<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2022.793335</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Expansion of Intestinal Secretory Cell Population Induced by <italic>Listeria monocytogenes</italic> Infection: Accompanied With the Inhibition of NOTCH Pathway</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Zhou</surname>
<given-names>Cong</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/1511194"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Yuanyuan</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bassey</surname>
<given-names>Anthony</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/1516799"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Huang</surname>
<given-names>Jie</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/868961"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zou</surname>
<given-names>Yafang</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ye</surname>
<given-names>Keping</given-names>
</name>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/425908"/>
</contrib>
</contrib-group>
<aff id="aff1">
<institution>National Centre of Meat Quality and Safety Control, Jiangsu Collaborative Innovation Center of Meat Production and Processing, Quality and Safety Control, College of Food Science and Technology, Nanjing Agricultural University</institution>, <addr-line>Nanjing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Qingli Dong, University of Shanghai for Science and Technology, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Qun Sun, Sichuan University, China; George-John Nychas, Agricultural University of Athens, Greece</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Keping Ye, <email xlink:href="mailto:yekeping.arc@163.com">yekeping.arc@163.com</email>
</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Molecular Bacterial Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>25</day>
<month>03</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>12</volume>
<elocation-id>793335</elocation-id>
<history>
<date date-type="received">
<day>12</day>
<month>10</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>04</day>
<month>03</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Zhou, Zhang, Bassey, Huang, Zou and Ye</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Zhou, Zhang, Bassey, Huang, Zou and Ye</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Listeria monocytogenes</italic>, as a model organism, is a causative agent of enteric pathogen that causes systemic infection. However, the interaction of <italic>L. monocytogenes</italic> and small intestinal epithelium has not been fully elucidated yet. In this study, mice and intestinal organoids were chosen as the models to investigate the influence of <italic>L. monocytogenes</italic> infection on the intestinal secretory cells and its differentiation-related pathways. Results confirmed the phenomenon of intestinal damage that <italic>L. monocytogenes</italic> infection could lead to villi damage in mice, which was accompanied by the increase of TNF-&#x3b1; production in jejunum as well as lipopolysaccharide (LPS) secretion in serum. Moreover, it was demonstrated that <italic>L. monocytogenes</italic> infection increased the number of goblet and Paneth cells in mice and intestinal organoids and upregulated the expression of <italic>Muc2</italic> and <italic>Lyz</italic>. Furthermore, <italic>L. monocytogenes</italic> decreased the relative expression of Notch pathway-related genes (<italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Notch1</italic>, and <italic>Hes1</italic>) while upregulating the relative expression of <italic>Math1</italic> gene in mice and intestinal organoids. This indicated that <italic>L.&#xa0;monocytogenes</italic> infection caused the inhibition of Notch pathway, which may be the reason for the increased number of goblet and Paneth cells in the intestine. Collectively, these results are expected to provide more information on the mechanism of <italic>L.&#xa0;monocytogene</italic>s infection in the intestine.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Listeria monocytogenes</italic>
</kwd>
<kwd>intestine</kwd>
<kwd>goblet cell</kwd>
<kwd>Paneth cell</kwd>
<kwd>notch pathway</kwd>
</kwd-group>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<counts>
<fig-count count="5"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="34"/>
<page-count count="9"/>
<word-count count="3873"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>
<italic>Listeria monocytogenes</italic> is a major foodborne pathogen that causes listeriosis and has a high mortality rate ranging from 20 to 30% (<xref ref-type="bibr" rid="B6">de Noordhout et&#xa0;al., 2014</xref>). Its severity is attributed to the fact that it can cross the intestinal, placental, and blood-brain barriers in immunocompromised individuals, inducing gastroenteritis, abortions, and meningitis (<xref ref-type="bibr" rid="B8">Doganay, 2003</xref>).</p>
<p>As the first defense barrier, the intestine plays a vital role in <italic>L. monocytogenes</italic> defense (<xref ref-type="bibr" rid="B10">Gahan and Hill, 2014</xref>; <xref ref-type="bibr" rid="B2">Becattini and Pamer, 2018</xref>). Under normal conditions, mucosal epithelial cells, mucus-secreting cells, and immune cells form a protective barrier against invading pathogens (<xref ref-type="bibr" rid="B20">Ruch and Engel, 2017</xref>). Related studies mainly focused on the protective effects of immune cells during <italic>L. monocytogenes</italic> infection (<xref ref-type="bibr" rid="B4">Cho et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B28">Wilharm et&#xa0;al., 2021</xref>). However, the intestinal epithelial cells compose numerous cell types that help maintain intestinal homeostasis and defend against enteric pathogen invasion. Specifically, goblet cells can produce mucin glycoproteins and form mucus, and Paneth cells, at the bottom of intestinal crypts, can secret antimicrobial peptides (AMPs). It had been found that <italic>L. monocytogenes</italic> could damage intestinal homeostasis and affect the differentiation of intestinal epithelial cells. A study on intestinal infection by <italic>L. monocytogenes</italic> demonstrated a significant effect on the differentiation of epithelial cells by increasing the number of goblet cells in mice (<xref ref-type="bibr" rid="B16">Pian et&#xa0;al., 2020</xref>). In addition, it was reported that the counts of Paneth cells in organoids decreased after <italic>L. monocytogenes</italic> infection for 1&#xa0;h but increased after infection for 18&#xa0;h through the regulation of Wnt signaling pathway (<xref ref-type="bibr" rid="B12">Huang et&#xa0;al., 2021</xref>). Therefore, these studies indicated that the differentiation of epithelial cells, especially the secretory cells, could be affected by bacteria invasion <italic>in vivo</italic> or <italic>in vitro</italic>.</p>
<p>In literature, the proliferation and differentiation of intestinal epithelial cells were confirmed to be regulated by a variety of signaling pathways, such as Wnt, EGF, BMP, and Notch signaling pathways (<xref ref-type="bibr" rid="B5">Date and Sato, 2015</xref>). Among them, the Notch signaling pathway played a crucial role in regulating the differentiation of intestinal secretory cells, such as goblet and Paneth cells. Recently, some studies have demonstrated that mice exposed to Cadmium or <italic>Salmonella</italic> infection led to a loss of goblet cells through the activation of Notch-signaling pathway (<xref ref-type="bibr" rid="B31">Wu et&#xa0;al., 2018</xref>; <xref ref-type="bibr" rid="B32">Xie et&#xa0;al., 2020</xref>). Conversely, blockade of the Notch pathway using &#x3b3;-secretase inhibitors led to the conversion of all intestinal epithelial cells into goblet cells (<xref ref-type="bibr" rid="B30">Wong et&#xa0;al., 2004</xref>; <xref ref-type="bibr" rid="B24">van der Flier and Clevers, 2009</xref>). These studies indicated that the Notch signaling pathway regulated the differentiation of secretory cells under physiological and pathological conditions. However, researches on the influence of intestinal infection caused by <italic>L. monocytogenes</italic> on the Notch pathway are insufficient.</p>
<p>Animals and cells models are often used to investigate the infection mechanism of the enteric pathogens in the intestine.&#xa0;However, most traditional intestinal cell models have&#xa0;immortalized 2-D cell lines, such as Caco-2 cells containing&#xa0;a&#xa0;single cell type, which cannot reproduce some characteristics&#xa0;of&#xa0;natural infection (<xref ref-type="bibr" rid="B29">Wilson et&#xa0;al., 2015</xref>). Recently, intestinal&#xa0;organoids were served as a more effective model to study&#xa0;pathogen-host interactions (<xref ref-type="bibr" rid="B11">Hill and Spence, 2017</xref>). In contrast to traditional cell lines, intestinal organoids occupied 3-dimensional space. They formed complex microenvironments that facilitated differentiation and persistence of epithelial subtypes and the formation of villus-like structures, comprised of Paneth cells, Goblet cells, enterocytes, enteroendocrine cells, and stem cells (<xref ref-type="bibr" rid="B27">Watson et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B9">Finkbeiner et&#xa0;al., 2015</xref>). In addition, it was reported that intestinal organoids were used to visualize the invasiveness of <italic>Salmonella</italic> and the morphologic changes of the organoids (<xref ref-type="bibr" rid="B34">Zhang et&#xa0;al., 2014</xref>). And intestinal organoids also were used to model the infection of <italic>L. monocytogenes</italic> (<xref ref-type="bibr" rid="B12">Huang et&#xa0;al., 2021</xref>), and pathogenic <italic>Escherichia coli</italic> strains (<xref ref-type="bibr" rid="B25">Vandussen et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B18">Rajan et&#xa0;al., 2018</xref>), which provided important insights into the pathogenesis of the intestine.</p>
<p>Therefore, in this study, mice and intestinal organoids were used to establish an invasion model of <italic>L. monocytogenes</italic> to explore its influence on the differentiation of secretory cells and differentiation-related Notch pathway, which will provide more information on the mechanism of <italic>L. monocytogenes</italic> infection in the intestine.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>2 Materials and Methods</title>
<sec id="s2_1">
<title>2.1 Bacterial Strain Culture</title>
<p>The <italic>L. monocytogenes</italic> 10403s strain used in this study was supplied by Prof. Weihuan Fang (Zhejiang University). <italic>L. monocytogenes</italic> 10403s was grown in brain heart infusion (BHI) broth supplemented with 5 &#x3bc;g/ml erythromycin for 16&#xa0;h at 37&#xb0;C with shaking (180 rpm).</p>
</sec>
<sec id="s2_2">
<title>2.2 Animals and Intestinal Organoids</title>
<sec id="s2_2_1">
<title>2.2.1 Animals</title>
<p>Twenty-four C57BL/6 mice (4 weeks old, specific-pathogen-free (SPF) female) were purchased from the Animal Research Centre of Yang Zhou University. All animals were randomly divided into two groups and orally administrated sterile PBS (control group, CK, n=6) and <italic>L. monocytogenes</italic> 10403s (10<sup>9</sup> CFU/ml, LM, n=18). The mice were sacrificed on day 4, and tissue samples were collected for further analysis. All animal studies were approved by the Nanjing Agriculture University Committee on Animal Resources Committee and the National Institutes of Health guidelines for the performance of animal experiments.</p>
</sec>
<sec id="s2_2_2">
<title>2.2.2 Intestinal Organoids</title>
<sec id="s2_2_2_1">
<title>2.2.2.1 Isolation and Culture of Intestinal Organoids</title>
<p>Intestinal organoids were isolated from the small intestine of 4-week-old SPF C57/BL6 mice. The intestine samples were cleaned with phosphate-buffer saline (PBS) and cut into small pieces. After that, Gentle Cell Dissociation Reagent (Stem Cell, Canada) was added, and the mixture was digested at 20&#xb0;C for 15&#xa0;min. After incubation, crypts were filtered through a 70-&#x3bc;m sterile cell strainer and centrifuged at 300&#xa0;g for 5&#xa0;min at 4&#xb0;C. The cells were resuspended by Matrigel (Corning, USA) and IntestiCult&#x2122; OGM Mouse Basal Medium (Stem cell, Canada) and then plated in 24-well plates. The plates were polymerized at 37&#xb0;C for 20&#xa0;min before the addition of culture medium. The medium was changed every 2-3 days.</p>
</sec>
<sec id="s2_2_2_2">
<title>2.2.2.2 L. Monocytogenes Infection of Organoid Cells</title>
<p>The methods of organoids infection were referenced from Huang et&#xa0;al. (<xref ref-type="bibr" rid="B12">Huang et&#xa0;al., 2021</xref>) with some modifications. Firstly, <italic>L.&#xa0;monocytogenes</italic> culture was centrifuged at 5000 rpm for 5&#xa0;min and washed with PBS, before being resuspended in culture medium to 10<sup>8</sup> CFU/ml. After removing the Matrigel with cold PBS, organoids were pipetted up and down and were resuspended in culture medium for 1&#xa0;h. Subsequently, the organoids were reseeded with Matrigel and cultured with medium containing gentamicin (100 &#x3bc;g/ml, Gbico) for 18&#xa0;h.</p>
</sec>
</sec>
</sec>
<sec id="s2_3">
<title>2.3 The Location of <italic>L. monocytogenes</italic> in Organoids</title>
<p>After centrifugation at 5000rpm for 5min, the collected bacteria were washed once with 1&#xa0;ml 0.1M NaHCO<sub>3</sub>, re-suspended in a solution containing 0.2 mg/mL fluoresceine isothiocyanate (FITC) dissolved in 0.1M NaHCO<sub>3</sub> and incubated in the dark at 37&#xb0;C for 1h. The FITC labeled bacteria were washed twice with PBS and the concentration was set to obtain 10<sup>8</sup> CFU/mL. Then the labeled bacteria were used to infect crypts before the following steps, and observed in organoids by using a Leica DMi8 Laser Scanning confocal microscope.</p>
</sec>
<sec id="s2_4">
<title>2.4 Morphology of Intestine Tissue</title>
<p>To observe the pathological change of the intestine, the intestinal tissue was fixed in 4% paraformaldehyde for 24&#xa0;h, dehydrated in ethanol (for 1h in 70%, 80%, 90%, and 100%, respectively), xylene for 40 s, and embedded in paraffin wax. The paraffin blocks were cut to a thickness of 5 microns and stained with hematoxylin-eosin (H&amp;E) staining.</p>
</sec>
<sec id="s2_5">
<title>2.5 ELISA</title>
<p>The production of TNF-&#x3b1; was analyzed with Mouse TNF-&#x3b1; ELISA kits (NeoBioscience, China), and Lipopolysaccharide (LPS) was measured with LPS ELISA kits (NeoBioscience, China) according to the manufacturer&#x2019;s protocols.</p>
</sec>
<sec id="s2_6">
<title>2.5 Real-Time Quantitative PCR</title>
<p>Total RNA of tissue and organoid samples was extracted using TRIzol (Ambion, USA), after which reverse transcription PCR was performed. Using the primers (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>), 1 &#x3bc;L of template cDNA was reacted with a master mix in a final volume of 10 &#x3bc;L. The thermal cycling procedure was 30 s at 95&#xb0;C, followed by 40 cycles of 10 s at 95&#xb0;C and 30 s at 60&#xb0;C using an Applied Biosystems 7500 real-time PCR system.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primer sequences used for RT-qPCR.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Target genes</th>
<th valign="top" align="center">Primer sense (5&#x2019;-3&#x2019;)</th>
<th valign="top" align="center">Primer antisense (5&#x2019;-3&#x2019;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>Jag1</italic>
</td>
<td valign="top" align="left">AGTGGCTTGGGTCTGTTGCTTGGT</td>
<td valign="top" align="left">CATTGTTGGTGGTGTTGTCCTCGGG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Dll4</italic>
</td>
<td valign="top" align="left">TTCCAGGCAACCTTCTCCGA</td>
<td valign="top" align="left">ACTGCCGCTATTCTTGTCCC</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Notch1</italic>
</td>
<td valign="top" align="left">CTTGCCAGGTTTTGCTGGAC</td>
<td valign="top" align="left">CTTTGCCGTTGACAGGGTTG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Lyz</italic>
</td>
<td valign="top" align="left">GAGACCGAAGCACCGACTATG</td>
<td valign="top" align="left">CGGTTTTGACATTGTGTTCGC</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Muc2</italic>
</td>
<td valign="top" align="left">ACGATGCCTACACCAAGGTC</td>
<td valign="top" align="left">TGATCTTTACATGTTCCCA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>GAPDH</italic>
</td>
<td valign="top" align="left">ATGGTGAAGGTCGGTGTGAA</td>
<td valign="top" align="left">TGGAAGATGGTGATGGGCTT</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_7">
<title>2.6 Immunofluorescence Assay</title>
<p>Intestinal tissue slides were deparaffinized with xylene and rehydrated with an alcohol gradient. To enhance immunoreactivity, the slides were incubated in 10 mM sodium citrate for 15&#xa0;min at 95&#xb0;C. Then the slides were cooled to room temperature, washed in PBS for 5&#xa0;min (five times in total), blocked for 2&#xa0;h with 5% Bovine Serum Albumin (BSA), and incubated for 2&#xa0;h with Ulex europaeus agglutinin-1 (UEA-1). Finally, 4&#x2032;,6-diamidino-2-phenylindole(DAPI)was used to counterstain nuclei. For lysozyme (Lyz) staining, cells were stained with anti-rabbit lysozyme antibody (1:200, Abcam) overnight at 4&#xb0;C. The samples were incubated with goat anti-rabbit to Alexa Fluor 594 (1:250, Abcam) for 90&#xa0;min, followed by DAPI for 5&#xa0;min at room temperature. For <italic>in vitro</italic> imaging, infected organoids were embedded in Matrigel on glass chamber slides. The 0.5% Triton X-100 was used for 20&#xa0;min to permeabilize the cells. Thereafter, the slides were washed with PBS three times and incubated for 1&#xa0;h in 5% BSA. Subsequently, UEA-1 and Lyz were used to visualize goblet cells and Paneth cells in organoids, respectively, and the staining was observed with a Leica DMi8 Laser Scanning confocal microscope (Leica, Germany).</p>
</sec>
<sec id="s2_8">
<title>2.7 Western Blot</title>
<p>Tissue and cell samples were lysed in RIPA buffer containing a protease inhibitor cocktail. Protein concentration in the lysed sample was detected using a bicinchoninic acid (BCA) assay kit (Thermo Scientific, USA). After that, samples containing 5&#xd7; load buffer were heated for 5&#xa0;min at 95&#xb0;C. Equal amounts of protein were separated by 4-20% SDS-PAGE, and transferred to PVDF membranes (BIO-RAD, USA). Then, the membranes were blocked with 5% non-fat milk in TBS with 0.1% Tween-20 for 1&#xa0;h and incubated with rabbit anti-GAPDH (Abcam, 1:10000), rabbit anti-lysozyme (Abcam,1:1000) overnight, respectively. After the washing, goat anti-rabbit secondary antibodies (Bioss, 1:1500) were used to incubate the membranes. Finally, the optical protein bands were developed using efficient chemiluminescence (ECL) kit, and light emission was captured using the Versa DOC 4000 imaging system.</p>
</sec>
<sec id="s2_9">
<title>2.8 Statistical Analysis</title>
<p>All statistical analyses were performed using GraphPad Prism 7.&#xa0;A t-test was employed to determine the significant difference between the two groups. The significance levels were shown as *<italic>P &lt;</italic> 0.05, **<italic>P &lt;</italic> 0.01 and ***<italic>P &lt;</italic> 0.001. Data were combined from at least three independent experiments unless otherwise stated and expressed as means &#xb1; SD.</p>
</sec>
</sec>
<sec id="s3">
<title>3 Results</title>
<sec id="s3_1">
<title>3.1 The Intestinal Pathological Changes in Mice After <italic>L. monocytogenes</italic> Infection</title>
<p>Compared with the control group, <italic>L. monocytogenes</italic> infection led to the disorder of intestinal villi in the jejunum (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). Moreover, after <italic>L. monocytogenes</italic> infection, the concentration of LPS in the serum of mice increased significantly (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1C</bold>
</xref> showed that the protein expression level of TNF-&#x3b1; in the jejunum was significantly higher than that in the control group. These results confirmed that <italic>L. monocytogenes</italic> infection could lead to intestinal pathological changes in mice.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>The intestinal pathological changes in mice after <italic>L. monocytogenes</italic> infection. CK, control, orally challenge with PBS; LM, <italic>L. monocytogenes</italic>-infected group. <bold>(A)</bold> Histopathological changes in jejunum tissues were examined by hematoxylin eosin (HE) staining. <bold>(B)</bold> The concentration of LPS was measured in serum. <bold>(C)</bold> The concentration of TNF-&#x3b1; was measured in jejunum. Data is presented as mean &#xb1; SD. **<italic>P &lt;</italic> 0.01. Data combined from at least three independent experiments unless otherwise stated.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-793335-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>3.2 The Influence of <italic>L. monocytogenes</italic> on Goblet and Paneth Cells in Mice</title>
<p>Intestinal secretory cells, such as goblet and Paneth cells, could protect the mucosal barrier and defend against <italic>L. monocytogenes</italic> invasion. The immunofluorescence assay results showed that the oral administration of <italic>L. monocytogenes</italic> could increase the number of goblet cells stained with UEA-1 (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2A</bold>
</xref>) and increase the relative expression level of <italic>Muc2</italic> gene significantly in the jejunum of mice (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Additionally, the number of Paneth cells stained with <italic>Lyz</italic> was significantly increased through immunofluorescence analysis (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2B</bold>
</xref>). The protein and mRNA expression levels of <italic>Lyz</italic> were also upregulated to 3.08-fold and 1.79-fold after <italic>L. monocytogenes</italic> infection, respectively (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2C, E</bold>
</xref>). These results indicated that <italic>L. monocytogenes</italic> caused the abnormal increase of goblet and Paneth cells in the jejunum of mice.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>The influence of <italic>L. monocytogenes</italic> on the differentiation of intestinal secretory cells in mice. CK, control, orally challenge with PBS; LM, <italic>L. monocytogenes</italic>-infected group. <bold>(A)</bold> Confocal microscopy analysis of mucus stained with UEA-1 in jejunum sections. <bold>(B)</bold> Confocal microscopy analysis of lysozyme in jejunum sections. <bold>(C)</bold> Western blot of lysozyme in jejunum. <bold>(D)</bold> mRNA levels of <italic>Muc2</italic> from homogenized jejunum samples. <bold>(E)</bold> mRNA levels of <italic>Lyz</italic> from homogenized jejunum samples. Data is presented as mean &#xb1; SD. *<italic>P &lt;</italic> 0.05, **<italic>P &lt;</italic> 0.01. Data combined from at least three independent experiments unless otherwise stated.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-793335-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>3.3 The Influence of <italic>L. monocytogenes</italic> on the Notch Signaling Pathway in Mice</title>
<p>The differentiation of intestinal secretory cells was regulated by the Notch signaling pathway, where <italic>Dll4</italic> and <italic>Jag1</italic> are two Notch ligands that regulate the expression of the Notch target gene, <italic>Hes1</italic>. The relative expression of the genes showed that the mRNA relative expression of <italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Notch1</italic>, and <italic>Hes1</italic> were down-regulated to 0.57-fold, 0.66-fold, 0.92-fold, and 0.64-fold, respectively (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A-D</bold>
</xref>). Additionally, the relative expression of <italic>Math1</italic> gene in the jejunum, which governs the differentiation of goblet and Paneth cells, was significantly increased after <italic>L. monocytogenes</italic> infection (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3E</bold>
</xref>). These results indicated that <italic>L. monocytogenes</italic> infection could inhibit the Notch signaling pathway, which may be the reason for the increase in the number of goblet and Paneth cells in mice.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>The influence of <italic>L. monocytogenes</italic> on the Notch pathway in mice. CK, control, orally challenged with PBS; LM, <italic>L. monocytogenes</italic>-infected group. <bold>(A-E)</bold> The expression of <italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Notch1</italic>, <italic>Hes1</italic> and <italic>Math1</italic> genes were determined by quantitative RT-PCR and normalized by the expression of <italic>GAPDH</italic>. Data is presented as mean &#xb1; SD. *<italic>P &lt;</italic> 0.05, **<italic>P &lt;</italic> 0.01. Data combined from at least three independent experiments unless otherwise stated.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-793335-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>3.4 The Influence of <italic>L. monocytogenes</italic> on Intestinal Secretory Cell Differentiation and Notch Signaling Pathway in Organoids</title>
<p>Intestinal organoids, as an <italic>in vitro</italic> model, were used to verify the influence of <italic>L. monocytogenes</italic> on intestinal secretory cell differentiation. <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4A</bold>
</xref> showed that the FITC-labeled <italic>L. monocytogenes</italic> were observed in organoids, which indicated that <italic>L. monocytogenes</italic> could invade in organoids after 18h co-culture. In addition, results showed that <italic>L. monocytogenes</italic> infection increased the number of UEA-1<sup>+</sup> cells (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4B</bold>
</xref>) and markedly increased <italic>Muc2</italic> expression (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4E</bold>
</xref>). Furthermore, the number of Lyz<sup>+</sup> cells were increased (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4C</bold>
</xref>), and the mRNA and protein expression of Lyz were increased significantly after <italic>L. monocytogenes</italic> infection (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4D, F</bold>
</xref>), which indicated that <italic>L. monocytogenes</italic> infection increased the Paneth cells of organoids. Also, <italic>L. monocytogenes</italic> significantly decreased the relative expression of <italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Notch1</italic>, and <italic>Hes1</italic> genes and upregulated the relative expression of <italic>Math1</italic> gene in organoids (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A-E</bold>
</xref>). Overall, the results of organoids further confirmed those of mice findings, which also indicated that the inhibition of Notch signaling pathway during <italic>L. monocytogenes</italic> infection may induce the expansion of goblet and Paneth cell population.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>The influence of L. monocytogenes on the differentiation of intestinal secretory cells. CK, control; LM, L. monocytogenes-infected group. <bold>(A)</bold> The location of <italic>L. monocytogenes</italic> in organoids. <bold>(B)</bold> Confocal microscopy analysis of UEA-1+ cells in organoids. <bold>(C)</bold> Confocal microscopy analysis of Lyz+ cells in organoids. <bold>(D)</bold> Western blot of lysozyme in organoids. <bold>(E)</bold> mRNA levels of Muc2 from organoids samples. <bold>(F)</bold> mRNA levels of <italic>Lyz</italic> from organoids samples. Data is presented as mean &#xb1; SD. *<italic>P</italic> &lt; 0.05, **<italic>P</italic> &lt; 0.01. Data combined from at least three independent experiments unless otherwise stated.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-793335-g004.tif"/>
</fig>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>The influence of <italic>L. monocytogenes</italic> on the Notch pathway in organoids. CK, control; LM, <italic>L. monocytogenes</italic>-infected group. <bold>(A-E)</bold> The expression of <italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Notch1</italic>, <italic>Hes1</italic> and <italic>Math1</italic> genes were determined by quantitative RT-PCR and normalized by the expression of <italic>GAPDH</italic>. Data is presented as mean &#xb1; SD. *<italic>P &lt;</italic> 0.05, ***<italic>P &lt;</italic> 0.001. Data combined from at least three independent experiments unless otherwise stated.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-793335-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s4">
<title>4 Discussion</title>
<p>
<italic>L. monocytogenes</italic> infection is a severe foodborne disease worldwide, reported in more than 30 countries, including the USA, Canada, Germany, Portugal, and Austria (<xref ref-type="bibr" rid="B7">Desai et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B13">Jamshidi and Zeinali, 2019</xref>). During <italic>L. monocytogenes</italic> infection, the intestine is a vital defense line. This study showed that <italic>L. monocytogenes</italic> infection could lead to villi damage with H&amp;E staining, which was closely related to the increase of pro-inflammatory cytokines TNF-&#x3b1; secretion. This corroborated the study of Alkhuriji et&#xa0;al. that <italic>L. monocytogenes</italic> infection in mice could cause epithelial cells exfoliation and degeneration of the lamina propria and induce the production of TNF-&#x3b1; in the intestine (<xref ref-type="bibr" rid="B1">Alkhuriji et&#xa0;al., 2020</xref>). In addition, <italic>L. monocytogenes</italic> increased the level of LPS in the serum, which indicated that the intestinal permeability was increased (<xref ref-type="bibr" rid="B14">Mokkala, K. et&#xa0;al., 2017</xref>).</p>
<p>As specialized intestinal epithelial cells, goblet and Paneth cells play an essential role in mucosal homeostasis and bacterial defense. During infection, goblet cell secretion, which contains mucopolysaccharides, critical in forming the first line of defense by protecting the intestinal barrier against pathogenic invasion, was described extensively (<xref ref-type="bibr" rid="B15">Pelaseyed et&#xa0;al., 2014</xref>). This study demonstrated that the number of goblet cells, <italic>in vivo</italic> and <italic>in vitro</italic>, and the relative expression of <italic>Muc2</italic> gene were significantly increased, which was consistent with the previous study (<xref ref-type="bibr" rid="B16">Pian et&#xa0;al., 2020</xref>). Notably, Paneth cells, located at the bottom of the intestinal crypt, could produce various antibacterial peptides to kill pathogens, including regenerating 3&#x3b3; (<italic>reg3&#x3b3;</italic>), lysozyme, and defensin (<xref ref-type="bibr" rid="B3">Bevins and Salzman, 2011</xref>). This study showed that the count of Lyz<sup>+</sup> cells was increased in mice, which was consistent with the protein and mRNA expression levels in mice and organoids. Moreover, it was reported that <italic>L. monocytogenes</italic> increased the number of Paneth cells during co-culture with organoids for 18&#xa0;h <italic>in vitro</italic> (<xref ref-type="bibr" rid="B12">Huang et&#xa0;al., 2021</xref>). Although the increasing number of goblet and Paneth cells shielded against epithelial damage, excessive secretory cells may disrupt the intestinal homeostasis by consuming the stem cells (<xref ref-type="bibr" rid="B17">Putman et&#xa0;al., 2011</xref>), which could rejuvenate tissue homeostasis and repair injured tissues (<xref ref-type="bibr" rid="B23">Umar, 2002</xref>). Therefore, how to preserve the number and function of goblet and Paneth cells during the treatment of bacterial infection is imperative.</p>
<p>The Notch signaling pathway is a development switch for intestinal secretory and absorptive cells. However, its suppression leads to the inhibition of enterocytes differentiation and a dramatic expansion in goblet and Paneth cell numbers (<xref ref-type="bibr" rid="B26">van Es et&#xa0;al., 2005</xref>). The Notch signaling was activated when one of the Delta or Jagged Notch transmembrane receptors interacted with one of the five Notch ligands triggering proteolytic cleavage of the receptor (<xref ref-type="bibr" rid="B21">Scoville et&#xa0;al., 2008</xref>). The cleavage released the free Notch 1 intracellular domain (NICD) that translocated into the nucleus to upregulate target genes, mainly of Hes class, such as <italic>Hes1</italic> in the intestine, which suppressed the <italic>Math1</italic> gene (<xref ref-type="bibr" rid="B33">Yang et&#xa0;al., 2001</xref>). It was reported that constitutive overexpression of the <italic>Notch1</italic> receptor reduced the differentiation of enteroendocrine and Paneth cells, thus decreasing their numbers (<xref ref-type="bibr" rid="B19">Robine et&#xa0;al., 2005</xref>). Also, deficiency in <italic>Hes1</italic> mice led to an abundance of goblet, enteroendocrine, and Paneth cells, but a reduced number of enterocytes (<xref ref-type="bibr" rid="B22">Suzuki et&#xa0;al., 2005</xref>). Conversely, the intestine from <italic>Math1</italic> deficient mice exhibited an intestinal epithelium formed only by enterocytes (<xref ref-type="bibr" rid="B33">Yang et&#xa0;al., 2001</xref>).</p>
<p>Furthermore, under pathological conditions, Wu et&#xa0;al. found that <italic>Salmonella</italic> infection induced the loss of goblet cells and reduced the mRNA expression of <italic>Muc2</italic> by increasing the expression of <italic>Dll1</italic>, <italic>Dll4</italic>, and <italic>Hes1</italic> genes, indicating the activation of Notch signaling pathway (<xref ref-type="bibr" rid="B31">Wu et&#xa0;al., 2018</xref>). However, to the best of our knowledge, the influence of <italic>L. monocytogenes</italic> infection on the Notch signaling pathway has not been documented in mice and organoids. Based on the increase in goblet and Paneth cells, our findings speculated whether <italic>L. monocytogenes</italic> promoted the differentiation of intestinal secretory cells by inhibiting the Notch signaling pathway. Consistent with this hypothesis, the relative expression of related genes of Notch pathway (<italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Nocth1</italic>, and <italic>Hes1</italic>) were detected and decreased, while the mRNA relative expression of <italic>Math1</italic> was upregulated in mice. Also, the intestinal organoids, an effective intestinal cell model, were used to establish an infection model <italic>in vitro</italic>. The mRNA relative expression of <italic>Jag1</italic>, <italic>Dll4</italic>, <italic>Nocth1</italic>, and <italic>Hes1</italic> were down-regulated significantly, while the relative expression of <italic>Math1</italic> gene was significantly increased, which was consistent with a previous study (<xref ref-type="bibr" rid="B12">Huang et&#xa0;al., 2021</xref>). As such, the decreased expression of the Notch signaling pathway genes demonstrated <italic>L. monocytogenes</italic> inhibition on the Notch pathway. Combined with these results, the Notch pathway inhibition may be the reason for the increased number of goblet and Paneth cells after <italic>L. monocytogenes</italic> infection in mice and organoids.</p>
<p>In summary, this study indicated that <italic>L. monocytogenes</italic> infection damaged the intestinal barrier and upregulated LPS level in serum, and increased the expression of TNF-&#x3b1; in the jejunum. Furthermore, <italic>L. monocytogenes</italic> infection inhibited the Notch pathway, which may lead to the increasing number of goblet and Paneth cells in the intestine of mice. Therefore, this study provides insight to study the mechanism of <italic>L. monocytogenes</italic> damage to the intestinal mucosal barrier, which is helpful to control <italic>L. monocytogenes</italic> pathogenic infection.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The animal study was reviewed and approved by Nanjing Agriculture University Committee on Animal Resources Committee and the National Institutes of Health guidelines for the performance of animal experiments.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>CZ: Data curation, Formal analysis, Writing - original draft. YYZ: Writing - original draft. AB: Writing - original draft. JH: Writing - original draft. YFZ: Writing - original draft. KY: Conceptualization, Formal analysis, Funding acquisition, Supervision, Writing - original draft, Writing - review and editing. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by the National Natural Science Foundation of China (32172267) and Program for Student Innovation through Research and Training (202110307047).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alkhuriji</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Majrashi</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Alomar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>El-Khadragy</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Awad</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Khatab</surname> <given-names>A. R.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>The Beneficial Effect of Eco-Friendly Green Nanoparticles Using Garcinia Mangostana Peel Extract Against Pathogenicity of Listeria Monocytogenes in Female BALB/C Mice</article-title>. <source>Animals</source> <volume>10</volume> (<issue>4</issue>), <fpage>573</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/ani10040573</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Becattini</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Pamer</surname> <given-names>E. G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Multifaceted Defense Against Listeria Monocytogenes in the Gastro-Intestinal Lumen</article-title>. <source>Pathogens</source> <volume>7</volume> (<issue>1</issue>), <fpage>1</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/pathogens7010001</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bevins</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Salzman</surname> <given-names>N. H.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Paneth Cells, Antimicrobial Peptides and Maintenance of Intestinal Homeostasis</article-title>. <source>Nat. Rev. Microbiol.</source> <volume>9</volume> (<issue>5</issue>), <fpage>356</fpage>&#x2013;<lpage>368</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nrmicro2546</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cho</surname> <given-names>S. S. L.</given-names>
</name>
<name>
<surname>Han</surname> <given-names>J.</given-names>
</name>
<name>
<surname>James</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Png</surname> <given-names>C. W.</given-names>
</name>
<name>
<surname>Weerasooriya</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Alonso</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Dual-Specificity Phosphatase 12 Targets P38 Map Kinase to Regulate Macrophage Response to Intracellular Bacterial Infection</article-title>. <source>Front. Immunol.</source> <volume>8</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fimmu.2017.01259</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Date</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Mini-Gut Organoids: Reconstitution of Stem Cell Niche</article-title>. <source>Annu. Rev. Cell Dev. Biol.</source> <volume>31</volume>, <fpage>269</fpage>&#x2013;<lpage>289</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev-cellbio-100814-125218</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>de Noordhout</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Devleesschauwer</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Angulo</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Verbeke</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Haagsma</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kirk</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>The Global Burden of Listeriosis: A Systematic Review and Meta-Analysis</article-title>. <source>Lancet Infect. Dis.</source> <volume>14</volume> (<issue>11</issue>), <fpage>1073</fpage>&#x2013;<lpage>1082</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S1473-3099(14)70870-9</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Desai</surname> <given-names>A. N.</given-names>
</name>
<name>
<surname>Anyoha</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Madoff</surname> <given-names>L. C.</given-names>
</name>
<name>
<surname>Lassmann</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Changing Epidemiology of Listeria Monocytogenes Outbreaks, Sporadic Cases, and Recalls Globally: A Review of Promed Reports From 1996 to 2018</article-title>. <source>Int. J. Infect. Dis.</source> <volume>84</volume>, <fpage>48</fpage>&#x2013;<lpage>53</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijid.2019.04.021</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Doganay</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Listeriosis: Clinical Presentation</article-title>. <source>FEMS Immunol. Med. Microbiol.</source> <volume>35</volume> (<issue>3</issue>), <fpage>173</fpage>&#x2013;<lpage>175</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0928-8244(02)00467-4</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Finkbeiner</surname> <given-names>S. R.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>D. R.</given-names>
</name>
<name>
<surname>Altheim</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Dedhia</surname> <given-names>P. H.</given-names>
</name>
<name>
<surname>Taylor</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Tsai</surname> <given-names>Y. H.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>&#x2026;</article-title>
<article-title>Transcriptome-Wide Analysis Reveals Hallmarks of Human Intestine Development and Maturation In Vitro and <italic>In Vivo</italic>
</article-title>. <source>Stem Cell Rep.</source> <volume>4</volume> (<issue>6</issue>), <fpage>1140</fpage>&#x2013;<lpage>1155</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.stemcr.2015.04.010</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gahan</surname> <given-names>C. G. M.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Listeria Monocytogenes: Survival and Adaptation in the Gastrointestinal Tract</article-title>. <source>Front. Cell. Infect. Microbiol.</source> <volume>4</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2014.00009</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hill</surname> <given-names>D. R.</given-names>
</name>
<name>
<surname>Spence</surname> <given-names>J. R.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Gastrointestinal Organoids: Understanding the Molecular Basis of the Host-Microbe Interface</article-title>. <source>Cell. Mol. Gastroenterol. Hepatol.</source> <volume>3</volume> (<issue>2</issue>), <fpage>138</fpage>&#x2013;<lpage>149</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jcmgh.2016.11.007</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Zhou</surname> <given-names>G. H.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>H. K.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>K. P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Effect of Listeria Monocytogenes on Intestinal Stem Cells in the Co-Culture Model of Small Intestinal Organoids</article-title>. <source>Microbial Pathogenesis</source> <volume>153</volume>, <fpage>104776</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.micpath.2021.104776</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jamshidi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Zeinali</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Significance and Characteristics of Listeria Monocytogenes in Poultry Products</article-title>. <source>Int. J. Food Sci</source>. <issue>3</issue>, <fpage>1</fpage>&#x2013;<lpage>7</lpage>. doi: <pub-id pub-id-type="doi">10.1155/2019/7835253</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mokkala</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Pellonper&#xe4;</surname> <given-names>O.</given-names>
</name>
<name>
<surname>R&#xf6;yti&#xf6;</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Pussinen</surname> <given-names>P.</given-names>
</name>
<name>
<surname>R&#xf6;nnemaa</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Laitinen</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Increased Intestinal Permeability, Measured by Serum Zonulin, is Associated With Metabolic Risk Markers in Overweight Pregnant Women</article-title>. <source>Metabolism</source> <volume>69</volume>, <fpage>43</fpage>&#x2013;<lpage>50</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.metabol.2016.12.015</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pelaseyed</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Bergstrom</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Gustafsson</surname> <given-names>J. K.</given-names>
</name>
<name>
<surname>Ermund</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Birchenough</surname> <given-names>G. M. H.</given-names>
</name>
<name>
<surname>Schutte</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>The Mucus and Mucins of the Goblet Cells and Enterocytes Provide the First Defense Line of the Gastrointestinal Tract and Interact With the Immune System</article-title>. <source>Immunol. Rev.</source> <volume>260</volume> (<issue>1</issue>), <fpage>8</fpage>&#x2013;<lpage>20</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/imr.12182</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pian</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Chai</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>B. Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lv</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Qiu</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Type 3 Innate Lymphoid Cells Direct Goblet Cell Differentiation <italic>via</italic> the LT-LT Beta R Pathway During Listeria Infection</article-title>. <source>J. Immunol.</source> <volume>205</volume> (<issue>3</issue>), <fpage>853</fpage>&#x2013;<lpage>863</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.4049/jimmunol.2000197</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Putman</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Burger-van Paassen</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Schaart</surname> <given-names>M. W.</given-names>
</name>
<name>
<surname>de Bruijn</surname> <given-names>A. C. J. M.</given-names>
</name>
<name>
<surname>de Krijger</surname> <given-names>R. R.</given-names>
</name>
<name>
<surname>Tibboel</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Paneth Cell Hyperplasia and Metaplasia in Necrotizing Enterocolitis</article-title>. <source>Pediatr. Res.</source> <volume>69</volume> (<issue>3</issue>), <fpage>217</fpage>&#x2013;<lpage>223</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1203/PDR.0b013e3182092a9a</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rajan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Vela</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zeng</surname> <given-names>X. L.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Shroyer</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Blutt</surname> <given-names>S. E.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Novel Segment- and Host-Specific Patterns of Enteroaggregative Escherichia Coli Adherence to Human Intestinal Enteroids</article-title>. <source>MBio</source> <volume>9</volume>, <issue>1</issue>. doi:&#xa0;<pub-id pub-id-type="doi">10.1128/mBio.02419-17</pub-id>. J. m.</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Robine</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Fre</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Huyghe</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Artavanis-Tsakonas</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Louvard</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Notch Signals Control the Fate of Immature Progenitor Cells in the Intestine</article-title>. <source>M S-Med. Sci.</source> <volume>21</volume> (<issue>8-9</issue>), <fpage>780</fpage>&#x2013;<lpage>781</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1051/medsci/2005218-9780</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ruch</surname> <given-names>T. R.</given-names>
</name>
<name>
<surname>Engel</surname> <given-names>J. N.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Targeting the Mucosal Barrier: How Pathogens Modulate the Cellular Polarity Network</article-title>. <source>Cold Spring Harbor Perspect. Biol.</source> <volume>9</volume> (<issue>6</issue>), <fpage>a027953</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1101/cshperspect.a027953</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Scoville</surname> <given-names>D. H.</given-names>
</name>
<name>
<surname>Sato</surname> <given-names>T.</given-names>
</name>
<name>
<surname>He</surname> <given-names>X. C.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L. H.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Current View: Intestinal Stem Cells and Signaling</article-title>. <source>Gastroenterology</source> <volume>134</volume> (<issue>3</issue>), <fpage>849</fpage>&#x2013;<lpage>864</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1053/j.gastro.2008.01.079</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suzuki</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Fukui</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Kayahara</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Sawada</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Seno</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Hiai</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Hes1-Deficient Mice Show Precocious Differentiation of Paneth Cells in the Small Intestine</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>328</volume> (<issue>1</issue>), <fpage>348</fpage>&#x2013;<lpage>352</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bbrc.2004.12.174</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Umar</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Intestinal Stem Cells</article-title>. <source>Curr. Gastroenterol. Rep</source>. <volume>12</volume> (<issue>5</issue>), <fpage>340</fpage>&#x2013;<lpage>348</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s11894-010-0130-3340-348</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van der Flier</surname> <given-names>L. G.</given-names>
</name>
<name>
<surname>Clevers</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Stem Cells, Self-Renewal, and Differentiation in the Intestinal Epithelium</article-title>. <source>Annu. Rev. Physiol.</source> <volume>71</volume>, <fpage>241</fpage>&#x2013;<lpage>260</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1146/annurev.physiol.010908.163145</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vandussen</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Marinshaw</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Shaikh</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Miyoshi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Stappenbeck</surname> <given-names>T. S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Development of an Enhanced Human Gastrointestinal Epithelial Culture System to Facilitate Patient-Based Assays</article-title>. <source>Gut</source> <volume>64</volume> (<issue>6</issue>), <fpage>911</fpage>&#x2013;<lpage>920</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1136/gutjnl-2013-306651</pub-id>. J. G.</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Es</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>van Gijn</surname> <given-names>M. E.</given-names>
</name>
<name>
<surname>Riccio</surname> <given-names>O.</given-names>
</name>
<name>
<surname>van den Born</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Vooijs</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Begthel</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Notch/Gamma-Secretase Inhibition Turns Proliferative Cells in Intestinal Crypts and Adenomas Into Goblet Cells</article-title>. <source>Nature</source> <volume>435</volume> (<issue>7044</issue>), <fpage>959</fpage>&#x2013;<lpage>963</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nature03659</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Watson</surname> <given-names>C. L.</given-names>
</name>
<name>
<surname>Mahe</surname> <given-names>M. M.</given-names>
</name>
<name>
<surname>Munera</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Howell</surname> <given-names>J. C.</given-names>
</name>
<name>
<surname>Sundaram</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Poling</surname> <given-names>H. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>&#x2026;</article-title>
<article-title>An In Vivo Model of Human Small Intestine Using Pluripotent Stem Cells</article-title>. <source>Nat. Med.</source> <volume>20</volume> (<issue>11</issue>), <fpage>1310</fpage>&#x2013;<lpage>1314</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nm.3737</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilharm</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Brigas</surname> <given-names>H. C.</given-names>
</name>
<name>
<surname>Sandrock</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ribeiro</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Amado</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Reinhardt</surname> <given-names>A.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Microbiota-Dependent Expansion of Testicular IL-17-Producing V Gamma 6(+) Gamma Delta T Cells Upon Puberty Promotes Local Tissue Immune Surveillance (Sep, 10.1038/S41385-020-00346-7, 2020)</article-title>. <source>Mucosal Immunol.</source> <volume>14</volume> (<issue>1</issue>), <fpage>278</fpage>&#x2013;<lpage>278</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/s41385-020-00346-7</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wilson</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Tocchi</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Holly</surname> <given-names>M. K.</given-names>
</name>
<name>
<surname>Parks</surname> <given-names>W. C.</given-names>
</name>
<name>
<surname>Smith</surname> <given-names>J. G.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>A Small Intestinal Organoid Model of non-Invasive Enteric Pathogen-Epithelial Cell Interactions</article-title>. <source>Mucosal Immunol.</source> <volume>8</volume> (<issue>2</issue>), <fpage>352</fpage>&#x2013;<lpage>361</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/mi.2014.72</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wong</surname> <given-names>G. T.</given-names>
</name>
<name>
<surname>Manfra</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Poulet</surname> <given-names>F. M.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Josien</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Bara</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Chronic Treatment With the Gamma-Secretase Inhibitor LY-411,575 Inhibits Beta-Amyloid Peptide Production and Alters Lymphopoiesis and Intestinal Cell Differentiation</article-title>. <source>J. Biol. Chem.</source> <volume>279</volume> (<issue>13</issue>), <fpage>12876</fpage>&#x2013;<lpage>12882</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1074/jbc.M311652200</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname> <given-names>H. Q.</given-names>
</name>
<name>
<surname>Ye</surname> <given-names>L. L.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>X. X.</given-names>
</name>
<name>
<surname>Xie</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>Q. H.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Lactobacillus Acidophilus Alleviated Salmonella-Induced Goblet Cells Loss and Colitis by Notch Pathway</article-title>. <source>Mol. Nutr. Food Res.</source> <volume>62</volume> (<issue>22</issue>), <fpage>1800552</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1002/mnfr.201800552</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xie</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>W. J.</given-names>
</name>
<name>
<surname>Yu</surname> <given-names>S. Y.</given-names>
</name>
<name>
<surname>Turner</surname> <given-names>J. R.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Cadmium Ingestion Exacerbates Salmonella Infection, With a Loss of Goblet Cells Through Activation of Notch Signaling Pathways by ROS in the Intestine</article-title>. <source>J. Hazardous Materials</source> <volume>391</volume>, <fpage>122262</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.jhazmat.2020.122262</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Bermingham</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Finegold</surname> <given-names>M. J.</given-names>
</name>
<name>
<surname>Zoghbi</surname> <given-names>H. Y.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Requirement of Math1 for Secretory Cell Lineage Commitment in the Mouse Intestine</article-title>. <source>Science</source> <volume>294</volume> (<issue>5549</issue>), <fpage>2155</fpage>&#x2013;<lpage>2158</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1126/science.1065718</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y. G.</given-names>
</name>
<name>
<surname>Wu</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Salmonella-Infected Crypt-Derived Intestinal Organoid Culture System for Host&#x2013;Bacterial Interactions</article-title>. <source>Physiol. Rep</source>. <volume>2</volume>, (<issue>9</issue>), <fpage>e12147</fpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.14814/phy2.12147</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>