<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2022.874694</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Assessing <italic>in vivo</italic> and <italic>in vitro</italic> biofilm development by <italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> using a murine model of catheter-associated biofilm and human keratinocyte cell</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Alves-Barroco</surname>
<given-names>Cinthia</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1022773"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Botelho</surname>
<given-names>Ana Maria Nunes</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Am&#xe9;rico</surname>
<given-names>Marco Antonio</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fracalanzza</surname>
<given-names>S&#xe9;rgio Eduardo Longo</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/926892"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>de Matos</surname>
<given-names>Ant&#xf3;nio P. Alves</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1826784"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Guimaraes</surname>
<given-names>M&#xe1;rcia Aparecida</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ferreira-Carvalho</surname>
<given-names>Bernadete Teixeira</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1254269"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Figueiredo</surname>
<given-names>Agnes Marie S&#xe1;</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/603260"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Fernandes</surname>
<given-names>Alexandra R.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/464205"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>UCIBIO - Applied Molecular Biosciences Unit, Dept. Ci&#xea;ncias da Vida, NOVA School of Science and Technology</institution>, <addr-line>Caparica</addr-line>, <country>Portugal</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>i4HB, Associate Laboratory - Institute for Health and Bioeconomy, Faculdade de Ci&#xea;ncias e Tecnologia, Universidade NOVA de Lisboa</institution>, <addr-line>Caparica</addr-line>, <country>Portugal</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Instituto de Microbiologia Paulo de G&#xf3;es, Universidade Federal do Rio de Janeiro</institution>, <addr-line>Rio de Janeiro</addr-line>, <country>Brazil</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Centro de Investiga&#xe7;&#xe3;o Interdisciplinar Egas Moniz (CiiEM), Egas Moniz - Cooperativa de Ensino Superior CRL</institution>, <addr-line>Quinta da Granja</addr-line>, <country>Portugal</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Samuel Lee, Dartmouth College, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Limei Zhang, China Agricultural University, China; Ai-Qun Jia, Hainan University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Alexandra R. Fernandes, <email xlink:href="mailto:ma.fernandes@fct.unl.pt">ma.fernandes@fct.unl.pt</email>; Agnes Marie S&#xe1; Figueiredo, <email xlink:href="mailto:agnes@micro.ufrj.br">agnes@micro.ufrj.br</email>
</p>
</fn>
<fn fn-type="other" id="fn003">
<p>&#x2020;These authors share last authorship</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Biofilms, a section of the journal Frontiers in Cellular and Infection Microbiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>19</day>
<month>07</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>12</volume>
<elocation-id>874694</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>02</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>29</day>
<month>06</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Alves-Barroco, Botelho, Am&#xe9;rico, Fracalanzza, de Matos, Guimaraes, Ferreira-Carvalho, Figueiredo and Fernandes</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Alves-Barroco, Botelho, Am&#xe9;rico, Fracalanzza, de Matos, Guimaraes, Ferreira-Carvalho, Figueiredo and Fernandes</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> (SDSD) is an important agent of bovine mastitis. This infection causes an inflammatory reaction in udder tissue, being the most important disease-causing significant impact on the dairy industry. Therefore, it leads to an increase in dairy farming to meet commercial demands. As a result, there is a major impact on both the dairy industry and the environment including global warming. Recurrent mastitis is often attributed to the development of bacterial biofilms, which promote survival of sessile cells in hostile environments, and resistance to the immune system defense and antimicrobial therapy. Recently, we described the <italic>in vitro</italic> biofilm development on abiotic surfaces by bovine SDSD. In that work we integrated microbiology, imaging, and computational methods to evaluate the biofilm production capability of SDSD isolates on abiotic surfaces. Additionally, we reported that bovine SDSD can adhere and internalize human cells, including human epidermal keratinocyte (HEK) cells. We showed that the adherence and internalization rates of bovine SDSD isolates in HEK cells are higher than those of a SDSD DB49998-05 isolated from humans. <italic>In vivo</italic>, bovine SDSD can cause invasive infections leading to zebrafish morbidity and mortality. In the present work, we investigated for the first time the capability of bovine SDSD to develop biofilm <italic>in vivo</italic> using a murine animal model and ex-vivo on human HEK cells. Bovine SDSD isolates were selected based on their ability to form weak, moderate, or strong biofilms on glass surfaces. Our results showed that SDSD isolates displayed an increased ability to form biofilms on the surface of catheters implanted in mice when compared to <italic>in vitro</italic> biofilm formation on abiotic surface. A greater ability to form biofilm <italic>in vitro</italic> after animal passage was observed for the VSD45 isolate, but not for the other isolates tested. Besides that, <italic>in vitro</italic> scanning electron microscopy demonstrated that SDSD biofilm development was visible after 4 hours of SDSD adhesion to HEK cells. Cell viability tests showed an important reduction in the number of HEK cells after the formation of SDSD biofilms. In this study, the expression of genes encoding BrpA-like (biofilm regulatory protein), FbpA (fibronectin-binding protein A), HtrA (serine protease), and SagA (streptolysin S precursor) was higher for biofilm grown <italic>in vivo</italic> than <italic>in vitro</italic>, suggesting a potential role for these virulence determinants in the biofilm-development, host colonization, and SDSD infections. Taken together, these results demonstrate that SDSD can develop biofilms <italic>in vivo</italic> and on the surface of HEK cells causing important cellular damages. As SDSD infections are considered zoonotic diseases, our data contribute to a better understanding of the role of biofilm accumulation during SDSD colonization and pathogenesis not only in bovine mastitis, but they also shed some lights on the mechanisms of prosthesis-associated infection and cellulitis caused by SDSD in humans, as well.</p>
</abstract>
<kwd-group>
<kwd>host-pathogen interaction</kwd>
<kwd>bovine mastitis</kwd>
<kwd>bacterial cytotoxicity</kwd>
<kwd>biofilm development</kwd>
<kwd>SDSD pathogenesis</kwd>
</kwd-group>
<counts>
<fig-count count="6"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="53"/>
<page-count count="12"/>
<word-count count="6021"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>
<italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> (SDSD) has been considered an important bovine mastitis pathogen (<xref ref-type="bibr" rid="B1">Abdelsalam et&#xa0;al., 2010</xref>; <xref ref-type="bibr" rid="B53">Zadoks et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B10">Cervinkova et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B42">Rato et&#xa0;al., 2013</xref>) that causes severe economic repercussions over milk production. In addition, the association of SDSD with human infections has been reported (<xref ref-type="bibr" rid="B29">Koh et&#xa0;al., 2009</xref>; <xref ref-type="bibr" rid="B38">Park et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B26">Jordal et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B13">Chennapragada et&#xa0;al., 2018</xref>). Nevertheless, the role and importance of SDSD in human pathogenesis remain mostly unclear. Despite that, it is remarkable that SDSD is amongst the bacterial agents able to cause prosthetic joint infections (<xref ref-type="bibr" rid="B38">Park et&#xa0;al., 2012</xref>).</p>
<p>It is well known that biofilm is an important mechanism on the pathogenesis of medical device-associated infections, such as orthopedic prostheses (<xref ref-type="bibr" rid="B44">Ronin et&#xa0;al., 2022</xref>). Biofilms play an essential role in bacterial pathogenesis, promoting persistent infections and contributing to therapy failure. Biofilm formation involves various phases, including adhesion of the bacterial cells to the biotic and abiotic surfaces, in which diverse bacterial factors are involved (<xref ref-type="bibr" rid="B30">Kumar et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B25">Jamal et&#xa0;al., 2018</xref>). The great majority of the studies on bacterial biofilms have been based on <italic>in vitro</italic> growth on abiotic surfaces, which might be relevant for pathogens that grow on pacemakers, catheters, protheses and other implantable medical devices, increasing the risk of infections in hospital environments. Despite that, most bacterial host infections require biofilm formation on biotic surfaces as the initial stage of colonization or infection (<xref ref-type="bibr" rid="B11">Chao et&#xa0;al., 2017</xref>).</p>
<p>Additionally, host microenvironments, especially plasma proteins, are important for bacterial adherence to biotic or abiotic surfaces and biofilm formation during the process of a natural infection (<xref ref-type="bibr" rid="B48">Speziale et&#xa0;al., 2014</xref>). Therefore, <italic>in vivo</italic> models are important to gain a better understanding of the mechanisms involved in the development of biofilms and associated diseases. In the <italic>in vivo</italic> models of device-related infections (also called murine foreign body model), the foreign body can be inserted into the organ or into the subcutaneous space. The latter involves inserting a 1&#xa0;cm segment of a catheter containing bacterium inoculum under animals&#x2019; skin (<xref ref-type="bibr" rid="B40">Prabhakara et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B49">Tr&#xf8;strup et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B28">Kissoyan et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B45">See et&#xa0;al., 2016</xref>). Previous studies have shown that the murine model of prosthetic implant infection mediated by <italic>Staphylococcus aureus</italic> stimulates host responses like those observed in human infections (<xref ref-type="bibr" rid="B40">Prabhakara et&#xa0;al., 2011</xref>). Additionally, animal models have proved to be very useful providing excellent results in studies aimed at the development of new antibacterial agents and alternative therapies (<xref ref-type="bibr" rid="B41">Proetzel and Wiles, 2010</xref>; <xref ref-type="bibr" rid="B16">Cusumano et&#xa0;al., 2014</xref>). Other <italic>in vivo</italic> models of biofilm development have been described, such as those involving central venous catheter implantation in rats (<xref ref-type="bibr" rid="B12">Chauhan et&#xa0;al., 2016</xref>). This last model is more suitable for studies on the pathogenesis of bloodstream infections related to biofilm formation on catheter surfaces, while the murine model involving insertion of catheters into subcutaneous space would be more useful for studies on the role played by biofilm in foreign body infections (<xref ref-type="bibr" rid="B40">Prabhakara et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B12">Chauhan et&#xa0;al., 2016</xref>).</p>
<p>The ability of SDSD to form biofilms on abiotic surfaces was recently reported by us using confocal laser scanning microscopy, transmission electron microscopy and scanning electron microscopy (<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>). We have also demonstrated for the first time that SDSD isolated from bovines can adhere to and internalize into human cells, including human epidermal keratinocyte (HEK) cells. Notably, the adherence and internalization rates of these SDSD isolates in HEK were higher than those of <italic>S. pyogenes</italic> and SDSD DB49998-05 (GCS-Si) isolates from humans (<xref ref-type="bibr" rid="B43">Roma-Rodrigues et&#xa0;al., 2016</xref>). &#x200b;Besides that, there are histological evidence that SDSD can cause invasive infections in a zebrafish model leading to morbidity and mortality (<xref ref-type="bibr" rid="B6">Alves-Barroco et&#xa0;al., 2018</xref>).</p>
<p>The first report of SDSD biofilm involvement in prosthetic joint infections in humans was provided in 2012. The patient was treated by re-implantation with an application of antibiotic-impregnated cement spacer (<xref ref-type="bibr" rid="B38">Park et&#xa0;al., 2012</xref>).</p>
<p>In the present work, we used BALB/c mice for a biofilm model <italic>via</italic> catheter implant to investigate the ability of SDSD isolates to form biofilms <italic>in vivo</italic>. Additionally, we compared <italic>in vivo</italic> and <italic>in vitro</italic> biofilm developments by SDSD isolates collected from bovines. We also investigated the capability of these isolates to develop biofilm on human keratinocyte (HEK) cells, since this bacterium can zoonotically infect humans causing, for example, cellulitis (<xref ref-type="bibr" rid="B13">Chennapragada et&#xa0;al., 2018</xref>). Finally, the expression profile of genes associated with virulence, including biofilm development and modulation, in other streptococci was analyzed both <italic>in vivo</italic> and <italic>in vitro</italic> to gain some insights on biofilm formation by SDSD isolates.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and methods</title>
<sec id="s2_1">
<title>Ethics</title>
<p>The animal experimentation was approved by the ethics committee on the use of animals&#xa0;from Centro de Ci&#xea;ncias da Sa&#xfa;de, Universidade Federal do Rio de Janeiro, Brazil (#01200.001568/2013-87- CEAU).</p>
</sec>
<sec id="s2_2">
<title>Biofilm formation assay on abiotic surfaces</title>
<p>The ability to form&#xa0;biofilms&#xa0;by 37 SDSD isolates from bovine clinical mastitis obtained between 2011 and 2013 [collection II, (<xref ref-type="bibr" rid="B2">Alves-Barroco et&#xa0;al., 2021</xref>)] was evaluated on polystyrene and glass surface (borosilicate test tubes) according to previously described protocols (<xref ref-type="bibr" rid="B24">Genteluci et&#xa0;al., 2015</xref>; <xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B52">Xu et&#xa0;al., 2022</xref>). For a comparative analysis, 18 SDSD isolates from bovine clinical mastitis (collection I) (<xref ref-type="bibr" rid="B42">Rato et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>), obtained between 2002 and 2003, were included in the study. Sample collection design followed the international (Directive 2010/63/EU of the European parliament, on the protection of animals used for scientific purposes) and national (Decreto-Lei n&#xb0; 113/2013) welfare regulations and guidelines (ARRIVE) was previously approved by the Portuguese &#x201c;Dire&#xe7;&#xe3;o Geral de Alimenta&#xe7;&#xe3;o e Veterin&#xe1;ria (DGAV)&#x201d; (authorization document 0421/000/000/2013). In addition, the two authors have a level C FELASA certification (Federation of European Laboratory Animal Science Associations).</p>
<p>To evaluate the biofilm production on glass surfaces, the bovine SDSD isolates were streaked on blood&#xa0;agar plates&#xa0;and incubated at 37&#x2009;&#xb0;C for 18&#x2009;h in a 5% (v/v) CO<sub>2</sub>&#xa0;incubator. About 5 colonies were transferred to Tryptic Soy Broth (TSB; Becton, Dickinson and Company, Le Pont de Claix, France) supplemented with 0.5% (w/v) glucose and incubated at 37&#x2009;&#xb0;C until the middle of the exponential growth phase. The pure&#xa0;culture (OD<sub>570</sub>&#x2009;=&#x2009;0.6) was diluted 1:40 in a glass test tube (16 x 1,05 x 100&#xa0;mm, NORMAX, Portugal) containing TSB supplemented with glucose (final volume 4 mL) and incubated at 37&#x2009;&#xb0;C for 20&#x2009;h. Then, the supernatant was removed, and the glass tube washed with sterile saline solution [0.85% (w/v) NaCl]. The tubes were incubated at 65&#x2009;&#xb0;C for 1&#x2009;h for drying. Biofilms were resuspended in 4&#x2009;mL of saline and the OD at 600&#x2009;nm measured. The isolates were defined as non-biofilm producers: OD<sub>600</sub> &#x2264; 0.099, weak: OD<sub>600</sub>&#xa0;between 0.1&#x2013;0.299, moderate: between 0.3&#x2013;0.599, or strong biofilm producers: OD<sub>600</sub>&gt;0.600.</p>
<p>On polystyrene surfaces, after growing to the middle of the exponential phase, the bacterial culture (OD<sub>570</sub> =&#x2009;0.6) was diluted 1:2 in TSB supplemented with glucose in a 96 well plate (final volume 200 &#xb5;L/well). The 96 well plate was sealed and incubated at 37&#x2009;&#xb0;C for 20&#x2009;h. The supernatant was removed, and the wells washed with saline to remove non-adherent bacteria. Then, the plates were incubated at 65&#x2009;&#xb0;C for 1&#x2009;h for drying and fixing biofilm. The biofilm was stained with&#xa0;crystal violet&#xa0;1% (w/v) for 1&#x2009;min. The wells were washed with sterile distilled water until the dye from the negative control-wells was completely removed. The OD<sub>570</sub>&#xa0;of the stained biofilm was directly measured in a plate reader (Infinite M200, Tecan, M&#xe4;nnedorf, Switzerland). Interpretation of biofilm formation was performed according to the criteria previously described (<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>) and the isolates were therefore categorized as follows: non producer: OD&#x2009;&#x2264;&#x2009;OD<sub>ctrl</sub>, (OD<sub>ctrl</sub> = 0.060); weak producer: OD<sub>ctrl</sub>&#xa0;&lt; OD&#x2009;&#x2264;&#x2009;2 &#xd7; OD<sub>ctrl</sub>; moderate producer: 2 &#xd7; OD<sub>ctrl</sub>&#xa0;&lt; OD&#x2009;&#x2264;&#x2009;4 &#xd7; OD<sub>ctrl</sub>. strong producer: OD&#x2009;&gt;&#x2009;4 &#xd7; OD<sub>ctrl</sub>
</p>
</sec>
<sec id="s2_3">
<title>SDSD biofilm formation&#xa0;on human keratinocyte cells</title>
<p>This assay was based on previously described protocols (<xref ref-type="bibr" rid="B43">Roma-Rodrigues et&#xa0;al., 2015</xref>) with few modifications. Bacteria were grown at 37&#xb0;C in Todd Hewitt Broth (THB; Oxoid; Basingstoke, UK) supplemented with 0.5% (w/v) yeast extract until the middle exponential growth phase. The infection was started by adding bacterial suspension (containing 10<sup>6</sup> bacterial cells) in Dulbecco&#x2019;s Modified Eagle&#x2019;s Medium (DMEM; ThermoFisher Scientific; Waltham, MA, USA) supplemented with 10% (v/v) fetal bovine serum (ThermoFisher Scientific) to 10<sup>4</sup> human epidermal keratinocyte (HEK) cells (ATCC-PCS-200-010, ATCC, Manassas, VA, USA). The infected culture was incubated at 37 &#xb0;C, 5% (v/v) CO<sub>2</sub>, and 99% relative humidity. After 2&#xa0;h and 4&#xa0;h of incubation, HEK cells were washed with phosphate buffer saline (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na<sub>2</sub>HPO<sub>4</sub>, and 1.8 mM KH<sub>2</sub>PO<sub>4</sub>, pH 7.4) (Sigma-Aldrich, St. Louis, MO, USA), to remove non-adhered bacteria, and then fixed with 2% (v/v) glutaraldehyde (Sigma-Aldrich) in PBS for 2&#xa0;h at room temperature. The HEK cells were washed with PBS (three times), post-fixed with 1.0% (w/v) osmium tetroxide (Sigma-Aldrich) at 4&#xb0;C for 1&#xa0;h, and then processed as previously described (<xref ref-type="bibr" rid="B23">Garc&#xed;a-P&#xe9;rez et&#xa0;al., 2003</xref>). The infected HEK cells were visualized using a scanning electron microscope (JEOL JSM-5400).</p>
<p>Viability of HEK cells was determined using MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt] assay as previously described (<xref ref-type="bibr" rid="B19">Fernandes et&#xa0;al., 2017</xref>). HEK cells were seeded in 96-well plates (ThermoFisher Scientific) and grown at 37 &#xb0;C, 5% (v/v) CO<sub>2</sub>, and 99% relative humidity for 24&#xa0;h, before incubations in the same conditions for 2&#xa0;h, 4&#xa0;h, and 6&#xa0;h with SDSD cells or bacterial growth supernatant. After the incubation period, the culture medium was removed and, after washing HEK cells with PBS, fresh medium containing 10% MTS reagent (ThermoFisher Scientific) was added to each well. The 96-well plate was incubated at 37&#xb0;C, in the same atmosphere, for 60&#xa0;min. The absorbance (Abs) was measured in a microplate reader at 490 nm (Infinite M200, Tecan, M&#xe4;nnedorf, Switzerland). The following equation was applied: cell viability (%) = 100 x [mean Abs of SDSD cells (or mean Abs bacterial growth supernatant)/mean Abs of control group without SDSD cells or bacterial growth supernatant].</p>
</sec>
<sec id="s2_4">
<title>
<italic>In vitro</italic> biofilm formation on the surface of an intravenous catheter segment</title>
<p>Exponentially growing SDSD cells in TSB supplemented with 0.5% (w/v) glucose were harvested by centrifugation and diluted in the fresh broth. A volume of 10&#xa0;&#x3bc;L [containing 10<sup>4</sup>&#xa0;colony forming units (CFU)] was injected into the lumen of a 1&#xa0;cm segment of the polyurethane catheter (C-953-J-UDLM; Cook Inc., Bloomington, IN, USA). Then, the catheter was placed into the well of a 24-well plate and incubated for 72&#xa0;h. To count the SDSD cells adhered, the catheter was washed with PBS twice, to remove non-adherent bacteria, and placed in fresh broth. After sonication (15&#xa0;min; 38.5&#x2013;40.5&#xa0;kHz, in ice), the CFU/mL was determined using Todd Hewitt Agar (THA). Biofilm was assessed by counting the SDSD cells adhered to the catheter.</p>
</sec>
<sec id="s2_5">
<title>
<italic>In vivo</italic> biofilm formation</title>
<p>The <italic>in vivo</italic> assays using a mouse foreign-body model were performed as described in <xref ref-type="bibr" rid="B24">Genteluci et&#xa0;al., 2015</xref>. Briefly, young adult BALB/c mice (age between 8 to 10 weeks), obtained from NCAL-UFRJ (<uri xlink:href="https://ccs.ufrj.br/paginas/sobre-o-ccs/coordenacoes/cambe">https://ccs.ufrj.br/paginas/sobre-o-ccs/coordenacoes/cambe</uri>), were anesthetized, and a subcutaneous incision was created to introduce a 1&#xa0;cm segment of a polyurethane intravenous catheter containing 10 &#x3bc;L of the bacterial suspension (10<sup>6</sup> CFU). The catheter was implanted subcutaneously (at least 1.5&#xa0;cm from the incision). after 72 hours of infection, the animals were euthanized, and the catheter segments removed. After that, the catheter segments were washed with 0.15 M NaCl to remove any planktonic bacteria and placed in a tube containing 1 mL of saline. After sonication (15&#xa0;min, 38.5&#x2013;40.5 kHz, in ice), CFU/mL was determined using THA. Biofilm was assessed by counting the SDSD cells adhered to the catheter.</p>
<p>To investigate whether animal passage can increase the ability of SDSD to accumulate biofilms <italic>in vitro</italic>, cells collected from the catheter implanted in the mice were inoculated in TSB containing 0.5% (w/v) glucose at 37 &#xb0;C for 18&#xa0;h. Then, aliquots (with and without animal passage) were obtained to assess biofilm formation on the glass surface following the protocol described above.</p>
</sec>
<sec id="s2_6">
<title>Reverse transcription quantitative PCR</title>
<p>Expression levels of genes associated with biofilm formation in other streptococci were evaluated using sessile cells recovered from <italic>in vivo</italic> and <italic>in vitro</italic> biofilms. RNA was extracted using NucleoSpin RNAII kit (Macherey-Nagel, Dueren, Germany) according to the manufacturer&#x2019;s instructions to comparatively quantify transcripts of genes encoding BrpA-like (biofilm regulatory protein), FbpA (fibronectin-binding protein A), HtrA (serine protease), and SagA (streptolysin S precursor). The cDNA was synthesized using the SuperScript first-strand synthesis system (Invitrogen) according to the manufacturer&#x2019;s instructions. The RT-qPCR reaction mixture (20&#x2009;&#x3bc;L) contained NZY qPCR Green Master Mix (NZYTech, Lisbon, Portugal), 1&#x2009;&#x3bc;L cDNA, and 0.5&#x2009;&#x3bc;M of the forward and reverse primers described in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. PCR conditions included an initial&#xa0;denaturation&#xa0;for 10&#x2009;min at 95&#xb0;C, followed by 30 cycles of amplification consisting of denaturation for 15&#x2009;s at 95&#xb0;C, and annealing for 30&#x2009;s at 58&#xb0;C and extension for 45&#x2009;s at 60&#x2009;&#xb0;C. The critical Ct was defined as the cycle in which fluorescence becomes detectable above the background fluorescence. The expression levels were normalized using the 16S rRNA gene as an internal standard. Each assay was performed with at least three independent RNA samples.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequences used for RT-qPCR analysis in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Primer name</th>
<th valign="top" align="center">Sequence (5&#x2019;-3&#x2019;)</th>
<th valign="top" align="center">PCR product size (bp)</th>
<th valign="top" align="center">Reference</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>brpA</italic>-like</td>
<td valign="top" align="left"/>
<td valign="top" align="center"/>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">for<xref ref-type="table-fn" rid="fnT1_1">
<sup>a</sup>
</xref>
</td>
<td valign="top" align="left">TGAAGCTAAGTTGAATGCTGC</td>
<td valign="top" rowspan="2" align="center">534</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">rev</td>
<td valign="top" align="left">GAACCACCATCAGACAAGGT</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">
<italic>fbpA</italic>-like</td>
<td valign="top" align="left"/>
<td valign="top" align="center"/>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">for</td>
<td valign="top" align="left">CGCACCATTTTACCAGGCTC</td>
<td valign="top" rowspan="2" align="center">376</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B6">Alves-Barroco et&#xa0;al., 2018</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">rev</td>
<td valign="top" align="left">TCAAGTCACTCGCTTGCTGA</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">
<italic>htrA</italic>
</td>
<td valign="top" align="left"/>
<td valign="top" align="center"/>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">for</td>
<td valign="top" align="left">TGCGACGATGAGTAAGATGG</td>
<td valign="top" rowspan="2" align="center">218</td>
<td valign="top" rowspan="2" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">rev</td>
<td valign="top" align="left">TGACACCAGAACCTTGAGCA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>sagA</italic>
</td>
<td valign="top" align="left"/>
<td valign="top" align="center"/>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">for</td>
<td valign="top" align="left">TGGAGGTGTTAGGACATGAGG</td>
<td valign="top" rowspan="2" align="center">192</td>
<td valign="top" align="left">This study</td>
</tr>
<tr>
<td valign="top" align="left">rev</td>
<td valign="top" align="left">CTTGCCTTTTCCGACGTTAG</td>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">16S RNA</td>
<td valign="top" align="left"/>
<td valign="top" align="center"/>
<td valign="top" align="left"/>
</tr>
<tr>
<td valign="top" align="left">for</td>
<td valign="top" align="left">ACCAAGGCGACGATACATAG</td>
<td valign="top" rowspan="2" align="center">61</td>
<td valign="top" align="left">
<xref ref-type="bibr" rid="B24">Genteluci et&#xa0;al., 2016</xref>
</td>
</tr>
<tr>
<td valign="top" align="left">rev</td>
<td valign="top" align="left">GTGTCTCAGTCCCAGTGTG</td>
<td valign="top" align="left"/>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="fnT1_1">
<label>a</label>
<p>for; forward, rev; reverse.</p>
</fn>
<fn id="fnT1_2">
<label>b</label>
<p>bp; base pair.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_7">
<title>Statistical analysis</title>
<p>GraphPad Prism version 7.0 was used for statistical analysis. All data were expressed as mean&#x2009;&#xb1;&#x2009;SEM from at least three independent (biological) experiments. The statistical significance was determined for each data set using the student&#x2019;s&#xa0;<italic>t</italic>-test, and statistical significance was considered when&#xa0;<italic>p</italic>&#x2009;&lt;&#x2009;0.05.</p>
<p>For comparison purposes, biofilm developments between SDSD isolates recovered from catheter implanted in mice (<italic>in vivo</italic>) and <italic>in vitro</italic> assay were both measured by CFU. In the case of biofilm developments by SDSD on glass surfaces before and after animal passage, biofilm growth was measured by OD determination.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results and discussion</title>
<sec id="s3_1">
<title>Biofilm formation assay on abiotic surfaces</title>
<p>As a first approach, the ability of 37 SDSD isolates (collection II) to form biofilms on glass and polystyrene surfaces was evaluated. For a comparative analysis, the results obtained for 18 SDSD isolates also obtained from bovines (collection I), shown in <xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al. (2019)</xref>, were included in the study. Overall, despite some differences, the results obtained point to a high <italic>in vitro</italic> biofilm-forming ability by most SDSD isolates with isolates from the collection II showing a greater ability to accumulate biofilms than those from the collection I (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>).</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Comparison of the <italic>in vitro</italic> ability to form biofilms on abiotic surfaces by bovine SDSD isolates of clinical and subclinical mastitis in Portugal, during 2002-2003 (collection I, red circles) and 2011-2013 (collection II, black circles). Interpretation criteria for biofilm formation on polystyrene surface: i) non-producer: OD&#x2009;&#x2264;&#x2009;OD<sub>ctrl</sub>; ii) weak producer: OD&#x2009;&#x2264;&#x2009;OD<sub>ctrl</sub> x 2; iii) moderate producer: OD<sub>ctrl</sub>&#xa0;x 2 &lt; OD &#x2264; OD<sub>ctrl</sub> x 4; and iv) strong producer: OD&#x2009;&gt;&#x2009;OD<sub>ctrl</sub> x 4 Interpretation criteria for <italic>in vitro</italic> biofilm formation on glass surface: i) non-producer: OD<sub>600</sub> &#x2264; 0.099; ii) weak producer; OD<sub>600</sub> &#x2265; 0.1 &#x2264; 0.299; iii) moderate producer OD<sub>600</sub>: &#x2265; 0.3 &#x2264; 0.599; and iv) strong producer OD<sub>600</sub> &gt; 0.600. OD<sub>ctrl</sub> = DO determined for the control.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>SDSD biofilm formation on human keratinocyte cells</title>
<p>HEK cells have an important role in host defense, providing a physical and immunological barrier against pathogenic bacteria. The adherence and/or invasion of Group G streptococci in HEK cells was associated with the severity of skin infections, e.g., necrotizing fasciitis (<xref ref-type="bibr" rid="B46">Siemens et&#xa0;al., 2015</xref>). We previously reported for the first time that bovine SDSD isolates are capable to adhere and internalize several human cells, including HEK cells (<xref ref-type="bibr" rid="B43">Roma-Rodrigues et&#xa0;al., 2016</xref>); <xref ref-type="bibr" rid="B6">Alves-Barroco et&#xa0;al., 2018</xref>. Here, the ability of SDSD isolates to form biofilms on HEK cells was analyzed by scanning electron microscope (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>). Our results demonstrated the formation of an extracellular polymeric matrix by the growth of SDSD biofilms after 2&#xa0;h of infection of HEK cells (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>). After 4&#xa0;h of infection, it was possible to visualize a typical biofilm architecture (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Scanning electron microscopy (SEM) of SDSD biofilms formed by VSD13 after <bold>(A)</bold> 2&#xa0;h and <bold>(B)</bold> 4&#xa0;h on human keratinocyte cells. Blue arrow: SDSD VSD13 cells; yellow arrow: formation of the extracellular polymeric matrix; red arrow: human keratinocyte cells.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g002.tif"/>
</fig>
<p>Similar results were observed by Matsue and co-workers in investigations with other streptococci. They showed that after 2&#xa0;h incubation of HEK cells with <italic>Streptococcus dysgalactiae</italic> subsp. <italic>equisimilis</italic> (SDSE), the percentage of adhered bacterial was on average 70%. Furthermore, the adherence of SDSE on HEK cells was about 10 times higher than that on polystyrene surfaces (<xref ref-type="bibr" rid="B34">Matsue et&#xa0;al., 2020</xref>). Previous&#xa0;studies&#xa0;have&#xa0;also&#xa0;shown&#xa0;the formation of biofilms by <italic>Streptococcus pyogenes</italic> in HEK cells. Visually, <italic>S. pyogenes</italic> biofilms formed on HEK cells were similar to biofilms on abiotic surfaces; however, <italic>S. pyogenes</italic> biofilms on HEK cells were more resistant to antimicrobial therapy (<xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>). Marks and co-workers demonstrated that during coculture, the <italic>S. pyogenes</italic> biofilm extended about 20&#x2013;30 &#xb5;m above the HEK cells; however, <italic>S. pyogenes</italic> biofilms did not induce HEK cell death, as the keratinocytes layer remained intact during the experiment (<xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>). Contrary to what was observed for <italic>S. pyogenes</italic> (<xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>), SDSD biofilm induced a decline in viability of the HEK cells over time (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). After 6&#xa0;h incubation with VSD13 isolate grown in biofilm condition or with its filtered culture supernatant, the viability of HEK cells was 32% and 86%, respectively. Our results also showed that&#xa0;the development of biofilms on the&#xa0;HEK cell monolayers exhibited&#xa0;greater cytotoxicity than extracellular products from bacterial growth (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>). Thus, these data could indicate that SDSD biofilm may develop during the process of skin/soft tissue infections, suggesting that it might be important in the pathogenesis of human SDSD cellulitis.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Viability of HEK cells exposure to SDSD VSD13 sessile cells or bacterial supernatants for 2&#xa0;h, 4&#xa0;h and 6&#xa0;h. The following equation was applied: cell viability (%) = 100 x [mean Abs SDSD cells (or mean Abs bacterial growth supernatant)/mean Abs control group]. Data are the average of at least three independent (biological) assays with three technical replicates each. Error bars correspondent to standard deviation. Statistically significant differences were observed in the viability of HEK cells exposure to SDSD VSD13 sessile cells and bacterial supernatants at 4&#xa0;h and 6&#xa0;h, * <italic>p</italic> &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g003.tif"/>
</fig>
<p>Together, they suggest an important role for SDSD biofilm formation on HEK cells, which may contribute to the development of deeper tissue infections and bacterial dissemination. In fact, in recent years, the association of SDSD with human infections such as cellulitis has been reported (<xref ref-type="bibr" rid="B13">Chennapragada et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B36">Nathan et&#xa0;al., 2021</xref>), and one case of cellulitis rapidly progressed to septic shock (<xref ref-type="bibr" rid="B36">Nathan et&#xa0;al., 2021</xref>). Indeed, we have recently reported for the first time the resistance to conventional antibiotics associated with biofilm formation by SDSD (<xref ref-type="bibr" rid="B4">Alves-Barroco et&#xa0;al., 2022</xref>), which may complicate the treatment of some infections associated with this subspecies.</p>
</sec>
<sec id="s3_3">
<title>
<italic>In vivo</italic> Biofilm Formation</title>
<p>To reduce the number of sacrificed animals and to compare <italic>in vivo</italic> and <italic>in vitro</italic> biofilm formation and accumulation, SDSD isolates were selected based on their <italic>in vitro</italic> ability to form strong (n=2; isolates VSD9 and VSD22; collection I and II, respectively), moderate (n=1; isolate VSD16), or weak (n=2; isolates VSD13 and VSD45; collection I and II, respectively) biofilms on the glass surface. All SDSD isolates tested, including weak biofilm producers <italic>in vitro</italic>, were able to develop biofilm <italic>in vivo</italic> (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Comparison of biofilm development by bovine SDSD isolates recovered from catheter implanted in mice and by the <italic>in vitro</italic> assay. Statistically significant differences were observed in the formation of biofilms <italic>in vivo</italic> and <italic>in vitro</italic>, * <italic>p</italic> &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g004.tif"/>
</fig>
<p>The results showed an important increased ability to develop biofilm on catheter implanted in mice compared with the respective biofilm formed <italic>in vitro</italic>, except for the SDSD isolate VSD22, which already produced a very strong biofilm <italic>in vitro</italic>. Overall, the results suggest that the capability of SDSD isolated from bovines to develop strong biofilm <italic>in vivo</italic> is independent of the ability to form biofilms <italic>in vitro</italic> on abiotic surfaces. A possible limitation of this study is the fact that we used a collection of SDSD isolates from 2002 to 2013. However, it is important to emphasize that our results were not influenced by SDSD collection period, being similar for the isolates obtained in 2002-2003 or 2011-2013. Indeed, our data contribute for a better understanding of the pathogenic mechanisms of diseases not only in animals but also in humans, such as cellulitis and prosthetic joint infections that happened during these periods (Koh et&#xa0;al., 2009; <xref ref-type="bibr" rid="B38">Park et&#xa0;al., 2012</xref>).</p>
<p>The quantification of <italic>in vitro</italic> versus <italic>in vivo</italic> biofilms (CFU/mL) varied, respectively, from 9.8 x10<sup>3</sup> to 4.0 x10<sup>7</sup> for VSD9 isolate, from 8.0 x10<sup>3</sup> to 7.8 x10<sup>6</sup> for VSD13 isolate, from 1.8 x10<sup>3</sup> to 3.4 x10<sup>6</sup> for VSD16 isolate, and from 7.4 x10<sup>4</sup> to 6.4 x10<sup>6</sup> for VSD45 isolate. An increased ability (approx. 2.2 times) to form biofilm <italic>in vitro</italic> (glass surface) after animal passage was observed for the SDSD isolate VSD45 (weak biofilm producer <italic>in vitro</italic>, <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref>), but not for the other isolates tested.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Biofilm development on glass surfaces by the representative biofilm producers with and without animal passage. Statistically significant differences were observed in the formation of biofilms after animal passage for VSD45, * <italic>p</italic> &lt; 0.05. No significant differences were observed in the biofilm development on glass surfaces after animal passage for VSD9, VSD13, VSD16 and VSD22.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g005.tif"/>
</fig>
<p>Once the role of biofilms in infections was recognized, different <italic>in vitro</italic> and <italic>in vivo</italic> models of infections were developed. The <italic>in vitro</italic> models, although more simplistic, contributed to the current knowledge of the biofilm. These models are also used to investigate the role of genes involved in biofilm formation and to screen antimicrobial agents capable of disintegrating bacterial biofilms. However, <italic>in vitro</italic> models ignore important parameters and host factors. The <italic>in vivo</italic> models have contributed to a better understanding of bacterial adhesion, invasion and cytotoxicity factors, as well as the mechanisms involved in host inflammatory responses. There is no gold-standard model since each model can provide a specific answer. Information about models of biofilm-related infections and their applications is reviewed in <xref ref-type="bibr" rid="B31">Lebeaux et&#xa0;al., 2013</xref>.</p>
<p>The foreign-body mouse model used in the present work has also been successfully applied in previous studies with different bacterial species to analyze the ability of bacteria to form biofilms (<xref ref-type="bibr" rid="B20">Ferreira et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B24">Genteluci et&#xa0;al., 2015</xref>). Genteluci and co-workers showed that SDSE isolates can form biofilms <italic>in vivo</italic>, regardless of their ability to form biofilms <italic>in vitro</italic>. Marks and co-workers showed that <italic>S. pyogenes</italic> non-biofilm producers on abiotic surfaces &#x200b;can form biofilms on epidermal cells with characteristics similar to an <italic>in vivo</italic> colonization or infection (<xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>). Although far from a complete understanding of the multiple factors that control the interactions between the pathogen and the host, animal models provide a better understanding of the biofilm within the context of the host. Taking all our data together, it can be concluded that <italic>in vivo</italic> growth increases the SDSD ability to form biofilms, possibly reflecting an important impact during some SDSD infections in bovine and in human hosts.</p>
</sec>
<sec id="s3_4">
<title>Expression Profiles of Genes Associated With Biofilm Formation</title>
<p>
<italic>In vivo</italic> colonization by the group of pyogenic streptococci requires a series of interactions between the pathogen and the host, involving differential gene expression in both (<xref ref-type="bibr" rid="B3">Alves-Barroco et&#xa0;al., 2020</xref>). Our data revealed that <italic>in vivo</italic>, a similar number of sessile cells were recovered from SDSD isolates previously classified as weak and strong biofilm producers <italic>in vitro</italic>. This difference might be explained by changes in gene expression profiles associated with the regulation of biofilm formation (<xref ref-type="bibr" rid="B33">Marks et&#xa0;al., 2014</xref>). To test this hypothesis, we compared the expression of some biofilm-associated genes in sessile cells of SDSD isolates grown <italic>in vivo</italic> and <italic>in vitro</italic>; except for VSD22 isolate, as no difference was observed between <italic>in vivo</italic> and <italic>in vitro</italic> biofilm formation. Indeed, a remarkably increased expression was observed for the genes encoding BrpA-like (biofilm regulatory protein) and FbpA (fibronectin-binding protein A) for all bacterial biofilms collected from catheters recovered from the mice model (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>B</bold>
</xref>). The <italic>brpA</italic>-like gene was upregulated ~182, 112, 335, and 144-fold for VSD9, VSD13, VAS16, and VSD45, respectively, while <italic>fbpA</italic> was upregulated ~369, 822, 1419, and 708-fold for VSD9, VSD13, VAS16, and VSD45, respectively. The mRNA expression of <italic>htrA</italic> (encoding serine protease) was more dramatically increased for VSD9 (796-fold) and VSD13 (1441-fold) isolates, and mRNA expression of <italic>sagA</italic> (encoding streptolysin S percussor) for VSD13 isolate (~9.8-fold) (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C</bold>
</xref>, <xref ref-type="fig" rid="f6">
<bold>D</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Relative expression levels of <bold>(A)</bold> <italic>brpA</italic>-like <bold>(B)</bold> <italic>fbpA</italic> <bold>(C)</bold> <italic>htrA</italic> and <bold>(D)</bold> <italic>sagA</italic> genes in sessile cells generated <italic>in vivo</italic> compared with those formed <italic>in vitro</italic>. RT-qPCR was expressed as the mean of three biologically independent experiments. The bar represents the standard deviation. The calibration sample was the cDNA for VSD13 biofilm grown <italic>in vitro</italic>. Statistically significant differences were observed for&#xa0;gene expression in SDSD biofilm grown <italic>in vivo</italic> or <italic>in vitro</italic>: * <italic>p</italic> &lt; 0.05; ** <italic>p</italic> &lt; 0.01; *** <italic>p</italic> &lt; 0.001.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-874694-g006.tif"/>
</fig>
<p>The role of the biofilm regulatory protein A (BrpA) in autolysis and cell division of the <italic>Streptococcus mutans</italic> has been shown. <italic>In vitro</italic>, the BrpA-deficient mutant of <italic>S. mutans</italic> maintained its adherence property, but the ability to form biofilms was considerably affected. Additionally, the deficiency of BrpA impaired cell envelope stress responses and acid and oxidative stress tolerance. (<xref ref-type="bibr" rid="B8">Bitoun et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B7">Bitoun et&#xa0;al., 2014</xref>). The biofilm-producing SDSD isolates carry a <italic>brpA</italic>-like gene, which expression level was associated with the ability to form biofilms <italic>jn vitro</italic> (<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>). Therefore, our data showing a parallel increase of biofilm accumulation and <italic>brpA</italic>-like gene expression in the <italic>in vivo</italic> model corroborate a role played by this gene in the development of biofilm by SDSD.</p>
<p>Studies estimated that initial adherence to host cells is mainly mediated by adhesins, such as fibronectin-binding proteins, that allow adhesion to provide biofilm development on host tissues and/or bacterial internalization into host cells (<xref ref-type="bibr" rid="B15">Cue et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B47">&#x160;mitran et&#xa0;al., 2018</xref>). Several fibronectin-binding proteins are produced by <italic>S. dysgalactiae</italic>, with different binding affinities and properties (<xref ref-type="bibr" rid="B3">Alves-Barroco et&#xa0;al., 2020</xref>). These proteins provide adherence to human cells such as fibroblasts and keratinocytes cells, contributing to biofilm development <italic>in vivo</italic> and consequently to persistent infections (<xref ref-type="bibr" rid="B14">Collin and Ols&#xe9;n, 2003</xref>; <xref ref-type="bibr" rid="B9">Brandt and Spellerberg, 2009</xref>). In this work, we observed an increased expression of fibronectin-binding protein A (<italic>fbpA</italic>) gene for sessile cells of SDSD grown <italic>in vivo</italic> compared with <italic>in vitro</italic> (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>). These results corroborate studies showing the important role of fibronectin-binding proteins in biofilm formation (<xref ref-type="bibr" rid="B9">Brandt and Spellerberg, 2009</xref>; <xref ref-type="bibr" rid="B37">O'Neill et&#xa0;al., 2009</xref>).</p>
<p>The high-temperature requirement protein A (HtrA, also known as DegP), is a serine protease widely distributed among streptococci (<xref ref-type="bibr" rid="B3">Alves-Barroco et&#xa0;al., 2020</xref>). HtrA homologs are responsible for the degradation of abnormal proteins in response to environmental stress. These proteins have also been identified in Gram-positive isolates (<xref ref-type="bibr" rid="B27">Kim and Kim, 2005</xref>). In <italic>Streptococcus mutans</italic>, the deletion of the <italic>htrA</italic> gene causes decreased ability to respond to environmental stress (<xref ref-type="bibr" rid="B18">Diaz-Torres and Russell, 2001</xref>). In <italic>S. pyogenes</italic>, the deletion of <italic>htrA</italic> gene affected the expression of several virulence genes (<xref ref-type="bibr" rid="B32">Lyon and Caparon, 2004</xref>). In addition to the proteolytic properties, this enzyme can adhere to the extracellular matrix of host tissues (<xref ref-type="bibr" rid="B32">Lyon and Caparon, 2004</xref>; <xref ref-type="bibr" rid="B27">Kim and Kim, 2005</xref>). Herein, differential expression of the <italic>htrA</italic> gene was observed between <italic>in vitro</italic> and <italic>in vivo</italic> biofilms. Isolates VSD9, VSD13 and VSD45 exhibited an increased <italic>htrA</italic> gene expression <italic>in vivo</italic> (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Interestingly, the VSD16 isolate exhibited a decreased expression of this gene (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6C</bold>
</xref>). Unlike other VSD isolates, such as VSD9 and VSD10, which produce extracellular matrices mostly composed of protein, VSD16 biofilm shows mucus-like material in the biofilm extracellular matrix (<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>), suggesting that the matrix might be formed mostly by extracellular DNA (eDNA) or by complexes of eDNA and proteins (<xref ref-type="bibr" rid="B5">Alves-Barroco et&#xa0;al., 2019</xref>). Taken together, these results indicate that the VSD16 isolate may have a different biofilm formation pathway.</p>
<p>The <italic>sagA</italic> gene encodes the mature streptolysin S (SLS) toxin responsible mainly for the &#x3b2;-hemolytic activity among the pyogenic group of streptococci (<xref ref-type="bibr" rid="B17">Datta et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B35">Molloy et&#xa0;al., 2011</xref>). The SLS operon encodes the <italic>sagA</italic> gene (the structural propeptide), followed by genes that provide the conversion of SagA propeptide into SLS (<italic>sagB</italic> to <italic>D</italic>), leader cleavage (<italic>sagE</italic>), and transport across the membrane (<italic>sagF</italic> to <italic>I</italic>). The <italic>S. pyogenes</italic> SLS causes host soft-tissue damages, impacts phagocytes, and contributes to translocation across the epithelial barrier (<xref ref-type="bibr" rid="B35">Molloy et&#xa0;al., 2011</xref>). SLS also promotes programmed cell death and enhances inflammation in HEK cells (<xref ref-type="bibr" rid="B21">Flaherty et&#xa0;al., 2015</xref>). Studies revealed that SLS promotes host-associated biofilm formation (<xref ref-type="bibr" rid="B51">Vajjala et&#xa0;al., 2019</xref>), besides inducing mitochondrial damage and consequently macrophage death (<xref ref-type="bibr" rid="B50">Tsao et&#xa0;al., 2019</xref>). Datta and co-works reported that all SLS operon is required for the functional expression of streptolysin S (<xref ref-type="bibr" rid="B17">Datta et&#xa0;al., 2005</xref>). The loss of <italic>Sag</italic>B-I observed in SDSD isolates from bovine origin is associated with loss of &#x3b2;-hemolytic activity (<xref ref-type="bibr" rid="B2">Alves-Barroco et&#xa0;al., 2021</xref>); however, the <italic>sagA</italic> gene has been maintained in the bovine SDSD genome, which possibly indicates an additional function to the product of this gene (<xref ref-type="bibr" rid="B2">Alves-Barroco et&#xa0;al., 2021</xref>). Some studies suggested that SagA plays an important role in the regulation of several virulence determinants, including M proteins (<xref ref-type="bibr" rid="B17">Datta et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B35">Molloy et&#xa0;al., 2011</xref>). The mechanisms by which <italic>sagA</italic> mRNA regulates virulence in <italic>Streptococcus</italic> have been the subject of investigations. In the present study, a high and significant increase in <italic>sagA</italic> expression was observed <italic>in vivo</italic> for the sessile cells of VSD13 isolate (<xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6D</bold>
</xref>), suggesting that the regulation of <italic>sagA</italic> expression may differ in a strain-specific manner.</p>
<p>The multiple factors that control the interactions between the pathogen and the host is still far from being fully understood. Nonetheless, the animal models provide better knowledge of biofilm within the host context. Importantly, the <italic>in vivo</italic> biofilm growth of SDSD isolates trigger distinct stress pathways that lead to the upregulation of the <italic>brpA</italic>-like, <italic>fbpA, htrA</italic>, and <italic>sagA</italic> genes that may play an important role in the host colonization and infection. Although previous studies suggest that SDSD may have different host preferences (<xref ref-type="bibr" rid="B39">Porcellato et&#xa0;al., 2021</xref>), together, the results presented in the present work suggest that SDSD isolates from bovine origin are able to infect other hosts, and may have a potential zoonotic capability.</p>
</sec>
</sec>
<sec id="s4" sec-type="conclusions">
<title>Conclusions</title>
<p>To the best of our knowledge, the present study demonstrates for the first time in literature the ability of SDSD collected from bovines to form biofilm <italic>in vivo</italic> and suggests that the mechanism underlying biofilm development appears to be multifactorial. Despite that, the increase of <italic>fbpA</italic> transcripts in all sessile cells grown <italic>in vivo</italic> suggest a possible role for fibronectin-binding protein A in biofilm formation/accumulation. Indeed, the number of <italic>brpA</italic>-like gene transcripts was also higher in sessile cells corroborating a role of biofilm regulatory protein A in biofilm modulation of SDSD. Thus, future studies with knockout mutants are important to define exactly the role of each of these genes in biofilm development and SDSD-associated infections. In this work, we demonstrated that the capability of bovine SDSD to develop strong biofilm <italic>in vivo</italic> is independent on the ability to form biofilms <italic>in vitro</italic> on the abiotic surface. Moreover, we also provide data that show that bovine SDSD can form biofilms <italic>ex vivo</italic> on the surface of HEK cells causing important cellular damages. Due to SDSD ability to cause severe zoonotic infections, our data contribute to a better understanding of the role of biofilm accumulation during SDSD colonization and pathogenesis in human skin infections and possibly in bovine mastitis as well. Additional studies are required toward a better understanding of the mechanisms associated with the regulation of biofilm formation by SDSD isolates and the precise role of biofilm development in SDSD infections.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by Centro de Ci&#xea;ncias da Sa&#xfa;de, Universidade Federal do Rio de Janeiro, Brazil (#01200.001568/2013-87- CEAU).</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>AMF and ARF were involved in the study conception and design, coordination, and revision of the final version of the manuscript. CA-B contributed to biofilm formation assay <italic>in vivo</italic> and <italic>in vitro</italic> and analysis of the expression of genes associated with the formation of biofilms, and statistical analysis. CA-B and APM contributed to analysis of SDSD biofilm formation in human keratinocyte cell. CA-B, MA, BF-C and SF contributed to subcutaneous catheter implantation in the animal model. CA-B and MG contributed to biofilm formation on glass and polystyrene assay. CA-B wrote the draft version of the manuscript. All authors read and corrected the manuscript.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported in part by grants # 307672/2019-0 from Conselho Nacional de Desenvolvimento Cient&#xed;fico e Tecnol&#xf3;gico (CNPq); # E-26/200.952/2021, # E-26/010.002435/2019 and # E-26/010.001280 from Funda&#xe7;&#xe3;o de Amparo &#xe0; Pesquisa do Rio de Janeiro (FAPERJ); and # 001 from Coordena&#xe7;&#xe3;o de Aperfei&#xe7;oamento de Pessoal de N&#xed;vel Superior (CAPES). This work is also financed by national funds from FCT - Funda&#xe7;&#xe3;o para a Ci&#xea;ncia e a Tecnologia, I.P., in the scope of the project UIDP/04378/2020 and UIDB/04378/2020 of the Research Unit on Applied Molecular Biosciences - UCIBIO and the project LA/P/0140/2020 of the Associate Laboratory Institute for Health and Bioeconomy - i4HBand also by projects PTDC/CVT-EPI/4651/2012 and PTDC/CVT-EPI/6685/2014. FCT-MEC is also acknowledged for grant SFRH/BD/118350/2016 to CA-B.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdelsalam</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>S. C.</given-names>
</name>
<name>
<surname>Yoshida</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Dissemination of streptococcal pyrogenic exotoxin G (<italic>spegg</italic>) with an IS-like element in fish isolates of <italic>Streptococcus dysgalactiae</italic>
</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>309</volume>, <fpage>105</fpage>&#x2013;<lpage>113</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1574-6968.2010.02024.x</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Ca&#xe7;o</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Roma-Rodrigues</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Fernandes</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Bexiga</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Oliveira</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>New insights on <italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> isolates</article-title>. <source>Front. Microbiol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2021.686413</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Paquete-Ferreira</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Santos-Silva</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Fernandes</surname> <given-names>A. R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Singularities of pyogenic streptococcal biofilms - from formation to health implication</article-title>. <source>Front. Microbiol.</source> <volume>11</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2020.584947</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Rivas-Garc&#xed;a</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Fernandes</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Baptista</surname> <given-names>P. V.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Light triggered enhancement of antibiotic efficacy in biofilm elimination mediated by gold-silver alloy nanoparticles</article-title>. <source>Front. Microbiol.</source> <volume>13</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2022.841124</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Roma-Rodrigues</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Balasubramanian</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Guimar&#xe3;es</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Ferreira-Carvalho</surname> <given-names>B. T.</given-names>
</name>
<name>
<surname>Muthukumaran</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Biofilm development and computational screening for new putative inhibitors of a homolog of the regulatory protein BrpA <italic>in streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic>
</article-title>. <source>IJMM</source> <volume>309</volume> (<issue>3-4</issue>), <fpage>169</fpage>&#x2013;<lpage>181</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.ijmm.2019.02.001</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Roma-Rodrigues</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Raposo</surname> <given-names>L. R.</given-names>
</name>
<name>
<surname>Br&#xe1;s</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Diniz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ca&#xe7;o</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>
<italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> isolated from milk of the bovine udder as emerging pathogens: <italic>In vitro</italic> and <italic>in vivo</italic> infection of human cells and zebrafish as biological models</article-title>. <source>MicrobiologyOpen</source> <volume>8</volume> (<issue>1</issue>), <elocation-id>e00623</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mbo3.623</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitoun</surname> <given-names>J. P.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>G. G.</given-names>
</name>
<name>
<surname>Beatty</surname> <given-names>W. L.</given-names>
</name>
<name>
<surname>Wen</surname> <given-names>Z. T.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Deficiency of BrpB causes major defects in cell division, stress responses and biofilm formation by <italic>Streptococcus mutans</italic>
</article-title>. <source>Microbiol. (Reading England)</source> <volume>160</volume> (<issue>Pt 1</issue>), <fpage>67</fpage>&#x2013;<lpage>78</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/mic.0.072884-0</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bitoun</surname> <given-names>J. P.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Ahn</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Isoda</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Nguyen</surname> <given-names>A. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>BrpA is involved in regulation of cell envelope stress responses in <italic>Streptococcus mutans</italic>
</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>78</volume> (<issue>8</issue>), <fpage>2914</fpage>&#x2013;<lpage>2922</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/AEM.07823-11</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brandt</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Spellerberg</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Human infections due to <italic>Streptococcus dysgalactiae</italic> subspecies <italic>equisimilis</italic>
</article-title>. <source>Clin. Infect. Dis.</source> <volume>49</volume> (<issue>5</issue>), <fpage>766</fpage>&#x2013;<lpage>772</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1086/605085</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cervinkova</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Vlkova</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Borodacova</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Makovcova</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Babak</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Lorencova</surname> <given-names>A</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>Prevalence of mastitis pathogens in milk from clinically healthy cows</article-title>. <source>Vet. Med</source> <volume>58</volume> (<issue>11</issue>), <fpage>567</fpage>&#x2013;<lpage>575</lpage>. doi: <pub-id pub-id-type="doi">10.17221/7138-VETMED</pub-id>
</citation>
</ref> <ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chao</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Bergenfelz</surname> <given-names>C.</given-names>
</name>
<name>
<surname>H&#xe5;kansson</surname> <given-names>A. P.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>
<italic>In vitro</italic> and <italic>in vivo</italic> biofilm formation by pathogenic streptococci</article-title>. <source>Methods Mol. Biol. (Clifton N.J.)</source> <volume>1535</volume>, <fpage>285</fpage>&#x2013;<lpage>299</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-4939-6673-8_19</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chauhan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Ghigo</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Beloin</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Study of <italic>in vivo</italic> catheter biofilm infections using pediatric central venous catheter implanted in rat</article-title>. <source>Nat. Protoc.</source> <volume>11</volume>, <fpage>525</fpage>&#x2013;<lpage>541</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nprot.2016.033</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chennapragada</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Ramphul</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Barnett</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Mejias</surname> <given-names>S. G.</given-names>
</name>
<name>
<surname>Lohana</surname> <given-names>P.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>A rare case of <italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic> human zoonotic infection</article-title>. <source>Cureus</source> <volume>10</volume> (<issue>7</issue>), <elocation-id>e2901</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.7759/cureus.2901</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Collin</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ols&#xe9;n</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Extracellular enzymes with immunomodulating activities: variations on a theme in <italic>Streptococcus pyogenes</italic>
</article-title>. <source>Infect. Immun.</source> <volume>71</volume> (<issue>6</issue>), <fpage>2983</fpage>&#x2013;<lpage>2992</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.71.6.2983-2992.2003</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cue</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Southern</surname> <given-names>S. O.</given-names>
</name>
<name>
<surname>Southern</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Prabhakar</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Lorelli</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Smallheer</surname> <given-names>J. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2000</year>). <article-title>A nonpeptide integrin antagonist can inhibit epithelial cell ingestion of <italic>Streptococcus pyogenes</italic> by blocking formation of integrin alpha 5beta 1-fibronectin-M1 protein complexes</article-title>. <source>PNAS U.S.A.</source> <volume>97</volume> (<issue>6</issue>), <fpage>2858</fpage>&#x2013;<lpage>2863</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1073/pnas.050587897</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cusumano</surname> <given-names>Z. T.</given-names>
</name>
<name>
<surname>Watson</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Caparon</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>
<italic>Streptococcus pyogenes</italic> arginine and citrulline catabolism promotes infection and modulates innate immunity</article-title>. <source>Infect. Immun.</source> <volume>82</volume>, <fpage>233</fpage>&#x2013;<lpage>242</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.00916-13</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Datta</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Myskowski</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Kwinn</surname> <given-names>L. A.</given-names>
</name>
<name>
<surname>Chiem</surname> <given-names>D. N.</given-names>
</name>
<name>
<surname>Varki</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kansal</surname> <given-names>R. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Mutational analysis of the group a streptococcal operon encoding streptolysin s and its virulence role in invasive infection</article-title>. <source>Mol. Microbiol.</source> <volume>56</volume> (<issue>3</issue>), <fpage>681</fpage>&#x2013;<lpage>695</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1365-2958.2005.04583.x</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Diaz-Torres</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Russell</surname> <given-names>R. R. B.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>HtrA protease and processing of extracellular proteins of <italic>Streptococcus mutans</italic>
</article-title>. <source>FEMS Microbiol. Lett.</source> <volume>204</volume>, <fpage>23</fpage>&#x2013;<lpage>28</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0378-1097(01)00374-3</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fernandes</surname> <given-names>A. R.</given-names>
</name>
<name>
<surname>Jesus</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Martins</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Figueiredo</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Rosa</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Martins</surname> <given-names>L. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Multifunctional gold-nanoparticles: A nanovectorization tool for the targeted delivery of novel chemotherapeutic agents</article-title>. <source>J. Control. Release</source> <volume>245</volume>, <fpage>52</fpage>&#x2013;<lpage>61</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jconrel.2016.11.021</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ferreira</surname> <given-names>F. A.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Bonelli</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Am&#xe9;rico</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Fracalanzza</surname> <given-names>S. E. L.</given-names>
</name>
<name>
<surname>Figueiredo</surname> <given-names>A. M. S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Comparison of <italic>in vitro</italic> and <italic>in vivo</italic> systems to study <italic>ica</italic>-independent <italic>Staphylococcus aureus</italic> biofilms</article-title>. <source>J. Microbiol. Methods</source> <volume>88</volume>, <fpage>393</fpage>&#x2013;<lpage>398</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.mimet.2012.01.007</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Flaherty</surname> <given-names>R. A.</given-names>
</name>
<name>
<surname>Puricelli</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Higashi</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>C. J.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>S. W.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Streptolysin s promotes programmed cell death and enhances inflammatory signaling in epithelial keratinocytes during group a <italic>Streptococcus</italic> infection</article-title>. <source>Infect. Immun.</source> <volume>83</volume> (<issue>10</issue>), <fpage>4118</fpage>&#x2013;<lpage>4133</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.00611-15</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Genteluci</surname> <given-names>G. L.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>L. G.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Glatthardt</surname> <given-names>T.</given-names>
</name>
<name>
<surname>de Mattos</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Ejzemberg</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Assessment and characterization of biofilm formation among human isolates of Streptococcus dysgalactiae subsp. equisimilis</article-title>. <source>IJMM</source> <volume>305</volume> (<issue>8</issue>), <fpage>937</fpage>&#x2013;<lpage>947</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijmm.2015.10.004</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garc&#xed;a-P&#xe9;rez</surname> <given-names>B. E.</given-names>
</name>
<name>
<surname>Mondrag&#xf3;n-Flores</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Luna-Herrera</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Internalization of <italic>Mycobacterium tuberculosis</italic> by macropinocytosis in non-phagocytic cells</article-title>. <source>Microb. Pathog.</source> <volume>35</volume>, <fpage>49</fpage>&#x2013;<lpage>55</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0882-4010(03)00089-5</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Genteluci</surname> <given-names>G. L.</given-names>
</name>
<name>
<surname>Silva</surname> <given-names>L. G.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Glatthardt</surname> <given-names>T.</given-names>
</name>
<name>
<surname>de Mattos</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Ejzemberg</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Assessment and characterization of biofilm formation among human isolates of <italic>Streptococcus dysgalactiae</italic> subsp. <italic>equisimilis</italic>
</article-title>. <source>IJMM</source> <volume>305</volume> (<issue>8</issue>), <fpage>937</fpage>&#x2013;<lpage>947</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijmm.2015.10.004</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jamal</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ahmad</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Andleeb</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Jalil</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Imran</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Nawaz</surname> <given-names>M. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Bacterial biofilm and associated infections</article-title>. <source>JCMA</source> <volume>81</volume> (<issue>1</issue>), <fpage>7</fpage>&#x2013;<lpage>11</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcma.2017.07.012</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jordal</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Glambek</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Oppegaard</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Kittang</surname> <given-names>B. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>New tricks from an old cow: Infective endocarditis caused by <italic>Streptococcus dysgalactiae</italic> subsp. <italic>dysgalactiae</italic>
</article-title>. <source>J. Clin. Microbiol.</source> <volume>53</volume>, <fpage>731</fpage>&#x2013;<lpage>734</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/JCM.02437-14</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>D. Y.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>K. K.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Structure and function of HtrA family proteins, the key players in protein quality control. journal of biochemistry and molecular biology</article-title>. <source>J. Biochem. Mol. Biol.</source> <volume>38</volume> (<issue>3</issue>), <fpage>266</fpage>&#x2013;<lpage>274</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5483/bmbrep.2005.38.3.266</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kissoyan</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Bazzi</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Hadi</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Matar</surname> <given-names>G. M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The inhibition of <italic>Pseudomonas aeruginosa</italic> biofilm formation by micafungin and the enhancement of antimicrobial agent effectiveness in BALB/c mice</article-title>. <source>Biofouling</source> <volume>32</volume> (<issue>7</issue>), <fpage>779</fpage>&#x2013;<lpage>786</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1080/08927014.2016.1199021</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Koh</surname> <given-names>T. H.</given-names>
</name>
<name>
<surname>Sng</surname> <given-names>L. H.</given-names>
</name>
<name>
<surname>Yuen</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Thomas</surname> <given-names>C. K.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>P. L.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>S. H.</given-names>
</name>
<etal/>
</person-group> (<year>2009</year>). <article-title> Streptococcal cellulitis following preparation of fresh raw seafood</article-title>. <source>Zoonoses Public Health</source> <volume>56</volume> (<issue>4</issue>), <fpage>206</fpage>&#x2013;<lpage>208</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1863-2378.2008.01213.x</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kumar</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Alam</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Rani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ehtesham</surname> <given-names>N. Z.</given-names>
</name>
<name>
<surname>Hasnain</surname> <given-names>S. E.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Biofilms: Survival and defense strategy for pathogens</article-title>. <source>Int. J. Med. Microbiol.</source> <volume>307</volume>, <fpage>481</fpage>&#x2013;<lpage>489</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijmm.2017.09.016</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lebeaux</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Chauhan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Rendueles</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Beloin</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>From <italic>in vitro</italic> to <italic>in vivo</italic> models of bacterial biofilm-related infections</article-title>. <source>Pathogens</source> <volume>2</volume> (<issue>2</issue>), <fpage>288</fpage>&#x2013;<lpage>356</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/pathogens2020288</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lyon</surname> <given-names>W. R.</given-names>
</name>
<name>
<surname>Caparon</surname> <given-names>M. G.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Role for serine protease HtrA (DegP) of <italic>Streptococcus pyogenes</italic> in the biogenesis of virulence factors SpeB and the hemolysin streptolysin s</article-title>. <source>Infect. Immun.</source> <volume>72</volume> (<issue>3</issue>), <fpage>1618</fpage>&#x2013;<lpage>1625</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.72.3.1618-1625.2004</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marks</surname> <given-names>L. R.</given-names>
</name>
<name>
<surname>Mashburn-Warren</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Federle</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Hakansson</surname> <given-names>A. P.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>
<italic>Streptococcus pyogenes</italic> biofilm growth <italic>in vitro</italic> and <italic>in vivo</italic> and its role in colonization, virulence, and genetic exchange</article-title>. <source>J. Infect. Dis.</source> <volume>210</volume> (<issue>1</issue>), <fpage>25</fpage>&#x2013;<lpage>34</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/infdis/jiu058</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matsue</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ogura</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Sugiyama</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Miyoshi-Akiyama</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Takemori-Sakai</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Iwata</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Pathogenicity characterization of prevalent-type <italic>Streptococcus dysgalactiae</italic> subsp. <italic>equisimilis</italic> strains</article-title>. <source>Front. Microbiol.</source> <volume>11</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2020.00097</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Molloy</surname> <given-names>E. M.</given-names>
</name>
<name>
<surname>Cotter</surname> <given-names>P. D.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Mitchell</surname> <given-names>D. A.</given-names>
</name>
<name>
<surname>Ross</surname> <given-names>R. P.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Streptolysin s-like virulence factors: The continuing <italic>sagA</italic>
</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>9</volume>, <fpage>670</fpage>&#x2013;<lpage>681</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrmicro2624</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nathan</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Pillai</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Ayyan</surname> <given-names>S. M.</given-names>
</name>
<name>
<surname>Ss</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Prakash Raju</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>
<italic>Streptococcus dysgalactiae</italic> subspecies <italic>dysgalactiae</italic> infection presenting with septic shock</article-title>. <source>Cureus</source> <volume>13</volume> (<issue>1</issue>), <elocation-id>e12465</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.7759/cureus.12465</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>O'Neill</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Humphreys</surname> <given-names>H.</given-names>
</name>
<name>
<surname>O'Gara</surname> <given-names>J. P.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Carriage of both the <italic>fnbA</italic> and <italic>fnbB</italic> genes and growth at 37 degrees c promote FnBP-mediated biofilm development in meticillin-resistant <italic>Staphylococcus aureus</italic> clinical isolates</article-title>. <source>J. Med. Microbiol.</source> <volume>58</volume> (<issue>Pt 4</issue>), <fpage>399</fpage>&#x2013;<lpage>402</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1099/jmm.0.005504-0</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Park</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Eun</surname> <given-names>I. S.</given-names>
</name>
<name>
<surname>Jung</surname> <given-names>C. Y.</given-names>
</name>
<name>
<surname>Ko</surname> <given-names>Y. C.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>Y. J.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>C. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>
<italic>Streptococcus dysgalactiae</italic> subspecies <italic>dysgalactiae</italic> infection after total knee arthroplasty: a case report</article-title>. <source>Knee Surg. Relat. Res.</source> <volume>24</volume>, <fpage>120</fpage>&#x2013;<lpage>123</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.5792/ksrr.2012.24.2.120</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Porcellato</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Smistad</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Skeie</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>J&#xf8;rgensen</surname> <given-names>H. J.</given-names>
</name>
<name>
<surname>Austb&#xf8;</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Oppegaard</surname> <given-names>O.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Whole genome sequencing reveals possible host species adaptation of <italic>Streptococcus dysgalactiae</italic>
</article-title>. <source>Sci. Rep</source> <volume>11</volume>, <fpage>1</fpage>&#x2013;<lpage>13</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-021-96710-z</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Prabhakara</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Harro</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Leid</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Keegan</surname> <given-names>A. D.</given-names>
</name>
<name>
<surname>Prior</surname> <given-names>M. L.</given-names>
</name>
<name>
<surname>Shirtliff</surname> <given-names>M. E.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Suppression of the inflammatory immune response prevents the development of chronic biofilm infection due to methicillin-resistant <italic>Staphylococcus aureus</italic>
</article-title>. <source>Infect. Immun.</source> <volume>79</volume> (<issue>12</issue>), <fpage>5010</fpage>&#x2013;<lpage>5018</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/IAI.05571-11</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Proetzel</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Wiles</surname> <given-names>M. V.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Mouse models for drug discovery</article-title>. <source>Methods Protoc.</source> <volume>602</volume>, <fpage>395</fpage>&#x2013;<lpage>403</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/978-1-60761-058-8</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rato</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Bexiga</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Florindo</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Cavaco</surname> <given-names>L. M.</given-names>
</name>
<name>
<surname>Vilela</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Santos-Sanches</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Antimicrobial resistance and molecular epidemiology of streptococci from bovine mastitis</article-title>. <source>Vet. Microbiol.</source> <volume>161</volume>, <fpage>286</fpage>&#x2013;<lpage>294</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.vetmic.2012.07.043</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roma-Rodrigues</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Alves-Barroco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Raposo</surname> <given-names>L. R.</given-names>
</name>
<name>
<surname>Costa</surname> <given-names>M. N.</given-names>
</name>
<name>
<surname>Fortunato</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Baptista</surname> <given-names>P. V.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Infection of human keratinocytes by <italic>Streptococcus dysgalactiae</italic> subspecies <italic>dysgalactiae</italic> isolated from milk of the bovine udder</article-title>. <source>Microbes Infect</source> <volume>18</volume> (<issue>4</issue>), <fpage>290</fpage>&#x2013;<lpage>293</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micinf.2015.11.005</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ronin</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Boyer</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Alban</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Natoli</surname> <given-names>R. M.</given-names>
</name>
<name>
<surname>Johnson</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kjellerup</surname> <given-names>B. V.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Current and novel diagnostics for orthopedic implant biofilm infections: a review</article-title>. <source>APMIS</source> <volume>130</volume> (<issue>2</issue>), <fpage>59</fpage>&#x2013;<lpage>81</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/apm.13197</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>See</surname> <given-names>J. X.</given-names>
</name>
<name>
<surname>Samudi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Saeidi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Menon</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Choh</surname> <given-names>L. C.</given-names>
</name>
<name>
<surname>Vadivelu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Experimental persistent infection of BALB/c mice with small-colony variants of <italic>Burkholderia pseudomallei</italic> leads to concurrent upregulation of PD-1 on T cells and skewed Th1 and Th17 responses</article-title>. <source>PloS Negl. Trop. Dis.</source> <volume>10</volume> (<issue>3</issue>), <elocation-id>e0004503</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pntd.0004503</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Siemens</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kittang</surname> <given-names>B. R.</given-names>
</name>
<name>
<surname>Chakrakodi</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Oppegaard</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Johansson</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Bruun</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Increased cytotoxicity and streptolysin O activity in group G streptococcal strains causing invasive tissue infections</article-title>. <source>Sci. Rep.</source> <volume>5</volume>, <fpage>1</fpage>&#x2013;<lpage>12</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/srep16945</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>&#x160;mitran</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Vukovi&#x107;</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Opavski</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Gaji&#x107;</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Marinkovi&#x107;</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bo&#x17e;i&#x107;</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Influence of subinhibitory antibiotic concentration on <italic>Streptococcus pyogenes</italic> adherence and biofilm production</article-title>. <source>Acta Microbiol. Immunol. Hung</source> <volume>65</volume> (<issue>2</issue>), <fpage>229</fpage>&#x2013;<lpage>240</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1556/030.65.2018.026</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Speziale</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Pietrocola</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Foster</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Geoghegan</surname> <given-names>J. A.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Protein-based biofilm matrices in staphylococci</article-title>. <source>Front. Cell Infect. Microbiol.</source> <volume>4</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2014.00171</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tr&#xf8;strup</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Thomsen</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Christophersen</surname> <given-names>L. J.</given-names>
</name>
<name>
<surname>Hougen</surname> <given-names>H. P.</given-names>
</name>
<name>
<surname>Bjarnsholt</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Jensen</surname> <given-names>P.&#xd8;.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>
<italic>Pseudomonas aeruginosa</italic> biofilm aggravates skin inflammatory response in BALB/c mice in a novel chronic wound model</article-title>. <source>Tissue Repair Soc.</source> <volume>21</volume> (<issue>2</issue>), <fpage>292</fpage>&#x2013;<lpage>299</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/wrr.12016</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsao</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Kuo</surname> <given-names>C. F.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>W. C.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>C. F.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>Y. S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Streptolysin s induces mitochondrial damage and macrophage death through inhibiting degradation of glycogen synthase kinase-3&#x3b2; in <italic>Streptococcus pyogenes</italic> infection</article-title>. <source>Sci. Rep.</source> <volume>9</volume> (<issue>1</issue>), <fpage>5371</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41598-019-41853-3</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vajjala</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Biswas</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Tay</surname> <given-names>W. H.</given-names>
</name>
<name>
<surname>Hanski</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Kline</surname> <given-names>K. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Streptolysin-induced endoplasmic reticulum stress promotes group a streptococcal host-associated biofilm formation and necrotising fasciitis</article-title>. <source>Cell. Microbiol.</source> <volume>21</volume> (<issue>1</issue>), <elocation-id>e12956</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/cmi.12956</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>K. Z.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>Z. Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J. J.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>2-tert-Butyl-1,4-benzoquinone, a food additive oxidant, reduces virulence factors of <italic>Chromobacterium violaceum</italic>
</article-title>. <source>LWT-Food Sci. Technol.</source> <volume>163</volume>, <elocation-id>113569</elocation-id>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.lwt.2022.113569</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zadoks</surname> <given-names>R. N.</given-names>
</name>
<name>
<surname>Middleton</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>McDougall</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Katholm</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Schukken</surname> <given-names>Y. H.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans</article-title>. <source>J. Mammary Gland Biol. Neoplasia</source> <volume>16</volume>, <fpage>357</fpage>&#x2013;<lpage>372</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s10911-011-9236-y</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>