazinamide, one of the frontline drugs used collectively for standard TB treatment (<xref ref-type="bibr" rid="B26">Oryan et&#xa0;al., 2022</xref>). Indeed, patient exposure to prolonged pyrazinamide treatment can result in hepatotoxicity and polyarthralgia (<xref ref-type="bibr" rid="B31">Papastavros et&#xa0;al., 2002</xref>) and should therefore be avoided if not required. Additionally, antibiotic treatment duration of <italic>M. bovis</italic> infections is recommended for 9 months (rather than the standard 6 months) because of the absence of pyrazinamide efficacy (<xref ref-type="bibr" rid="B23">Lan et&#xa0;al., 2016</xref>). In general, TB treatment durations shorter than recommendation may lead to incomplete sterilization of an infection and increase the risk of the development of antibiotic resistance (<xref ref-type="bibr" rid="B22">Khalif Ali et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B3">Ali et&#xa0;al., 2019</xref>). It is therefore important to investigate and identify lineage-specific TB molecular markers for designing diagnostic assays with high level of sensitivity and specificity to inform selection of appropriate medication to limit morbidity and drug resistance.</p>
<p>Using the comparative genomics workflow previously described by <xref ref-type="bibr" rid="B2">Akwani et&#xa0;al., 2022</xref>, MTBC lineage-specific genes identified were transferred into the development of multiplex PCR assay for TB lineage differentiation. This will enhance precise disease diagnosis, improve epidemiological surveillance studies and help inform selection of appropriate TB drug regimens at early time point especially in low resource settings with high TB incidence.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Selection and processing of genome sequences</title>
<p>Genome sequences of <italic>M. tuberculosis, M. africanum</italic> and <italic>M. bovis</italic> in the form of sequence reads and assembled genomes were obtained from NCBI, Genbank and EMBL-EBI repositories using fastq-dump instructions (<xref ref-type="bibr" rid="B35">SRA-Tools-NCBI, 2021</xref>). In addition, reference sequences were also obtained. An overall total of 7,456 genome sequences comprising <italic>M. tuberculosis</italic> (6802), <italic>M. africanum</italic> (244), <italic>M. bovis</italic> (391) and other animal-adapted MTBCs (19) were assessed (<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>). Genome assembly was performed with Shovil Megahit toolkit version 1.2.9. To evaluate the consistency of the assembled genomes, quality assessment was performed with QUAST version. 4.6.3 (<xref ref-type="bibr" rid="B18">Gurevich et&#xa0;al., 2013</xref>). The inclusion criteria for checks included: largest contig must be greater than 100kb, N50 &gt;25kb, L50 &lt; 50 and the genomic size between 4.0 and 4.8 Mbp. A total of 120 genomes of <italic>M. tuberculosis</italic>, <italic>M. africanum</italic> and <italic>M. bovis</italic> were used for the pangenome analysis leading to the identification of lineage-specific genes as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>An overview of Scheme of work towards identification of lineage-specific genes for PCR primers development (similar to comparative genomic workflow previously described by <xref ref-type="bibr" rid="B2">Akwani et&#xa0;al., 2022</xref>).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-13-1125079-g001.tif"/>
</fig>
</sec>
<sec id="s2_2">
<title>Phylogenetic analysis of MTBC</title>
<p>ParSNP v. 1.2 was used as described previously (<xref ref-type="bibr" rid="B32">Pornsukarom et&#xa0;al., 2018</xref>) using the &#x201c;-a 13 &#x2013; x&#x201d; settings to generate a phylogenetic tree of MTBC lineages. Classification of lineages was achieved based on the phylogenetic tree constructed. The output was visualised with FigTree version 1.4.3.</p>
</sec>
<sec id="s2_3">
<title>Comparative genomic analysis and identification of lineage-specific genes</title>
<p>Genomes were annotated using Prokka v1.14 (<xref ref-type="bibr" rid="B34">Seemann, 2014</xref>), while pangenomes were analyzed using Roary v3.12 (<xref ref-type="bibr" rid="B29">Page et&#xa0;al., 2015</xref>) at default settings and 90% BLAST cut-offusing randomly selected 120 genomes comprising <italic>M. tuberculosis</italic> (30), <italic>M. africanum</italic> L5 (30), <italic>M. africanum</italic> L6 (30) and <italic>M. bovis</italic> (30) <bold>(</bold>
<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Table S1</bold>
</xref>). Scoary analysis (<xref ref-type="bibr" rid="B7">Brynildsrud et&#xa0;al., 2016</xref>) was used to examine the association between accessory (lineage-specific) genes and phenotypic traits. The number of lineage-specific genes was trimmed using statistical results from Bonferroni corrected p-value of &#x2264; 0.05. Also, lineage-specific genes were selected only if present in greater than 90% of the respective lineages and less than 10% in the other lineages. Further screening of the lineage-specific genes was performed by BLAST+ version 2.13.0 against all 7,456 MTBC genomes <italic>via</italic> Abricate v.1.0.9 (<ext-link ext-link-type="uri" xlink:href="https://github.com/tseemann/abricate">https://github.com/tseemann/abricate</ext-link>) with minimum coverage of 70% and minimum identity of 80% for a correct match. Genomic regions were compared to identify uniqueness using Clinker alignment of complete genomes (<xref ref-type="bibr" rid="B16">Gilchrist &amp; Chooi, 2021</xref>).</p>
</sec>
<sec id="s2_4">
<title>Isolation of genomic DNA</title>
<p>The following reagents were obtained through BEI Resources, NIAID, NIH: genomic DNA from <italic>M. africanum</italic> strains NLA009502090, NR-49655 and <italic>M. africanum</italic> strain NLA000017316, NR-49652. Heat-killed <italic>M. tuberculosis</italic> (H37Rv) and <italic>M. bovis</italic> (AF2122/97) were obtained from liquid cultures prepared in the containment level 3 (CL3) lab before being transferred to the CL2 lab for DNA extraction. Genomic DNA of mycobacterial strains was extracted using the cetyltrimethylammonium bromide (CTAB)-chloroform method as described previously (<xref ref-type="bibr" rid="B5">Belisle et&#xa0;al., 2009</xref>). The concentration and purity of DNA was determined by the NanoDrop 2000 at absorbance of 260nm and purity A<sub>260</sub>/A<sub>280</sub> ratio of 1.7 to 2.0.</p>
</sec>
<sec id="s2_5">
<title>Primer design</title>
<p>Candidate genes identified were selected for primer design, using the PrimerQuest Tool developed by Integrated DNA Technologies (<ext-link ext-link-type="uri" xlink:href="https://eu.idtdna.com/Primerquest">https://eu.idtdna.com/Primerquest</ext-link>). The FASTA format of each nucleotide sequence was inputted with PCR 2 primer options. Each primer was assigned a specific product size ranging from 100 to 1000 bp. Details of primers have been shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>MTBC lineage-specific genes and primer sequences.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">MTBC</th>
<th valign="top" align="center">Gene</th>
<th valign="top" align="center">Type of Primer</th>
<th valign="top" align="center">Sequence</th>
<th valign="top" align="center">Length</th>
<th valign="top" align="center">Tm</th>
<th valign="top" align="center">Amplicon (bp)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" rowspan="6" align="left">Mtb</td>
<td valign="top" rowspan="2" align="center">
<italic>Rv1977</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">GTTTCCCGAGATCAGCTCAA</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">418</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">CATCATCATCGTGCGGTACA</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="center">
<italic>Rv2073c</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">CGCTGCTCCGGTAGTAATTT</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">558</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">CGCCCGATGACGAATCC</td>
<td valign="top" align="center">17</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="center">
<italic>Rv2074</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">GCGATGGTCAACACCACTA</td>
<td valign="top" align="center">19</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">133</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">GGTCGAAGGTGAAACCTACC</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">Maf (L5)</td>
<td valign="top" rowspan="2" align="center">
<italic>Rv3347c</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">CGCGGAAGCCTTAGGAAAT</td>
<td valign="top" align="center">19</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">275</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">ACGACCCGTTTATCAGCATC</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">Maf (L6)</td>
<td valign="top" rowspan="2" align="center">
<italic>Rv0186 (BglS)</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">CCGCAACTTCGAGTACCTTT</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">381</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">ATACCGTTGTGGTGCTTGAG</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">MTB Complex</td>
<td valign="top" rowspan="2" align="center">
<italic>Rv3903c</italic> (positive control)</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">CGGATCGAACCACCAGAATC</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">636</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">GGCCGGATTGTCTGTAAAGT</td>
<td valign="top" align="center">20</td>
<td valign="top" align="center">62</td>
</tr>
<tr>
<td valign="top" rowspan="2" align="left">Mbo*</td>
<td valign="top" rowspan="2" align="center">
<italic>pncA</italic>
</td>
<td valign="top" align="center">forward</td>
<td valign="top" align="center">ATGCGGGCGTTGATCATCGTC</td>
<td valign="top" align="center">21</td>
<td valign="top" align="center">62</td>
<td valign="top" rowspan="2" align="center">186</td>
</tr>
<tr>
<td valign="top" align="center">reverse</td>
<td valign="top" align="center">CGGTGTGCCGGAGAAGTCG</td>
<td valign="top" align="center">19</td>
<td valign="top" align="center">62</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>*<italic>M.bovis</italic> primers designed from pyrazinamidase (pncA) by <xref ref-type="bibr" rid="B13">de los Monteros et&#xa0;al., 1998</xref> were employed. The pncA gene carries a mutation within the genome of <italic>M. bovis</italic> but conserved in other MTBCs. There is a point mutation at the 169 nucleotide position which is occupied by guanine instead of cytosine.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_6">
<title>Preparation of PCR assay</title>
<p>For the single PCR assays, a final volume of 25 &#xb5;l was setup. Each setup contained 12.5 &#xb5;l of 2x GoTaq<sup>&#xae;</sup> Hot Start Green Master Mix (400 &#xb5;M polymerase, 400 &#xb5;M of dNTPs, 4 mM MgCl<sub>2</sub> and pH 8.5 buffer), produced by Promega, UK, 1&#xb5;l each of 10&#xb5;M forward and reverse primers, 1 &#xb5;l DNA (&lt; 250 ng), 1 &#xb5;l DMSO and nuclease free water. The non-template control consisted of the master mix, specific primers and nuclease free water, while 1 &#xb5;l of <italic>E.coli</italic> DNA was used as negative control. For the multiplex PCR assays, a 50&#xb5;l reaction volume was achieved with the following constituents: 25 &#xb5;l of 2x GoTaq<sup>&#xae;</sup> Hot Start Green Master Mix, 5 &#xb5;l of 10 &#xb5;M of forward/reverse primers (1 &#xb5;l of each lineage-specific primer), 1&#xb5;l DNA (&lt;250 ng), 2 &#xb5;l DMSO and nuclease free water. An all-in-one multiplex PCR had 4 &#xb5;l of DNA (1&#xb5;l from each lineage). The reaction mix contained an excess of primers and nucleotides to ensure reaction continuity without limitation. The amplification was carried out in the SimpliAmp Thermal cycler at an initial denaturation of 2 mins at 95&#xb0;C; 30 cycles of 30 sec at 95&#xb0;C; 1&#xa0;min at 62&#xb0;C; 1&#xa0;min at 72&#xb0;C and a final extension at 72&#xb0;C for 5&#xa0;min. The separation of PCR products was performed using 2% gel agarose electrophoresis at 80&#xa0;V for 1.30 hrs. A 100 bp DNA ladder was used as indicator. Visualization of gel was performed under ultraviolet light of Microtek MiBio Fluo version1.04.</p>
</sec>
<sec id="s2_7">
<title>Ethical clearance</title>
<p>Ethical approval for the use of human sputum samples was granted by the Committee on Human Research and Publication Ethics (CHRPE) at the School of Medical Science of Kwame Nkrumah University of Science and Technology (KNUST), Ghana: (CHRPE/AP/396/22).</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Stratification and identification of lineage-specific genes of the MTBC</title>
<p>A selection of 120 MTBC genomes (30 <italic>M. tuberculosis</italic>, 30 <italic>M. africanum</italic> L5, 30 <italic>M. africanum</italic> L6 and 30 <italic>M. bovis</italic>) from GenBank and EMBL repositories, were subjected to comparative genomic analysis. The phylogenetic relationship between the MTBCs was established with ParSNP which constructs a phylogenetic tree using core genome SNPs. In <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>, divisions were observed in four large clusters representing <italic>M. tuberculosis</italic>, <italic>M. africanum</italic> L5, <italic>M. africanum</italic> L6 and <italic>M. bovis</italic>. Pangenome analysis was performed on the same set of genomes to obtain the distribution of gene families within the MTBCs. A Roary matrix shows the clustering of 7,610 genes into either core genes (commonly shared by all members) or accessory genes (found in only few members) (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>). It could be seen that almost all the genes are skewed toward the core gene section while only a few were categorised as accessory genes. This type of gene distribution highlights the high level of clonality of the MTBC.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Phylogenetic tree together with pangenome distribution of genes within the MTBC &#x2013; <italic>M. tuberculosis, M. africanum</italic> and <italic>M. bovis</italic>. The phylogenetic tree was constructed <italic>via</italic> identification of core genome SNPs using ParSNP tool. Roary matrix obtained from pangenome analysis shows the distribution of core and accessory genes within the MTBC. The highlighted section of the <italic>M. bovis</italic> genomes shows deletions which are characteristic of <italic>M. bovis</italic> as RD4, RD7, RD8, RD9 and RD12 deletions.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-13-1125079-g002.tif"/>
</fig>
<p>Further analysis was conducted on the pangenome outcome to ascertain the relationship between accessory genes and trait (lineages) using Scoary statistics. The definition of lineage-specific genes was set as being present in more than 90% of specific species and less than 10% in the other lineages. A total of 56 lineage-specific genes were obtained comprising 16 <italic>M. africanum</italic> L5, 10 <italic>M. africanum</italic> L6, 10 <italic>M. tuberculosis</italic> and 20 <italic>M. bovis</italic> specific genes (<xref ref-type="supplementary-material" rid="SM2">
<bold>Supplementary Table S2</bold>
</xref>). A final screening of these lineage-specific genes was performed by BLAST against 7,456 MTBC genomes <italic>via</italic> Abricate with a minimum coverage of 70% and minimum identity of 80% for a correct match as shown in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>. The candidate genes specific for <italic>M. tuberculosis</italic> were <italic>Rv1977, Rv2073c and Rv2074.</italic> The <italic>Rv0186</italic>-betaglucosidase was unique for <italic>M. africanum</italic> L6 while <italic>Rv3903c</italic> was conserved in all the MTBCs, thus serving as positive control marker. The Rv<italic>3347c</italic> was unique for <italic>M. africanum</italic> L5 <italic>via</italic> Clinker alignment of gene clusters shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>. Although BLAST hits did not show any unique gene for <italic>M. bovis</italic>, the <italic>pncA</italic> gene highlighted to be distinctive in <italic>M. bovis</italic> by <xref ref-type="bibr" rid="B13">de los Monteros et&#xa0;al., 1998</xref> was used.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Summary of Abricate BLAST results showing MTBC lineage-specific genes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene ID</th>
<th valign="top" align="left">MafL5</th>
<th valign="top" align="left">MafL6</th>
<th valign="top" align="left">Mbo</th>
<th valign="top" align="left">Mtb</th>
<th valign="top" align="left">*Others</th>
<th valign="top" align="left">Name of gene in official H37Rv</th>
<th valign="top" align="left">Remarks</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">MAFGCA_01990</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">98.6</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">
<italic>Bgls (Rv0186)</italic>
</td>
<td valign="top" align="left">L6 specific</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_02010</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">98.9</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left"/>
<td valign="top" align="left">not L6</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_13290</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">99.6</td>
<td valign="top" align="left">75.0</td>
<td valign="top" align="left"/>
<td valign="top" align="left">not Mbo</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_13300</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">75.0</td>
<td valign="top" align="left"/>
<td valign="top" align="left">not Mbo</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_15940</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">99.6</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left"/>
<td valign="top" align="left">not L5/Mbo</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_20850</td>
<td valign="top" align="left">0.7</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">8.3</td>
<td valign="top" align="left">
<italic>Rv1977</italic>
</td>
<td valign="top" align="left">Mtb-specific</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_21880</td>
<td valign="top" align="left">0.7</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">8.3</td>
<td valign="top" align="left">
<italic>Rv2073c</italic>
</td>
<td valign="top" align="left">Mtb-specific</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_21890</td>
<td valign="top" align="left">0.7</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">0.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">8.3</td>
<td valign="top" align="left">
<italic>Rv2074</italic>
</td>
<td valign="top" align="left">Mtb-specific</td>
</tr>
<tr>
<td valign="top" align="left">MTBH37Rv_41080</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">100.0</td>
<td valign="top" align="left">99.1</td>
<td valign="top" align="left">99.6</td>
<td valign="top" align="left">91.7</td>
<td valign="top" align="left">
<italic>Rv3903c</italic>
</td>
<td valign="top" align="left">positive control gene</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>*Others = genomes of animal-adapted ecotypes of the MTBC (M. microti, M. pennipedii, M. orygis, M. caprae, M. mungi).</p>
</fn>
</table-wrap-foot>
</table-wrap>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Clinker showing variations of lineage-specific genes <italic>via</italic> alignment of gene clusters. Variable regions of the identified unique genes were examined through the alignment of gene clusters from members of the MTBC (<italic>M. tuberculosis, M. africanum</italic> L5/L6<italic>, M. bovis</italic>).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-13-1125079-g003.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>Comparison of genomic regions by clinker</title>
<p>The uniqueness of lineage-specific genes was visualized by comparing gene clusters <italic>via</italic> Clinker software as shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>. Variable regions of genes were observed to aid primers design.</p>
</sec>
<sec id="s3_3">
<title>Single PCR assays showing MTBC lineage-specificity</title>
<p>The primerQuest tool was used to design and assign all primers to different PCR product sizes for the purpose of differentiating the MTBCs in a multiplex PCR assay. Primers were screened and selected on the bases of sensitivity, specificity and compatibility. The <italic>M. tuberculosis</italic> specific primers designed from <italic>Rv1977, Rv2073c</italic> and <italic>Rv2074</italic> produced single amplification products of 418 bp, 558 bp and 133 bp specifically in reactions with <italic>M. tuberculosis</italic> DNA and not with other members of the MTBC (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A&#x2013;C</bold>
</xref>). Primers to the <italic>Rv3347c</italic> gene unique to <italic>M. africanum</italic> L5 produced a product band size of 275 bp specifically in reaction with <italic>M. africanum</italic> L5 DNA (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4D</bold>
</xref>), while <italic>M. africanum</italic> L6- <italic>BgIS</italic> primers amplified a fragment of 381 bp specifically from <italic>M. africanum</italic> L6 DNA (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). For <italic>M. bovis pncA</italic> primers designed by <xref ref-type="bibr" rid="B13">de los Monteros et&#xa0;al., 1998</xref> were used and produced an <italic>M. bovis</italic>-specific amplicon of 186 bp (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4F</bold>
</xref>). The positive control primers (<italic>Rv3903c)</italic> were also assigned to 636 bp (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4G</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>PCR results of MTBC specific lineages after optimization of various product sizes; Lane 1= DNA ladder, 2= <italic>M. africanum</italic> L5, 3= <italic>M. africanum</italic> L6 (isolate a), 4=BCG, 5= <italic>E</italic>. <italic>coli</italic>, 6= <italic>M. africanum</italic> L6 (isolate b), 7= water, 8= <italic>M. tuberculosis</italic> and 9= <italic>M. bovis</italic>. Each of the primers was tested against genomic DNA of all MTBCs for specificity. DNA of <italic>E</italic>. <italic>coli</italic> and nuclease-free water were used as negative and non-template controls respectively. Optimum separation of PCR products was achieved with 2% agarose gel at 80V, 1hr:30mins. Primers designed from genes; <bold>(A)</bold> <italic>Rv1977</italic>, <bold>(B)</bold> <italic>Rv2073c</italic>, and <bold>(C)</bold> <italic>Rv2074</italic> amplifying at 418 bp, 558 bp and 133 bp respectively were specific for Mtb. The <italic>M. africanum</italic> L5 and <italic>M. africanum</italic> L6 primers were set at 275 bp and 381bp respectively as shown in <bold>(D, E)</bold>. Primers developed from <italic>pncA</italic> gene by <xref ref-type="bibr" rid="B13">de los Monteros et&#xa0;al., 1998</xref> were used for <italic>M. bovis</italic> identification <bold>(F)</bold> at 186 bp. The <bold>(G)</bold> <italic>Rv3903c</italic> primers at 636 bp served as positive control since it was conserved in all MTBCs.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-13-1125079-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>Multiplex PCR assay differentiating MTBC</title>
<p>Two forms of multiplex PCR assays were performed in a 50 &#xb5;l reaction for each: Multiplex primers tested on each DNA sample (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5A</bold>
</xref>) and an &#x201c;All in one&#x201d; reaction i.e., combination of all primers with mixture of all DNA samples (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5B</bold>
</xref>). All expected amplification products were observed without any extra products formations.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Results of Multiplex PCR assays which show identification of the MTBC lineages investigated. Lane 1= DNA ladder, 2= <italic>M. africanum</italic> L5, 3= <italic>M. africanum</italic> L6 (isolate a), 4= <italic>E</italic>. <italic>coli</italic>, 5= <italic>M. tuberculosis</italic>, 6= water, 7= <italic>M. bovis</italic>, M=mixture of all samples. In <bold>(A)</bold> multiplex of all primers tested on each DNA sample, two bands were observed in each of the MTBC as expected. The band at 636 bp (positive control) is conserved in all the MTBCs, whereas the other band depicts the respective lineage-specific band. Bands at 275 bp and 381 bp denote <italic>M. africanum</italic> L5 and L6 specificity respectively, while Mtb was represented at 133 bp. <italic>M. bovis</italic> was identified at 186 bp. In <bold>(B)</bold> All in one reaction; the compatibility and specificity of the assay was ascertained by combining all primers with mixtures of <italic>M. tuberculosis, M. africanum</italic> L5 &amp; L6, and <italic>M. bovis.</italic> The outcome depicts a successful differentiation of the MTBCs without any inhibition.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-13-1125079-g005.tif"/>
</fig>
</sec>
<sec id="s3_5">
<title>Limits of detection (LOD) of PCR assays</title>
<p>PCR experiments were performed using the identified lineage-specific primers against their respective DNA samples to identify the least amount of DNA required for amplification. <italic>M. africanum</italic> L5, <italic>M. africanum</italic> L6 and <italic>M. bovis</italic> recorded LOD of 0.003 ng/&#xb5;l which equates to 620 genome copy numbers, while <italic>M. tuberculosis</italic> was detected at 0.012 ng/&#xb5;l or 2479 copy numbers as shown in <xref ref-type="table" rid="T3">
<bold>Table&#xa0;3</bold>
</xref>.</p>
<table-wrap id="T3" position="float">
<label>Table&#xa0;3</label>
<caption>
<p>Results showing LOD of PCR assays.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="center">MTBC</th>
<th valign="top" align="center">LOD (ng/&#xb5;l)</th>
<th valign="top" align="center">LOD (DNA copies/&#xb5;l)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="center">MafL5</td>
<td valign="top" align="center">0.003</td>
<td valign="top" align="center">620</td>
</tr>
<tr>
<td valign="top" align="center">MafL6</td>
<td valign="top" align="center">0.003</td>
<td valign="top" align="center">620</td>
</tr>
<tr>
<td valign="top" align="center">Mtb</td>
<td valign="top" align="center">0.012</td>
<td valign="top" align="center">2479</td>
</tr>
<tr>
<td valign="top" align="center">Mbo</td>
<td valign="top" align="center">0.003</td>
<td valign="top" align="center">620</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>A 10-fold serial dilution of DNA samples was used for the PCR to observe the least concentration at which amplification could still be achieved. DNA copy numbers were estimated using formula: (weight in ng x 6.0221x 10<sup>23</sup>molecules/moles)/[(genome length x 660g/mole) x 1 x 10<sup>9</sup>ng/g].</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s3_6">
<title>Specificity of MTBC primers against other pathogens</title>
<p>In view of misdiagnoses of tuberculosis with other respiratory pathogens such as a range of non-tuberculous mycobacteria (NTM) (<xref ref-type="bibr" rid="B40">Y&#x131;lmaz et&#xa0;al., 2017</xref>), cross-reactivity experiments involving testing primers against other microorganisms was conducted. NTMs obtained from Reference Centre for Mycobacteria, Borstel-Germany were used for the cross-reactivity study. The MTBC primers did not show any cross reactivity since negative PCR test results were obtained against all non-MTBC DNAs (<xref ref-type="supplementary-material" rid="SM4">
<bold>Supplementary Table S4</bold>
</xref>). Furthermore, PCR test results of other respiratory pathogens comprising a cocktail of bacteria and viruses (22 targets) also recorded negative (<xref ref-type="supplementary-material" rid="SM5">
<bold>Supplementary Table S5</bold>
</xref>). Details of various bacterial and viral analytes are shown in <xref ref-type="supplementary-material" rid="SM3">
<bold>Supplementary Table S3</bold>
</xref>.</p>
</sec>
<sec id="s3_7">
<title>Validation of multiplex PCR assay using clinical samples</title>
<p>A total of 341 retrospective sputum samples from TB patients in Ghana were used for the validation of PCR assays. These samples have been confirmed TB positive using sputum smear microscopy, GeneXpert MTB/RIF assay and culture (BD BACTEC Mycobacterium Growth Indicator Tube- MGIT) methods based on previous studies conducted on TB drug resistance surveillance in Ghana (<xref ref-type="bibr" rid="B36">Sylverken et&#xa0;al., 2021</xref>). Sputum samples were decontaminated by treating with 4% N-Acetyl-L-Cysteine-Sodium-Hydroxide (NALC-NaOH) before neutralizing with 1X phosphate-buffered saline (PBS). DNA extraction was performed using the GenoLYSE extraction kit and followed by the multiplex PCR assay procedure described earlier. The results showed that <italic>M. tuberculosis</italic> contributes to a quarter (24.9%) of the cases, <italic>M. africanum</italic> L5 and <italic>M. africanum</italic> L6 were identified with 9.1% and 14.4% respectively, while <italic>M. bovis</italic> recorded only 1.8% of the cases. Interestingly, there was an observation of mixed-lineage TB infections at 5.9%. Also, 27.0% and 17.0% of the cases were PCR negative and unspeciated respectively, which may have been due to the extremely low concentration of DNA in some samples.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>The ability to differentiate between the lineages of the MBTC is very important in TB management because it provides reliable information for epidemiological surveillance and treatment choice. In this study, MTBC have been phylogenetically classified leading to the identification of lineage-specific genes. These lineage-specific genes have been explored for the development of a multiplex PCR assay which distinguishes between members of the MTBC.</p>
<p>In low resource regions, Ziehl-Neelsen acid-fast staining microscopy is the most common technique used to diagnose TB (<xref ref-type="bibr" rid="B14">Denkinger et&#xa0;al., 2013</xref>). It requires about 5,000 &#x2013; 10,000 bacilli per ml of sputum for successful detection (<xref ref-type="bibr" rid="B4">Ausina Ruiz et&#xa0;al., 2013</xref>). Thus, its limitations are low sensitivity as well as the inability to differentiate between different mycobacterial species. Although culture, biochemical tests and sequencing are considered gold standard for identification and differentiation (<xref ref-type="bibr" rid="B15">Gholoobi et&#xa0;al., 2014</xref>), these are expensive, laborious and time-consuming. Additionally, obtaining results from these methods are sometimes unreliable due to difficulty in identification of some lineages (<italic>M. africanum</italic> lineages exhibit growth characteristics which are intermediates of <italic>M. tuberculosis</italic> and <italic>M. bovis</italic>) (<xref ref-type="bibr" rid="B10">de Jong et&#xa0;al., 2010a</xref>). The advent of genome sequencing techniques has provided relevant data for performing extensive genomic analyses. As a result, several molecular-based assays have been designed to detect MTBCs. These methods are highly sensitive and specific because unique gene sequences are targeted for amplification. Researchers have discovered gene markers such as IS<italic>6110, hsp65, dnaJ, psbA, lepA</italic> and <italic>MPT64</italic> to detect MTBCs against other respiratory pathogens such NTMs (<xref ref-type="bibr" rid="B8">Chin et&#xa0;al., 2018</xref>). A recent multiplex PCR assay (<xref ref-type="bibr" rid="B2">Akwani et&#xa0;al., 2022</xref>) demonstrated successful separation of <italic>Mycobacterium abscessus</italic> complex subspecies from other NTMs as well as <italic>M. tuberculosis</italic>, although evaluation of assay performance in clinical samples needs to be carried out. Since 2010, WHO has recommended the use of GeneXpert MTB/RIF assay as the first-line diagnostic tool which detects MTBC together with rifampicin resistance (<xref ref-type="bibr" rid="B17">Goig et&#xa0;al., 2019</xref>). This is a molecular approach based on detection of the repetitive elements <italic>IS6110</italic> and IS<italic>1081</italic> and rifampicin resistance region. However, misdiagnoses of TB using the GeneXpert assay have been observed in NTM species at a high bacterial load (<xref ref-type="bibr" rid="B30">Pang et&#xa0;al., 2017</xref>). In TB endemic areas with infections caused by a diversity of MTBC species, a suitable differential diagnostic approach will be required since GeneXpert lacks the ability to distinguish between MTBC lineages.</p>
<p>In West Africa, MTBC classification has been achieved using spoligotyping technique which involves the amplification of direct repeat copies, followed by hybridization into intergenic spacers experiments (<xref ref-type="bibr" rid="B11">De Jong et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B12">de Jong et&#xa0;al., 2010b</xref>; <xref ref-type="bibr" rid="B25">Ofori-Anyinam et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B27">Otchere et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B28">Otchere et&#xa0;al., 2019</xref>). This is a two-step approach which is expensive, laborious and time-consuming. In Ghana, a single multiplex PCR experiment was conducted on the MTBC differentiation using primers from spacer regions 33 and 34 of the DR copies of MTBC, <italic>IS6110</italic> and the <italic>hsp65</italic> (<xref ref-type="bibr" rid="B39">Yeboah-Manu et&#xa0;al., 2001</xref>). Although this assay is not successful in separation of <italic>M. tuberculosis</italic> from <italic>M. africanum</italic> L6, the assay could still be used to complement biochemical testing.</p>
<p>However, the present study introduces a successful differentiation of MTBCs <italic>via</italic> a single multiplex PCR method which is rapid, cost effective and has a short turnaround time. The different PCR product sizes can be easily used to distinguish between lineages without the need for sequencing. One advantage of this PCR assay is the ease of adapting it to the available hardware as it will work on any PCR platform. This new assay provides a reliable solution to misdiagnoses with other NTM infections reported in some endemic regions (<xref ref-type="bibr" rid="B6">Brown-Elliott et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B40">Y&#x131;lmaz et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B19">He et&#xa0;al., 2022</xref>). Indeed, our assay did not cross-react with a range of NTMs, respiratory bacterial and viral pathogens (<xref ref-type="supplementary-material" rid="SM4">
<bold>Supplementary Tables S4</bold>
</xref>, <xref ref-type="supplementary-material" rid="SM5">
<bold>S5</bold>
</xref>). We tested our assay using clinical samples (<xref ref-type="table" rid="T4">
<bold>Table&#xa0;4</bold>
</xref>; <xref ref-type="supplementary-material" rid="SF1">
<bold>Supplementary Figure S1</bold>
</xref>) to demonstrate its utility at revealing the diversity of MTBC lineages in Ghana. The highest number of cases (24.9%) was caused by <italic>M. tuberculosis</italic>, followed by <italic>M. africanum</italic> L5 &amp; L6 (23.5%). <italic>M. bovis</italic> recorded 1.8% which is comparable to 1.5% observed by <xref ref-type="bibr" rid="B28">Otchere et&#xa0;al., 2019</xref>. Negative PCR results (27.0%) and unspeciated lineages (17.0%) may require further confirmation <italic>via</italic> genome sequencing, although samples have been previously detected as MTBCs by liquid cultures, followed by confirmations using purity tests (on blood agar) and rapid test kit (TB cID) (<xref ref-type="bibr" rid="B36">Sylverken et&#xa0;al., 2021</xref>). However, since these are retrospective samples stored over time, sample integrity may have been compromised through repeated freeze/thaw cycles which were beyond our control. Following the reports of mixed MTBC infections among high TB burden settings (<xref ref-type="bibr" rid="B37">Van Rie et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B21">Huyen et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B41">Zetola et&#xa0;al., 2014</xref>), this study detected 20 (5.9%) cases of mixed-lineage TB infections. Poor treatment outcomes have been strongly associated with mixed-lineage TB infections (<xref ref-type="bibr" rid="B41">Zetola et&#xa0;al., 2014</xref>). Therefore, the effect of mixed-lineage TB infections in TB management cannot be overlooked as treatment failures are often observed in various regions of Ghana (<xref ref-type="bibr" rid="B1">Agyare et&#xa0;al., 2021</xref>).</p>
<table-wrap id="T4" position="float">
<label>Table&#xa0;4</label>
<caption>
<p>Results of multiplex PCR validation using samples from 341 active TB patients in Ghana.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Target</th>
<th valign="top" align="center">Number</th>
<th valign="top" align="center">Percentage (%)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>M. tuberculosis</italic>
</td>
<td valign="top" align="center">85</td>
<td valign="top" align="center">24.9</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. bovis</italic>
</td>
<td valign="top" align="center">6</td>
<td valign="top" align="center">1.8</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. africanum</italic> L5</td>
<td valign="top" align="center">31</td>
<td valign="top" align="center">9.1</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. africanum</italic> L6</td>
<td valign="top" align="center">49</td>
<td valign="top" align="center">14.4</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. africanum</italic> L5<italic>/M. tuberculosis</italic>
</td>
<td valign="top" align="center">6</td>
<td valign="top" align="center">1.8</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. africanum</italic> L5<italic>/M. africanum</italic> L6</td>
<td valign="top" align="center">5</td>
<td valign="top" align="center">1.5</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. africanum</italic> L6<italic>/M. tuberculosis</italic>
</td>
<td valign="top" align="center">5</td>
<td valign="top" align="center">1.5</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. bovis/M. africanum</italic> L6</td>
<td valign="top" align="center">2</td>
<td valign="top" align="center">0.6</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>M. bovis/M. tuberculosis</italic>
</td>
<td valign="top" align="center">2</td>
<td valign="top" align="center">0.6</td>
</tr>
<tr>
<td valign="top" align="left">Unspeciated species<break/>(only positive for control marker)</td>
<td valign="top" align="center">58</td>
<td valign="top" align="center">17.0</td>
</tr>
<tr>
<td valign="top" align="left">MTBC negative</td>
<td valign="top" align="center">92</td>
<td valign="top" align="center">27.0</td>
</tr>
<tr>
<td valign="top" align="left">TOTAL</td>
<td valign="top" align="center">341</td>
<td valign="top" align="center">100</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>In summary, this assay is not an alternate replacement for GeneXpert which is currently the first-line TB diagnostic tool recommended by WHO. However, it will be beneficial to low-resource regions where TB is caused by diverse members of the MTBC providing rapid diagnosis to inform appropriate TB drug selection, reduce treatment relapse and the development of antimicrobial resistance. It will also be useful in epidemiological surveillance studies providing reliable information on TB lineage prevalence as well as identifying cases of mixed-lineage tuberculosis infections.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="author-contributions">
<title>Author contributions</title>
<p>The concept and study design were established by SH-W, AS, NR, and GS. Bioinformatic analyses was performed by AvV. Assay optimization by WO, WA, and SH-W. Assay validation using clinical samples was performed in Ghana by RA, SA, and AS. Manuscript writing and editing were done by WO, AS, AvV, GS, and SH-W. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s7" sec-type="funding-information">
<title>Funding</title>
<p>This research was financially supported by the Vice Chancellor&#x2019;s Studentship Award from the University of Surrey and the Global Challenges Research Fund.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>We would like to say thank you to Reference Centre for Mycobacteria, Borstel-Germany for providing NTM strains used in the cross-reactivity experiment as well as the management of TB DRS Ghana project for supporting with clinical sputum samples. Thank you to BEI resources for providing the <italic>M. africanum</italic> DNA samples used in this study.</p>
</ack>
<sec id="s8" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s9" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2023.1125079/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2023.1125079/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.pdf" id="SF1" mimetype="application/pdf"/>
<supplementary-material xlink:href="Table_1.xlsx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.spreadsheetml.sheet"/>
<supplementary-material xlink:href="Table_2.docx" id="SM2" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_3.docx" id="SM3" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_4.docx" id="SM4" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
<supplementary-material xlink:href="Table_5.docx" id="SM5" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agyare</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Osei</surname> <given-names>F. A.</given-names>
</name>
<name>
<surname>Odoom</surname> <given-names>S. F.</given-names>
</name>
<name>
<surname>Mensah</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Amanor</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Martyn-Dickens</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Treatment outcomes and associated factors in tuberculosis patients at atwima nwabiagya district, Ashanti region, Ghana: A ten-year retrospective study</article-title>. <source>Tuberc. Res. Treat.</source> <volume>2021</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1155/2021/9952806</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akwani</surname> <given-names>W. C.</given-names>
</name>
<name>
<surname>van Vliet</surname> <given-names>A. H. M.</given-names>
</name>
<name>
<surname>Joel</surname> <given-names>J. O.</given-names>
</name>
<name>
<surname>Andres</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Diricks</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Maurer</surname> <given-names>F. P.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>The use of comparative genomic analysis for the development of subspecies-specific PCR assays for mycobacterium abscessus</article-title>. <source>Front. Cell. Infect. Microbiol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/FCIMB.2022.816615/BIBTEX</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ali</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Alrasheedy</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Kibuule</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Godman</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Hassali</surname> <given-names>M. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Assessment of multidrug-resistant tuberculosis (MDR-TB) treatment outcomes in sudan; findings and implications</article-title>. <source>Expert Rev. Anti Infect. Ther.</source> <volume>17</volume>, <fpage>927</fpage>&#x2013;<lpage>937</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/14787210.2019.1689818</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ausina Ruiz</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Fern&#xe1;ndez-Rivas</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Vilaplana Messeguer</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Selected culture and drug-susceptibility testing methods for drug-resistant mycobacterium tuberculosis screening in resource-constrained settings</article-title>. <source>Expert Rev. Mol. Diagn.</source> <volume>13</volume>, <fpage>247</fpage>&#x2013;<lpage>249</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1586/erm.13.10</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Belisle</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Mahaffey</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>P. J.</given-names>
</name>
</person-group> (<year>2009</year>). &#x201c;<article-title>Isolation of mycobacterium species genomic DNA</article-title>,&#x201d; in <source>Mycobacteria protocols</source>, <edition>2nd ed</edition>. Eds. <person-group person-group-type="editor">
<name>
<surname>Parish</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Brown</surname> <given-names>A. C.</given-names>
</name>
</person-group> (<publisher-loc>Totowa, NJ</publisher-loc>: <publisher-name>Humana Press</publisher-name>), <fpage>1</fpage>&#x2013;<lpage>12</lpage>.</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brown-Elliott</surname> <given-names>B. A.</given-names>
</name>
<name>
<surname>Nash</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Wallace</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Antimicrobial susceptibility testing, drug resistance mechanisms, and therapy of infections with nontuberculous mycobacteria</article-title>. <source>Clin. Microbiol. Rev.</source> <volume>25</volume>, <fpage>545</fpage>&#x2013;<lpage>582</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/CMR.05030-11</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brynildsrud</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Bohlin</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Scheffer</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Eldholm</surname> <given-names>V.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Rapid scoring of genes in microbial pan-genome-wide association studies with scoary</article-title>. <source>Genome Biol.</source> <volume>17</volume>, <fpage>1</fpage>&#x2013;<lpage>9</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/S13059-016-1108-8/FIGURES/4</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chin</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Sarmiento</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Norazmi</surname> <given-names>M. N.</given-names>
</name>
<name>
<surname>Acosta</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>DNA Markers for tuberculosis diagnosis</article-title>. <source>Tuberculosis</source> <volume>113</volume>, <fpage>139</fpage>&#x2013;<lpage>152</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.tube.2018.09.008</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cohen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Wallengren</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Samuel</surname> <given-names>E. Y.</given-names>
</name>
<name>
<surname>Murray</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Mixed-strain mycobacterium tuberculosis infections among patients dying in a hospital in KwaZulu-natal, south Africa</article-title>. <source>J. Clin. Microbiol.</source> <volume>49</volume>, <fpage>385</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.01378-10</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Jong</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Adetifa</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Walther</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>P. C.</given-names>
</name>
<name>
<surname>Antonio</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ota</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2010</year>a). <article-title>Differences between tuberculosis cases infected with <italic>Mycobacterium africanum</italic> , West African type 2, relative to Euro-American <italic>Mycobacterium tuberculosis</italic>: An update</article-title>. <source>FEMS Immunol. Med. Microbiol.</source> <volume>58</volume>, <fpage>102</fpage>&#x2013;<lpage>105</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-695X.2009.00628.x</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>De Jong</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Antonio</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Awine</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ogungbemi</surname> <given-names>K.</given-names>
</name>
<name>
<surname>De Jong</surname> <given-names>Y. P.</given-names>
</name>
<name>
<surname>Gagneux</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>Use of spoligotyping and large sequence polymorphisms to study the population structure of the mycobacterium tuberculosis complex in a cohort study of consecutive smear-positive tuberculosis cases in the Gambia</article-title>. <source>J. Clin. Microbiol.</source> <volume>47</volume>, <fpage>994</fpage>&#x2013;<lpage>1001</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.01216-08</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Jong</surname> <given-names>B. C.</given-names>
</name>
<name>
<surname>Antonio</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Gagneux</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2010</year>b). <article-title>Mycobacterium africanum-review of an important cause of human tuberculosis in West Africa</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>4</volume>, <elocation-id>e744</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0000744</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de los Monteros</surname> <given-names>L. E. E.</given-names>
</name>
<name>
<surname>Gala&#x301;n</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Gutie&#x301;rrez</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Samper</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Garci&#x301;a Mari&#x301;n</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Marti&#x301;n</surname> <given-names>C</given-names>
</name>
<etal/>
</person-group>. (<year>1998</year>). <article-title>Allele-specific PCR method based on pncA and oxyR sequences for distinguishing mycobacterium bovis from mycobacterium tuberculosis: Intraspecific m. bovis pncA sequence polymorphism</article-title>. <source>J. Clin. Microbiol.</source> <volume>36</volume>, <fpage>239</fpage>&#x2013;<lpage>242</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.36.1.239-242.1998</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Denkinger</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Kik</surname> <given-names>S. V.</given-names>
</name>
<name>
<surname>Pai</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Robust, reliable and resilient: designing molecular tuberculosis tests for microscopy centers in developing countries</article-title>. <source>Expert Rev. Mol. Diagn.</source> <volume>13</volume>, <fpage>763</fpage>&#x2013;<lpage>767</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1586/14737159.2013.850034</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gholoobi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Masoudi-Kazemabad</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Meshkat</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Comparison of culture and PCR methods for diagnosis of mycobacterium tuberculosis in different clinical specimens</article-title>. <source>Jundishapur. J. Microbiol.</source> <volume>7</volume>, <elocation-id>8939</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.5812/jjm.8939</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gilchrist</surname> <given-names>C. L. M.</given-names>
</name>
<name>
<surname>Chooi</surname> <given-names>Y. H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Clinker &amp; clustermap.js: Automatic generation of gene cluster comparison figures</article-title>. <source>Bioinformatics</source> <volume>37</volume>, <fpage>2473</fpage>&#x2013;<lpage>2475</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/BIOINFORMATICS/BTAB007</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Goig</surname> <given-names>G. A.</given-names>
</name>
<name>
<surname>Torres-Puente</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mariner-Llicer</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Villamayor</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Chiner-Oms</surname> <given-names>&#xc1;.</given-names>
</name>
<name>
<surname>Gil-Brusola</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Towards next-generation diagnostics for tuberculosis: identification of novel molecular targets by large-scale comparative genomics</article-title>. <source>Bioinformatics</source> <volume>36</volume>, <fpage>985</fpage>&#x2013;<lpage>989</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/bioinformatics/btz729</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gurevich</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Saveliev</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Vyahhi</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Tesler</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>QUAST: quality assessment tool for genome assemblies</article-title>. <source>Bioinformatics</source> <volume>29</volume>, <fpage>1072</fpage>&#x2013;<lpage>1075</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/BIOINFORMATICS/BTT086</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>He</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Y. A.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>M. S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Prevalence of culture-confirmed tuberculosis among patients with nontuberculous mycobacterial disease</article-title>. <source>Infect. Drug Resist.</source> <volume>15</volume>, <fpage>3097</fpage>&#x2013;<lpage>3101</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2147/IDR.S363765</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hingley-Wilson</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Casey</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Connell</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Bremang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Evans</surname> <given-names>J. T.</given-names>
</name>
<name>
<surname>Hawkey</surname> <given-names>P. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Undetected multidrug-resistant tuberculosis amplified by first-line therapy in mixed infection</article-title>. <source>Emerg. Infect. Dis.</source> <volume>19</volume>, <fpage>1138</fpage>&#x2013;<lpage>1141</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3201/1907.130313</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huyen</surname> <given-names>M. N. T.</given-names>
</name>
<name>
<surname>Kremer</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Lan</surname> <given-names>N. T. N.</given-names>
</name>
<name>
<surname>Cobelens</surname> <given-names>F. G. J.</given-names>
</name>
<name>
<surname>Buu</surname> <given-names>T. N.</given-names>
</name>
<name>
<surname>Dung</surname> <given-names>N. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Mixed tuberculosis infections in rural south Vietnam</article-title>. <source>J. Clin. Microbiol.</source> <volume>50</volume>, <page-range>1586&#x2013;1592</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.00434-12</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khalif Ali</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Karanja</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Karama</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Kenyatta</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Factors associated with tuberculosis treatment outcomes among tuberculosis patients attending tuberculosis treatment centres in 2016-2017 in Mogadishu, Somalia</article-title>. <source>Pan. Afr. Med. J.</source> <volume>28</volume>, <fpage>197</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4314/pamj.v28i1</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lan</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Bastos</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Menzies</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Treatment of human disease due to mycobacterium bovis: A systematic review</article-title>. <source>Eur. Respir. J.</source> <volume>48</volume>, <fpage>1500</fpage>&#x2013;<lpage>1503</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1183/13993003.00629-2016</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mostowy</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Onipede</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gagneux</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Niemann</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kremer</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Desmond</surname> <given-names>E. P.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Genomic analysis distinguishes mycobacterium africanum</article-title>. <source>J. Clin. Microbiol.</source> <volume>42</volume>, <fpage>3594</fpage>&#x2013;<lpage>3599</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.42.8.3594-3599.2004</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ofori-Anyinam</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Kanuteh</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Agbla</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Adetifa</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Okoi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Dolganov</surname> <given-names>G.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Impact of the mycobaterium africanum West Africa 2 lineage on TB diagnostics in West Africa: Decreased sensitivity of rapid identification tests in the Gambia</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>10</volume>, <fpage>e0004801</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0004801</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oryan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Yazdi</surname> <given-names>H. S.</given-names>
</name>
<name>
<surname>Alidadi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Doostmohammadi</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Use of a gyrB PCR-RFLP method to diagnose tuberculosis and identify the causative mycobacterium sp. in cattle and humans</article-title>. <source>Comp. Immunol. Microbiol. Infect. Dis.</source> <volume>82</volume>, <elocation-id>101767</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/J.CIMID.2022.101767</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Otchere</surname> <given-names>I. D.</given-names>
</name>
<name>
<surname>Coscoll&#xe1;</surname> <given-names>M.</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Bus&#xf3;</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Asante-Poku</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Brites</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Loiseau</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Comparative genomics of mycobacterium africanum lineage 5 and lineage 6 from Ghana suggests distinct ecological niches</article-title>. <source>Sci. Rep.</source> <volume>8</volume>, <fpage>1</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-018-29620-2</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Otchere</surname> <given-names>I. D.</given-names>
</name>
<name>
<surname>van Tonder</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Asante-Poku</surname> <given-names>A.</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Bus&#xf3;</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Coscoll&#xe1;</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Osei-Wusu</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Molecular epidemiology and whole genome sequencing analysis of clinical mycobacterium bovis from Ghana</article-title>. <source>PloS One</source> <volume>14</volume>, <fpage>e0209395</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0209395</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Page</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Cummins</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Hunt</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wong</surname> <given-names>V. K.</given-names>
</name>
<name>
<surname>Reuter</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Holden</surname> <given-names>M. T. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Roary: Rapid large-scale prokaryote pan genome analysis</article-title>. <source>Bioinformatics</source> <volume>31</volume>, <page-range>3691&#x2013;3693</page-range>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/BIOINFORMATICS/BTV421</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Zheng</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Misdiagnosis of tuberculosis associated with some species of nontuberculous mycobacteria by GeneXpert MTB/RIF assay</article-title>. <source>Infection</source> <volume>45</volume>, <fpage>677</fpage>&#x2013;<lpage>681</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s15010-017-1044-x</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papastavros</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Dolovich</surname> <given-names>L. R.</given-names>
</name>
<name>
<surname>Holbrook</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Whitehead</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Loeb</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Adverse events associated with pyrazinamide and levofloxacin in the treatment of latent multidrug-resistant tuberculosis</article-title>. <source>Can. Med. Assoc. J.</source> <volume>167</volume>, <fpage>131</fpage>.</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pornsukarom</surname> <given-names>S.</given-names>
</name>
<name>
<surname>van Vliet</surname> <given-names>A. H. M.</given-names>
</name>
<name>
<surname>Thakur</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Whole genome sequencing analysis of multiple salmonella serovars provides insights into phylogenetic relatedness, antimicrobial resistance, and virulence markers across humans, food animals and agriculture environmental sources</article-title>. <source>BMC Genomics</source> <volume>19</volume>, <fpage>801</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/s12864-018-5137-4</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>PrimerQuest Tool</collab>
</person-group> <source>IDT</source>. Available at: <uri xlink:href="https://eu.idtdna.com/Primerquest/Home/Index">https://eu.idtdna.com/Primerquest/Home/Index</uri> (Accessed <access-date>June 18, 2022</access-date>).</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Seemann</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Prokka: Rapid prokaryotic genome annotation</article-title>. <source>Bioinformatics</source> <volume>30</volume>, <fpage>2068</fpage>&#x2013;<lpage>2069</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/BIOINFORMATICS/BTU153</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>SRA-Tools-NCBI</collab>
</person-group> (<year>2021</year>). Available at: <uri xlink:href="https://ncbi.github.io/sra-tools/fastq-dump.html">https://ncbi.github.io/sra-tools/fastq-dump.html</uri> (Accessed <access-date>June 22, 2021</access-date>).</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sylverken</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Kwarteng</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Twumasi-Ankrah</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Owusu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Arthur</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Dumevi</surname> <given-names>R. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>The burden of drug resistance tuberculosis in ghana; results of the first national survey</article-title>. <source>PloS One</source> <volume>16</volume>, <fpage>e0252819</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/JOURNAL.PONE.0252819</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Rie</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Victor</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Richardson</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>R.</given-names>
</name>
<name>
<surname>van der Spuy</surname> <given-names>G. D.</given-names>
</name>
<name>
<surname>Murray</surname> <given-names>E. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Reinfection and mixed infection cause changing mycobacterium tuberculosis drug-resistance patterns</article-title>. <source>Am. J. Respir. Crit. Care Med.</source> <volume>172</volume>, <fpage>636</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1164/RCCM.200503-449OC</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="web">
<person-group person-group-type="author">
<collab>WHO</collab>
</person-group> (<year>2020</year>) <source>Global tuberculosis report 2020: executive summary</source>. Available at: <uri xlink:href="http://apps.who.int/bookorders">http://apps.who.int/bookorders</uri> (Accessed <access-date>January 5, 2021</access-date>).</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yeboah-Manu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Yates</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Wilson</surname> <given-names>S. M.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Application of a simple multiplex PCR to aid in routine work of the mycobacterium reference laboratory</article-title>. <source>J. Clin. Microbiol.</source> <volume>39</volume>, <fpage>4166</fpage>&#x2013;<lpage>4168</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.39.11.4166-4168.2001</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Y&#x131;lmaz</surname> <given-names>N.</given-names>
</name>
<name>
<surname>U&#xe7;ar</surname> <given-names>E. Y.</given-names>
</name>
<name>
<surname>Sa&#x11f;lam</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Mycobacterium tuberculosis and nontuberculous mycobacteria coinfection of the lungs</article-title>. <source>Turkish Thorac. J.</source> <volume>18</volume>, <fpage>23</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5152/TURKTHORACJ.2017.16034</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zetola</surname> <given-names>N. M.</given-names>
</name>
<name>
<surname>Shin</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Tumedi</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Moeti</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Ncube</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Nicol</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Mixed mycobacterium tuberculosis complex infections and false-negative results for rifampin resistance by GeneXpert MTB/RIF are associated with poor clinical outcomes</article-title>. <source>J. Clin. Microbiol.</source> <volume>52</volume>, <fpage>2422</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.02489-13</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>