<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2022.780272</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>
<italic>Mycobacterium tuberculosis</italic> Induced Osteoblast Dysregulation Involved in Bone Destruction in Spinal Tuberculosis</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Ma</surname>
<given-names>Wenxin</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Weidong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>He</surname>
<given-names>Xijing</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Sun</surname>
<given-names>Yuhang</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yin</surname>
<given-names>Huquan</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1486898"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Zili</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Shi</surname>
<given-names>Shiyuan</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Spine Surgery, General Hospital of Ningxia Medical University</institution>, <addr-line>Ningxia</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Spine Surgery, Xi&#x2019;an International Medical Center Hospital Affiliated to Northwest University</institution>, <addr-line>Shaanxi</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Orthopedics, Liaocheng Hospital of Traditional Chinese Medicine</institution>, <addr-line>Liaocheng</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Department of Biochemistry, Inteliex Biotechnology Corp</institution>, <addr-line>Tampa, FL</addr-line>, <country>United States</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Orthopedics, Hangzhou Chest Hospital affiliated to Zhejiang University Medical College</institution>, <addr-line>Zhejiang</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Alan G. Goodman, Washington State University, United States</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Jianping Xie, Southwest University, China; Zhengfeng Yang, Washington University in St. Louis, United States</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Zili Wang, <email xlink:href="mailto:zili.wang@nyfy.com.cn">zili.wang@nyfy.com.cn</email>; Shiyuan Shi, <email xlink:href="mailto:ssylf@sina.com">ssylf@sina.com</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work and share first authorship</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Molecular Bacterial Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>04</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>12</volume>
<elocation-id>780272</elocation-id>
<history>
<date date-type="received">
<day>20</day>
<month>09</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>21</day>
<month>02</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Ma, Jin, He, Sun, Yin, Wang and Shi</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Ma, Jin, He, Sun, Yin, Wang and Shi</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Disturbance of bone homeostasis caused by <italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>) is a key clinical manifestation in spinal tuberculosis (TB). However, the complete mechanism of this process has not been established, and an effective treatment target does not exist. Increasing evidence shows that abnormal osteoclastogenesis triggered by an imbalance of the receptor activator of NF-&#x3ba;B ligand (RANKL)/osteoprotegerin (OPG) axis may play a key role in the disturbance of bone homeostasis. Previous studies reported that RANKL is strongly activated in patients with spinal TB; however, the OPG levels in these patients were not investigated in previous studies. In this study, we investigated the OPG levels in patients with spinal TB and the dysregulation of osteoblasts caused by <italic>Mtb</italic> infection. Inhibition of the <italic>Mce4a</italic> gene of <italic>Mtb</italic> by an antisense locked nucleic acid (LNA) gapmer (Mce4a-ASO) was also investigated. Analysis of the serum OPG levels in clinical samples showed that the OPG levels were significantly decreased in patients with spinal TB compared to those in the group of non-TB patients. The internalization of <italic>Mtb</italic> in osteoblasts, the known major source of OPG, was investigated using the green fluorescent protein (GFP)-labeled <italic>Mycobacterium</italic> strain H37Ra (H37RaGFP). The cell-associated fluorescence measurements showed that <italic>Mtb</italic> can efficiently enter osteoblast cells. In addition, <italic>Mtb</italic> infection caused a dose-dependent increase of the CD40 mRNA expression and cytokine (interleukin 6, IL-6) secretion in osteoblast cells. Ligation of CD40 by soluble CD154 reversed the increased secretion of IL-6. This means that the induced CD40 is functional. Considering that the interaction between CD154-expressing T lymphocytes and bone-forming osteoblast cells plays a pivotal role in bone homeostasis, the CD40 molecule might be a strong candidate for mediating the target for treatment of bone destruction in spinal TB. Additionally, we also found that Mce4a-ASO could dose-dependently inhibit the <italic>Mce4a</italic> gene of <italic>Mtb</italic> and reverse the decreased secretion of IL-6 and the impaired secretion of OPG caused by <italic>Mtb</italic> infection of osteoblast cells. Taken together, the current finding provides breakthrough ideas for the development of therapeutic agents for spinal TB.</p>
</abstract>
<kwd-group>
<kwd>
<italic>Mycobacterium tuberculosis</italic>
</kwd>
<kwd>osteoblast</kwd>
<kwd>bone destruction</kwd>
<kwd>CD40</kwd>
<kwd>antisense oligonucleotide</kwd>
</kwd-group>    <contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<counts>
<fig-count count="5"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="51"/>
<page-count count="10"/>
<word-count count="4827"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<title>Introduction</title>
<p>Tuberculosis (TB), a disease caused by <italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>), is one of the oldest infectious diseases in history. To date, TB is still one of the top 10 leading causes of death worldwide. Moreover, bone and joint tuberculosis (BJTB) accounts for about 3%&#x2013;7% of all tuberculosis cases, among which over 70% are spinal tuberculosis (<xref ref-type="bibr" rid="B21">Khanna and Sabharwal, 2019</xref>). Spinal tuberculosis is a condition characterized by an enormous resorption of the spinal vertebrae due to <italic>Mtb</italic> infection. It is described as a persistent inflammatory destruction of the spinal bones, essentially incited by mycobacterial disease of the spinal cavity, and is believed to be initiated by the odd activation of osteoclasts in the bone tissue, which leads to inflammatory bone destruction, crack, and breakdown of the vertebrae, bringing about gigantic kyphotic distortions (<xref ref-type="bibr" rid="B17">Haynes, 2004</xref>; <xref ref-type="bibr" rid="B18">Hoshino et&#xa0;al., 2014</xref>).</p>
<p>Bones are composed of a variety of cell types, namely, osteoclasts, osteoblasts, osteocytes, and bone lining cells (<xref ref-type="bibr" rid="B46">Tobeiha et&#xa0;al., 2020</xref>). Osteoclasts originate from hematopoietic stem cells (HSCs, the macrophage lineage of hematopoietic stem cells), while osteoblasts originate from mesenchymal stem cells (MSCs) through certain stages, for example, osteoprogenitors and pre-osteoblasts (<xref ref-type="bibr" rid="B12">Datta et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B45">Thompson et&#xa0;al., 2012</xref>). In addition, bone homeostasis is maintained by the harmony between bone resorption by osteoclasts and bone deposition by osteoblasts (<xref ref-type="bibr" rid="B15">Eriksen, 2010</xref>; <xref ref-type="bibr" rid="B32">Rowe et&#xa0;al., 2021</xref>). Osteoclasts comprise a class of multinucleated bone destruction cells formed by the cytoplasmic combination of their mononuclear forerunners, which are in the myeloid heredity of hematopoietic cells that additionally bring about macrophages (<xref ref-type="bibr" rid="B6">Boyce and Xing, 2007</xref>). Activated osteoclasts launch proteolytic enzymes, which smash connective tissues in bones. They additionally secrete some acids that unravel the mineral phase of bones (<xref ref-type="bibr" rid="B27">Mundy, 2007</xref>). The formation and activation of osteoclasts require the expression of the osteoprotegerin ligand (OPGL) [or receptor activator of NF-&#x3ba;B ligand (RANKL)] in osteoblasts, which can be induced by calciotropic factors such as vitamin D3, interleukin 1 (IL-1), and tumor necrosis factor alpha (TNF-&#x3b1;). Once OPGL is induced, it then binds to RANKL on osteoblast precursors, leading to the maturation and activation of osteoblasts (<xref ref-type="bibr" rid="B8">Burgess et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B19">Hsu et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B22">Kong et&#xa0;al., 2000</xref>). Osteoprotegerin (OPG), which is secreted from osteoblasts, features as a soluble decoy receptor to OPGL and competes with the receptor activator of NF-&#x3ba;B (RANK) for binding to the OPGL. Consequently, OPG functions as an inhibitor of osteoclast maturation and osteoclast activation. Previous genetic and purposeful experiments pointed out that the stability between OPGL&#x2013;RANK signaling and the degree of biologically energetic OPG alter the improvement and activation of osteoclasts and bone metabolism (<xref ref-type="bibr" rid="B7">Bucay et&#xa0;al., 1998</xref>; <xref ref-type="bibr" rid="B24">Li et&#xa0;al., 2000</xref>). So far, research on this topic has continuously indicated that the disturbance of bone homeostasis is caused by the over-activation of osteoblasts through the regulation of OPGL&#x2013;RANK (<xref ref-type="bibr" rid="B38">Simonet et&#xa0;al., 1997</xref>; <xref ref-type="bibr" rid="B26">Morony et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B43">Tanaka et&#xa0;al., 2005</xref>; <xref ref-type="bibr" rid="B2">Baud&#x2019;huin et&#xa0;al., 2007</xref>). Moreover, <italic>Mtb</italic> infection of osteoblasts will increase the secretion of chemokines (such as IL-8, IP-10, and MCP-1), which will subsequently affect the recruitment of leukocytes and ultimately contribute to bone destruction. Therefore, chemokines derived from <italic>Mtb</italic>-infected osteoblasts may play an important role in the development of tuberculous and staphylococcal osteomyelitis (<xref ref-type="bibr" rid="B49">Wright and Friedland, 2002</xref>). These findings reinforced the general belief that osteoblasts play a pivotal role in the maturation and activation of osteoclasts for bone resorption locales. Likewise, osteoblasts could control bone resorption by the discharge of OPG and RANKL, and the RANK/OPG ratio may be the determinant factor for bone homeostasis. Pieces of evidence from other studies have suggested that the RANK&#x2013;RANKL pathway is strongly activated and that the tissue expression of OPG is not fully induced in spinal TB bone specimens (<xref ref-type="bibr" rid="B20">Izawa, 2015</xref>). Treatment of recombinant <italic>M. tuberculosis</italic> (r-Mt) 10-kDa co-chaperonin (cpn10) triggered a significantly downregulated level of OPG and upregulated level of RANKL in human osteoblast cells (<xref ref-type="bibr" rid="B50">Zhang et&#xa0;al., 2015</xref>). It should also be noted that <italic>Mtb</italic> could inhibit the complement receptor (CR)-mediated Ca<sup>2+</sup> signaling (<xref ref-type="bibr" rid="B25">Malik et&#xa0;al., 2000</xref>) and could lead to the impairment of OPG expression and secretion (<xref ref-type="bibr" rid="B3">Bergh et&#xa0;al., 2004</xref>). Infection of mice by acute administration of microbial results in elevated serum levels of OPG, which causes disruption of beta cell homeostasis by inhibiting glucose-stimulated insulin secretion (GSIS) (<xref ref-type="bibr" rid="B23">Kuroda et&#xa0;al., 2016</xref>). These findings suggest that there is great interest in investigating the circulating OPG levels in spinal TB patients.</p>
<p>One of the hallmarks of spinal TB is granuloma formation. Granuloma formation is a specific provocative reaction caused by specific microbes such as <italic>Mycobacterium</italic> (<xref ref-type="bibr" rid="B36">Shibuya et&#xa0;al., 2005</xref>). It is usually regarded as a host protective mechanism toward irritants or persistent contamination and occurs as an outcome of the failure of the host to defend against invading pathogens. Various cell types are involved in granuloma formation, such as macrophages, T cells, and epithelioid cells; however, the presence of multinucleated Langhans giant cells (LGCs) is the main feature of granulomatous inflammation (<xref ref-type="bibr" rid="B34">Sakai et&#xa0;al., 2012</xref>). Nevertheless, the complete mechanism of LGC formation is still not fully elucidated. The generally accepted theory is that cytokines (e.g., IFN-&#x3b3;, IL-3, and IL-4) secreted from T cells may play pivotal roles in this process (<xref ref-type="bibr" rid="B14">Enelow et&#xa0;al., 1992</xref>; <xref ref-type="bibr" rid="B42">Takashima et&#xa0;al., 1993</xref>). Additionally, an antibody inhibition experiment showed that CD40&#x2013;CD40 ligand (CD40L, or CD154) interaction and interferon gamma (IFN-&#x3b3;) are required for LGC formation and that soluble CD40L (sCD40L) and IFN-&#x3b3; could completely replace the role of T cells (<xref ref-type="bibr" rid="B34">Sakai et&#xa0;al., 2012</xref>). These facts suggest that the CD40&#x2013;CD40L axis has a critical role in the formation of LGCs. The interactions between CD40 and CD154, especially the ability of CD154-expressing T lymphocytes to ligate CD40-expressing cells, have been embroiled as being basic for the commencement of T-lymphocyte&#x2013;subordinate humoral and immune reactions (<xref ref-type="bibr" rid="B40">Stout et&#xa0;al., 1996</xref>; <xref ref-type="bibr" rid="B9">Calderhead et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B28">Netea et&#xa0;al., 2002</xref>). These interactions provide strong activation signals for antigen-presenting cells, allowing T lymphocytes to strongly affect the activity of CD40-expressing cells; the absence of these interactions significantly impairs the cell-mediated immune response (<xref ref-type="bibr" rid="B9">Calderhead et&#xa0;al., 2000</xref>; <xref ref-type="bibr" rid="B47">van Kooten, 2000</xref>). The traditionally recognized feature of osteoblasts is to synthesize type I collagen in order to catalyze the calcification of the bone matrix. However, pieces of evidence from recent studies have suggested that, following interplay with external bacteria, bone-forming osteoblasts have been proven to possess a surprising potential to upregulate the expressions of cytokines and chemokines (<xref ref-type="bibr" rid="B41">Taichman and Emerson, 1994</xref>; <xref ref-type="bibr" rid="B5">Bost et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B16">Graves et&#xa0;al., 1999</xref>; <xref ref-type="bibr" rid="B4">Bost et&#xa0;al., 2001</xref>), which tend to increase the T-lymphocyte-mediated inflammatory responses. In the current study, we investigated the expression of functional CD40 in human osteoblasts following interplay with <italic>Mtb</italic> and the changes in the secretion of inflammatory cytokines, which may influence the T-lymphocyte-mediated inflammatory responses in spinal TB.</p>
<p>
<italic>M. tuberculosis</italic> has four homologues of mammalian cell entry (mce) operons. Among them, mutation in the mce4 operon resulted in growth defects and in the reduced survival of <italic>Mycobacterium</italic>-infected mice (<xref ref-type="bibr" rid="B33">Saini et&#xa0;al., 2008</xref>). Moreover, mce genes have been proven to play essential roles in <italic>Mtb</italic> pathogenicity by modulating the host immune response (<xref ref-type="bibr" rid="B11">Checkley et&#xa0;al., 2011</xref>). In this study, we designed a locked nucleic acid (LNA)&#x2013;DNA&#x2013;LNA gapmer antisense specific to <italic>Mce4a</italic> in <italic>Mtb</italic> to examine whether it could inhibit <italic>Mycobacterium</italic>.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<title>Materials and Methods</title>
<sec id="s2_1">
<title>Clinical Samples</title>
<p>This study included clinical samples from seven adult patients with spinal TB (four men and three women; average age, 61.3 years) and eight normal volunteer donors (four men and four women; average age, 59.2 years). The baseline characteristics of the study subjects are shown in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>. The ethics of this study was reviewed by the Research Ethics Committee of the General Hospital of Ningxia Medical University, which considered it in compliance with the principles of research ethics and approved it (2014). All study participants gave informed consent.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Baseline characteristics of the study participants.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left"> </th>
<th valign="top" align="center">Non-spinal TB controls</th>
<th valign="top" align="center">Spinal TB patients</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">Age (years)</td>
<td valign="top" align="center">59.2 &#xb1; 8.8</td>
<td valign="top" align="center">61.3 &#xb1; 14.2</td>
</tr>
<tr>
<td valign="top" align="left">Sex: male/female (%)</td>
<td valign="top" align="center">50/50</td>
<td valign="top" align="center">50/50</td>
</tr>
<tr>
<td valign="top" align="left">Laboratory test</td>
<td valign="top" align="center">Negative</td>
<td valign="top" align="center">Xpert positive, TB DNA/RNA positive</td>
</tr>
<tr>
<td valign="top" align="left">ESR</td>
<td valign="top" align="center">N/A</td>
<td valign="top" align="center">53.3 &#xb1; 24.8</td>
</tr>
<tr>
<td valign="top" align="left">Surgery</td>
<td valign="top" align="center">None</td>
<td valign="top" align="center">None</td>
</tr>
<tr>
<td valign="top" align="left">Diagnosis</td>
<td valign="top" align="center">Asymptomatic</td>
<td valign="top" align="center">Low back pain, lumbar tuberculosis</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>TB, tuberculosis; ESR, erythrocyte sedimentation rate; N/A, not applicable.</p>
</fn>
</table-wrap-foot>
</table-wrap>
</sec>
<sec id="s2_2">
<title>Mammalian Cell Culture</title>
<p>Human bone tissue-derived osteoblasts (CRL-11372) [American Type Culture Collection (ATCC), Manassas, VA, USA] were maintained in the logarithmic phase of growth in a 1:1 mixture of Ham&#x2019;s F12 medium/Dulbecco&#x2019;s modified Eagle&#x2019;s medium (Gibco-BRL, Grand Island, NY, USA), with 2.5 mM <sc>l</sc>-glutamine (without phenol red), 0.3 mg/ml G418, and supplemented with heat-inactivated 10% fetal bovine serum (Gibco-BRL) at 34&#xb0;C in a 5% CO<sub>2</sub>&#x2013;95% air-humidified incubator. Human Jurkat T-lymphocyte leukemia cell lines (TIB-152; ATCC) were maintained in the logarithmic phase of growth in RPMI-1640 medium (Gibco-BRL) supplemented with heat-inactivated 10% fetal bovine serum (Gibco-BRL) at 37&#xb0;C in a 5% CO<sub>2</sub>&#x2013;95% air-humidified incubator.</p>
</sec>
<sec id="s2_3">
<title>Establishment of GFP-Expressing <italic>M. tuberculosis</italic> (H37Ra-GFP)</title>
<p>The <italic>Mycobacterium</italic> Strong Promoter (MSP) and green fluorescent protein (GFP) containing the pGFPHYG2 plasmid was a gift from Lalita Ramakrishnan (Addgene plasmid #30173, RRID: Addgene_30173; <uri xlink:href="http://n2t.net/addgene:30173">http://n2t.net/addgene:30173</uri>). <italic>Mtb</italic> strain H37Ra (25177; ATCC) was maintained in the medium log phage in Middlebrook 7H9 broth with ADC enrichment at 37&#xb0;C. pGFPHYG2 was introduced directly into the <italic>Mtb</italic> strain by electroporation using a Gene Pulser electroporator (Bio-Rad, Richmond, CA, USA). Electroporation of plasmid DNA was performed at settings of 2.5 kV, 25 &#xb5;F, 1,000 &#x3a9; (<xref ref-type="bibr" rid="B31">Roberts et&#xa0;al., 2004</xref>).</p>
</sec>
<sec id="s2_4">
<title>Measurement of Osteoprotegerin Levels</title>
<p>The levels of OPG were detected from human serum and cell culture medium and were measured with enzyme-linked immunosorbent assay (ELISA) using a commercially available kit (Boster Bio, Wuhan, China) according to the manufacturer&#x2019;s instruction. The OPG produced by osteoblast cells was normalized to the cell densities with the CellTiter-Blue<sup>&#xae;</sup> assay (Promega, Madison, WI, USA).</p>
</sec>
<sec id="s2_5">
<title>Reverse Transcription Polymerase Chain Reaction</title>
<p>For mammalian cells, total RNA was prepared using the TRIzol reagent according to the manufacturer&#x2019;s protocol (Invitrogen, Carlsbad, CA, USA), and single-strand complementary DNA (cDNA) was synthesized from the RNA in a reaction mixture containing optimum blend of oligo(dT) primers and iScript reverse transcriptase (Bio-Rad, Richmond, CA, USA). Quantitative reverse transcription PCR (qRT-PCR) amplifications were performed using the rEVAltion 2&#xd7; qPCR Master Mix (Empirical Bioscience, Grand Rapids, MI, USA) in an MyIQ2 Real-Time PCR Detection System (Bio-Rad) following the manufacturer&#x2019;s protocol. To determine the specificity of amplification, melting curve analysis was applied to all final PCR products. The relative amount of target messenger RNA (mRNA) was calculated using the comparative threshold cycle method by normalizing the target mRNA threshold cycle to that for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For bacterial cells, total RNA was prepared using FastPrep<sup>&#xae;</sup> instruments from MP Biomedicals (Irvine, CA, USA) according to the manufacturer&#x2019;s protocol. The gene-specific primers used in this study are listed in <xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>Gene-specific primers used in PCR amplification.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="top" align="left">Gene</th>
<th valign="top" align="center">Forward primer (5&#x2032;&#x2013;3&#x2032;)</th>
<th valign="top" align="center">Reverse primer (5&#x2032;&#x2013;3&#x2032;)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>CD40</italic>
</td>
<td valign="top" align="left">AAGAAGGCTGGCACTGTA</td>
<td valign="top" align="left">GATGACACATTGGAGAAGAAG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Mce1a</italic>
</td>
<td valign="top" align="left">CTCGTAGTTGCCTTGGTAT</td>
<td valign="top" align="left">CGGAATCAGGTGGATGTAA</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Mce2a</italic>
</td>
<td valign="top" align="left">GTTGGTGCTCGTATTGGT</td>
<td valign="top" align="left">CGCTGCTGTTGAGGAATT</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Mce3a</italic>
</td>
<td valign="top" align="left">GGCAAGGTGAACGGATAG</td>
<td valign="top" align="left">CATAGGTGTCGGTGAAGTT</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>Mce4a</italic>
</td>
<td valign="top" align="left">GAGTAGTCGGAGGTCACT</td>
<td valign="top" align="left">CATCGGTCTGTCTAATAACG</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>GAPDH</italic>
</td>
<td valign="top" align="left">TATGACAACAGCCTCAAGAT</td>
<td valign="top" align="left">AGTCCTTCCACGATACCA</td>
</tr>
<tr>
<td valign="top" align="left">16S RNA</td>
<td valign="top" align="left">TCCCGGGCCTTGTACACA</td>
<td valign="top" align="left">CCACTGGCTTCGGGTGTTA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_6">
<title>Measurement of Secreted Interleukin 6</title>
<p>The collected cell culture medium was used to measure the levels of released IL-6. The IL-6 levels in the cell culture medium were measured with ELISA using a commercially available kit (BioVision, Milpitas, CA, USA) according to the manufacturer&#x2019;s instruction. The results were normalized to the cell densities using the CellTiter-Blue<sup>&#xae;</sup> assay (Promega).</p>
</sec>
<sec id="s2_7">
<title>Quantification of <italic>M. tuberculosis</italic> Internalization Into Host Cells</title>
<p>Mycobacterium internalization was measured as previously described (<xref ref-type="bibr" rid="B1">Ashiru et&#xa0;al., 2010</xref>), with some modifications. Briefly, GFP-labeled <italic>Mtb</italic> was added to each cell culture at multiplicities of infection (MOIs) of 1:1,000, 1:100, and 1:10, and extracellular bacteria were removed by amikacin (200 &#x3bc;g/ml) treatment for a total of 1 h. The internalization of <italic>Mtb</italic> was evaluated by measuring the cell-based fluorescence using a SpectraMax Gemini EM fluorescence microplate reader. For imaging of internalized cells, fluorescence-labeled <italic>Mtb</italic> was cultured in Middlebrook 7H9 with OADC. Osteoblast cells were infected with the culture medium or <italic>Mtb</italic> for 5 h at an MOI of 20, and non-infected bacteria were removed by washing with phosphate-buffered saline (PBS) three times. The image was captured using a fluorescence microscope at an original magnification of &#xd7;200.</p>
</sec>
<sec id="s2_8">
<title>Locked Nucleic Acid Contained Antisense Oligonucleotides</title>
<p>The <italic>Mce4a</italic>-specific antisense oligonucleotide containing LNA (LNA&#x2013;DNA&#x2013;LNA gapmer), which can effectively induce RNase H activation, had the following sequence: 5&#x2032;-(TYE563)+G+G+A+A+CGGGACGACT+T+C+T+G+A-3&#x2032; (&#x201c;+&#x201d; denotes the site of LNA). The 5&#x2032;-end of the antisense gapmer was labeled with a TYE563 fluorescence dye.</p>
</sec>
<sec id="s2_9">
<title>Quantification of Colony Forming Units</title>
<p>
<italic>Mtb</italic> was added to the cell culture in the presence or absence of Mce4a-ASO at various MOIs for indicated times, and extracellular bacteria were removed by amikacin (200 &#x3bc;g/ml) treatment. The cells were lysed using a 0.1% TritonX-100-based lysis buffer and plated in a 7H11 agar plate. The colonies were counted using ImageLab<sup>&#xae;</sup> software (Bio-Rad, Hercules, CA, USA).</p>
</sec>
<sec id="s2_10">
<title>Statistical Analysis</title>
<p>Statistical significance was evaluated using GraphPad Prism 6.0 statistics software program (GraphPad Software, Inc., San Diego, CA, USA). Between-group comparisons were analyzed using two-tailed unpaired Student&#x2019;s <italic>t</italic>-test or two-way analysis of variance (ANOVA). Statistical significance was set at <italic>p</italic> &lt; 0.05.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<title>Results</title>
<sec id="s3_1">
<title>Circulating Osteoprotegerin Levels Were Decreased in Spinal TB Patients</title>    <p>It is well known that osteoclast differentiation could be inhibited by OPG binding to the RANKL and that changes in the OPG/RANKL ratio determine osteoclastogenesis (<xref ref-type="bibr" rid="B30">Ominsky et&#xa0;al., 2008</xref>). Previous studies showed that the expression of RANKL is strongly activated in patients with spinal TB (<xref ref-type="bibr" rid="B20">Izawa, 2015</xref>); however, there is no report on whether the levels of OPG changed in these patients. The clinical characteristics of patients are summarized in <xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>, and typical specimen magnetic resonance imaging (MRI) scans are shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>. We first investigated the circulating OPG levels in patients with spinal TB. As shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>, the circulating OPG levels were significantly decreased in patients with spinal TB compared to those in non-spinal TB controls.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Typical clinical manifestations of spinal TB in the study participants. <bold>(A)</bold> Typical radiology of a patient with spinal TB used in this study. (<italic>a</italic>, <italic>b</italic>) X-ray front and side positions suggesting the destruction of lumbar 3 and 4 vertebral bodies. (<italic>c</italic>, <italic>d</italic>) CT sagittal view showing bone destruction in the lumbar 2, 3, and 4 vertebrae. The CT axis showed severe damage to the vertebral body. (<italic>e</italic>&#x2013;<italic>h</italic>) T1 and T2 images and axial position of MRI indicating bone destruction of the lumbar 2, 3, and 4 vertebrae, accompanied by paravertebral abscess formation. <bold>(B)</bold> Measurement of the circulating OPG levels in patients with spinal TB using a commercially available ELISA kit. Means without a common letter differ. <italic>p</italic> &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-780272-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<title>
<italic>M. tuberculosis</italic> (H37Ra-GFP) Internalized and Changed the OPG/RANKL mRNA Ratio in Osteoblasts</title>
<p>OPG, also known as osteoclastogenesis inhibitory factor (OCIF), is a glycoprotein that is expressed by various cells in humans, including osteoblasts, epithelial cells, endothelial cells, B cells, and CD4<sup>+</sup> lymphocytes (<xref ref-type="bibr" rid="B39">Sordillo and Pearse, 2003</xref>; <xref ref-type="bibr" rid="B10">Chakravarti et&#xa0;al., 2008</xref>). Based on the evidence that OPG may be involved in spinal TB, we investigated the internalization of <italic>Mtb</italic> and the change in the OPG/RANKL ratio in osteoblast cells. For quantification of <italic>Mtb</italic> internalization into host cells, GFP-expressing <italic>Mtb</italic> strains were introduced into human osteoblast cells. Cell-based fluorescence analysis indicated that <italic>Mtb</italic> was effectively internalized into human osteoblast cells (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A, B</bold>
</xref>). Treatment of <italic>Mtb</italic> also changed the OPG/RANKL mRNA ratio (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2C</bold>
</xref>).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>
<italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>) internalized human osteoblast cells and changed the receptor activator of NF-&#x3ba;B ligand (RANKL)/osteoprotegerin (OPG) ratio. <bold>(A)</bold> Fluorescence-labeled <italic>Mtb</italic> were cultured in Middlebrook 7H9 with OADC. Osteoblast cells were infected with the culture medium or <italic>Mtb</italic> for 5 h at a multiplicity of infection (MOI) of 20, and non-infected bacteria were removed by washing with phosphate-buffered saline (PBS) three times. (<italic>a</italic>) Control. (<italic>b</italic>) <italic>Mtb</italic> infection. Images are shown at &#xd7;200 original magnification. <bold>(B)</bold> Fluorescence-labeled <italic>Mtb</italic> were co-cultured in accordance with the experimental procedure described in <italic>Materials and Methods</italic>. The internalized <italic>Mtb</italic> was measured based on the increased fluorescence density. <bold>(C)</bold> Single-stranded cDNA was synthesized from the total RNA from <italic>Mtb</italic>-infected osteoblast cells, and RT-PCR was performed with the gene-specific primers described in <italic>Materials and Methods</italic>. Means without a common letter differ. <italic>p</italic> &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-780272-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<title>Functional CD40 Was Induced by <italic>Mtb</italic> Treatment in Osteoblasts</title>
<p>T-lymphocyte and macrophage infiltration is often observed in the disturbance of bone homeostasis (<xref ref-type="bibr" rid="B44">Taubman and Kawai, 2001</xref>). Our next question was focused on whether the <italic>Mtb</italic> internalized in osteoblasts acts as a co-stimulatoryfactor of T lymphocytes in terms of CD40 induction in order to influence the bone homeostasis disturbance caused by <italic>Mtb</italic>. To examine whether <italic>Mtb</italic> infection induces the CD40 mRNA, osteoblast cells were treated with medium log-phase-maintained <italic>Mtb</italic> at an MOI of 1:100 for a total of 12 h. As shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3A</bold>
</xref>, the CD40 mRNA was increased in a time-dependent manner. We subsequently examined whether this increased expression of CD40 is functional. The functionality of CD40 was assessed based on the secretion changes of the cytokine IL-6. After infection with <italic>Mtb</italic>, osteoblast cells were treated with soluble CD154/TRAP fusion protein for the ligation of CD40. As shown in <xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3B</bold>
</xref>, the ligation of CD40 caused a significantly increased secretion of IL-6 by <italic>Mtb</italic> infection in osteoblasts.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Functional CD40 molecule is induced by <italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>) infection in human osteoblast cells. <bold>(A)</bold> Quantitative real-time PCR analysis for CD40 performed on single-stranded cDNA synthesized from the total RNA from <italic>Mtb</italic>-infected osteoblast cells. <bold>(B)</bold> Interleukin 6 (IL-6) secretion after ligation of CD40 by soluble CD154 in osteoblast cells. After <italic>Mtb</italic> infection, osteoblast cells were treated with soluble CD154, and the cell culture supernatant was collected 24 h later for the analysis of IL-6 secretion. The level of IL-6 was measured using a commercially available ELISA kit. Means without a common letter differ. <italic>p</italic> &lt; 0.05. Groups that do not share a lower case letter are significantly different.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-780272-g003.tif"/>
</fig>
</sec>
<sec id="s3_4">
<title>
<italic>Mce4a</italic>-Specific Antisense LNA Gapmers (Mce4a-ASO) Reversed the Cytokine Release and Decreased the OPG Production in <italic>Mtb</italic>-Infected Osteoblasts</title>
<p>Based on the various responses of <italic>Mtb</italic>-infected osteoblasts, we wondered whether inhibition of <italic>Mycobacterium</italic> activity in osteoblasts could affect these responses. Firstly, we designed the <italic>Mce4a</italic>-specific antisense LNA gapmers (Mce4a-ASO). To confirm the specificity of Mce4a-ASO, we first examined the effects of Mce4a-ASO on the mRNA expressions of the mce family genes in <italic>Mtb</italic> culture. When the mRNA levels of the <italic>Mce1a</italic>, <italic>Mce2a</italic>, <italic>Mce3a</italic>, and <italic>Mce4a</italic> genes were measured with real-time PCR using gene-specific primers, we found that the mRNA expression of <italic>Mce4a</italic> decreased significantly in a dose-dependent manner, but those of <italic>Mce1a</italic>, <italic>Mce2a</italic>, and <italic>Mce3a</italic> were not significantly changed by Mce4a-ASO treatment (<xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>). The <italic>Mce4a</italic> gene is related to the invasion of mycobacteria into host cells and is important to the survival of bacilli in cells (<xref ref-type="bibr" rid="B33">Saini et&#xa0;al., 2008</xref>). Therefore, we subsequently investigated the effects of Mce4a-ASO on osteoblast response to <italic>Mtb</italic> internalization. After incubation of the <italic>Mtb</italic>-infected osteoblast cells with or without Mce4a-ASO (0&#x2013;10 &#xb5;M) for 48 h, we measured the number of intracellular bacteria by quantification of the colony forming units (CFU). CFU analysis indicated that Mce4a-ASO markedly decreased the intracellular numbers of mycobacteria (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>). In addition, the measurement of cytokines in the cell culture supernatant showed that the cytokine release (IL-6) caused by <italic>Mtb</italic> infection was significantly decreased by Mec4a-ASO co-treatment in osteoblasts (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). The enhanced IL-6 release by co-treatment with CD154 was also reversed by Mec4a-ASO co-treatment in osteoblast cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5C</bold>
</xref>). To determine whether the decreased OPG production in <italic>Mtb</italic>-infected osteoblasts was affected by Mec4a-ASO treatment, the production of OPG was measured using ELISA. As shown in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>, the decreased production of OPG due to <italic>Mtb</italic> infection was reversed by Mec4a-ASO co-treatment in osteoblast cells (<xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5D</bold>
</xref>).</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Newly designed <italic>Mce4a</italic> antisense locked nucleic acid (LNA) gapmer (Mce4a-ASO) specifically downregulates the expression of <italic>Mce4a</italic> in <italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>). <italic>Mtb</italic> was incubated with various concentrations (0.1&#x2013;10 &#xb5;M) of Mce4a-ASO for 48 h. Gene expression was measured by real-time PCR using gene-specific primers. <bold>(A&#x2013;D)</bold> Expression levels of <italic>Mce1a</italic> <bold>(A)</bold>, <italic>Mce2a</italic> <bold>(B)</bold>, <italic>Mce3a</italic> <bold>(C)</bold>, and <italic>Mce4a</italic> <bold>(D)</bold>. Means without a common letter differ. <italic>p</italic> &lt; 0.05. Groups that do not share a lower case letter are significantly different.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-780272-g004.tif"/>
</fig>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Mce4a-ASO reduced <italic>Mycobacterium tuberculosis</italic> (<italic>Mtb</italic>) survival and cytokine secretion in human osteoblast cells. Osteoblast cells were incubated with <italic>Mtb</italic> in the presence or absence of Mce4a-ASO (0&#x2013;10 &#xb5;M) for 48 h. <bold>(A)</bold> Representative images of the colony forming unit (CFU) Petri dishes. (<italic>a</italic>) <italic>Mtb</italic> only. (<italic>b</italic>) <italic>Mtb</italic> infection with 0.1 &#xb5;M Mce4a-ASO. (<italic>c</italic>) <italic>Mtb</italic> infection with 1 &#xb5;M Mce4a-ASO. (<italic>d</italic>) <italic>Mtb</italic> infection with 10 &#xb5;M Mce4a-ASO. <bold>(B)</bold> The number of bacterial colonies was determined using ImageLab<sup>&#xae;</sup> software. <bold>(C)</bold> The secretion level of interleukin 6 (IL-6) was measured using a commercially available ELISA kit. <bold>(D)</bold> Osteoprotegerin produced by osteoblasts was measured using a commercially available ELISA kit according to the manufacturer&#x2019;s protocol. Means without a common letter differ. <italic>p</italic> &lt; 0.05.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-780272-g005.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<title>Discussion</title>
<p>In this study, we investigated the involvement of osteoblasts in <italic>Mtb</italic>-triggered disturbance of bone homeostasis in spinal TB. Analysis of the circulating OPG content in patients with spinal TB showed significantly decreased levels when compared to those in non-spinal TB patients. In <italic>in vitro</italic> studies using human osteoblast cells, <italic>Mtb</italic> exhibited efficient internalization into cells and triggered functional CD40 expression. Treatment with <italic>Mce4a</italic>-specific antisense LNA oligonucleotides significantly decreased the bacterial load in <italic>Mtb</italic>-infected osteoblasts, and the key cytokine (IL-6) release was also significantly decreased by Mce4a-ASO co-treatment.</p>
<p>With thousands of years of infection history, tuberculosis remains a modern and life-threatening health problem. According to the WHO report, an estimated 10 million incidents of TB cases and 1.5 million TB deaths occurred globally in 2018. Bone and joint involvement accounts for approximately 10% of extrapulmonary tuberculosis cases, and the spine is the most commonly affected site. Progressive bone destruction will ultimately lead to vertebral collapse and kyphosis in patients with spinal TB. Several lines of evidence have suggested that the RANLK/RANK/OPG system contributes to bone homeostasis disturbance (<xref ref-type="bibr" rid="B2">Baud&#x2019;huin et&#xa0;al., 2007</xref>; <xref ref-type="bibr" rid="B6">Boyce and Xing, 2007</xref>; <xref ref-type="bibr" rid="B30">Ominsky et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B46">Tobeiha et&#xa0;al., 2020</xref>). In the present study, the circulating OPG levels were significantly decreased in patients with spinal TB, and it has been known that RANKL is strongly activated in these patients (<xref ref-type="bibr" rid="B20">Izawa, 2015</xref>). Additionally, within normal physiological conditions, the osteoblast-derived RANKL interacted with the RANK of the osteoclast precursors and through TRAF6/NF-&#x3ba;B/NFTATC1 to activate the OPG gene. Moreover, the activated OPG featured as a soluble decoy receptor to the OPGL and competed with RANK for binding to the OPGL. Therefore, OPG functioned as an inhibitor of osteoclast maturation and osteoclast activation. Our current data showed that the internalized <italic>Mtb</italic> could disrupt RANKL/OPG homeostasis in human osteoblast cells. Therefore, these results suggest that the decreased ratio of OPG/RANKL in osteoblast cells might have contributed to the bone homeostasis disturbance in patients with spinal TB.</p>
<p>Osteoblasts are specialized mesenchymal bone marrow stromal cells that synthesize type 1 collagen, coordinate the mineralization of the skeleton, and regulate osteoclast activation (<xref ref-type="bibr" rid="B13">Dirckx et&#xa0;al., 2019</xref>). When bone-forming osteoblasts interact with bacteria, the release of cytokines and chemokines are increased. An increased cytokine release could enhance the response of T lymphocytes to inflammation (<xref ref-type="bibr" rid="B35">Schrum et&#xa0;al., 2003</xref>). The interaction of CD40 and CD154 (the CD40 ligand) is considered as an essential mechanism of the T-lymphocyte-mediated immune response to pathogens (<xref ref-type="bibr" rid="B29">Noelle, 1996</xref>). Engaging CD40 on dendritic cells using the CD40 agonist significantly enhanced the antigen-specific Th<sub>17</sub> response in mice, which means that the CD40&#x2013;CD154 pathway plays a key role in adaptive immune response against tuberculosis (<xref ref-type="bibr" rid="B37">Sia et&#xa0;al., 2017</xref>). In addition to the inflammation-related immune response, the CD40&#x2013;CD154 axis is necessary for LGC formation (<xref ref-type="bibr" rid="B34">Sakai et&#xa0;al., 2012</xref>), which is an important signature manifestation of spinal TB. These previous findings suggest that CD154-expressed T-lymphocyte-mediated interaction with CD40-expressed osteoblasts is a possible cause of the bone homeostasis disturbance brought about by <italic>Mtb</italic> infection. In the current study, we demonstrated that the expression of CD40 was significantly enhanced by the internalized mycobacterium, and the functionality of the enhanced CD40 was exhibited by co-treatment with soluble CD154 fusion protein. IL-6 secretion from osteoblasts was significantly augmented by soluble CD154, which means that the increased CD40 is functional in <italic>Mtb</italic>-infected osteoblasts and highly suggests that the enhanced functional CD40 is a possible mechanism of osteoblast-induced cytokine release.</p>
<p>The LNA-based antisense oligonucleotide is a new-generation methodology due to its characteristic of nuclease resistance, stability in plasma (<xref ref-type="bibr" rid="B48">Veedu and Wengel, 2009</xref>), and its ability to be delivered to cells without chemical transfection (<xref ref-type="bibr" rid="B51">Zhang et&#xa0;al., 2011</xref>). Previous studies showed that the mce genes have pivotal roles in the pathogenicity of <italic>Mtb</italic> by modulating the immune response of the host (<xref ref-type="bibr" rid="B35">Schrum et&#xa0;al., 2003</xref>; <xref ref-type="bibr" rid="B11">Checkley et&#xa0;al., 2011</xref>), and the reduced expression of the <italic>Mce4a</italic> gene of <italic>Mtb</italic> resulted in a significantly reduced intracellular survival of bacteria. In this study, we designed an <italic>Mce4a</italic>-specific LNA&#x2013;DNA&#x2013;LNA gapmer antisense (Mce4a-ASO) to modulate the effects of <italic>Mtb</italic> on host cells. Treatment with Mce4a-ASO caused a significantly reduced survival of <italic>Mtb</italic>, and its cytokine release also significantly changed inside osteoblast cells. These results suggest that inhibiting the <italic>Mce4a</italic> gene using an LNA-based gapmer is an effective strategy to modulating the behavior of <italic>Mtb</italic> in the disease progression of spinal TB.</p>
<p>Although the mechanism by which <italic>Mtb</italic> induces bone homeostasis disturbance is complex, a variety of molecules have been proposed as targets for therapeutic intervention. In the present study, we provided not only exploratory insights into understanding the role of <italic>Mtb</italic>-infected osteoblasts in bone homeostasis disturbance in spinal TB but also breakthrough ideas for the effective treatment of human spinal TB. Two potential limitations of this study are the relatively small total number of patients and the lack of evidence from <italic>in vivo</italic> model studies. However, this study provided substantial evidence of <italic>Mtb</italic>-infected osteoblasts in impaired bone homeostasis in spinal TB.</p>
<p>In subsequent studies, we will focus on constructing pRNA-3WJ nanoparticles that simultaneously contain CD40 RNA aptamers for targeting and <italic>Mce4a</italic>-specific ASO for modulating the behavior of <italic>Mtb</italic> and will investigate the effects on bone homeostasis disturbance in an animal model of spinal TB.</p>
</sec>
<sec id="s5" sec-type="data-availability">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.</p>
</sec>
<sec id="s6" sec-type="ethics-statement">
<title>Ethics Statement</title>
<p>The studies involving human participants were reviewed and approved by the Research Ethics Committee of the General Hospital of Ningxia Medical University. The patients/participants provided written informed consent to participate in this study.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author Contributions</title>
<p>WM: Conceptualization, Methodology. WJ: Investigation Methodology. XH: Investigation Methodology and Data curation. YS: Investigation Methodology. HY: Data curation, Writing- Original draft preparation. ZW: Funding acquisition, Supervision, Project administration, Writing- Reviewing and Editing. SS: Supervision, Project administration, Writing- Reviewing and Editing. All authors contributed to the article and approved the submitted version.</p>
</sec>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This work was supported by a National Natural Science Foundation of China (Grant No. 81460336; Grant No. 81660370) and Ningxia youth talent promotion project.</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of Interest</title>
<p>Author HY is employed by Inteliex Biomedical Corporation.</p>
<p>The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
</body>
<back>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ashiru</surname> <given-names>O. T.</given-names>
</name>
<name>
<surname>Pillay</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Sturm</surname> <given-names>A. W.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Adhesion to and Invasion of Pulmonary Epithelial Cells by the F15/LAM4/KZN and Beijing Strains of Mycobacterium Tuberculosis</article-title>. <source>J. Med. Microbiol.</source> <volume>59</volume>, <fpage>528</fpage>&#x2013;<lpage>533</lpage>. doi: <pub-id pub-id-type="doi">10.1099/jmm.0.016006-0</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baud&#x2019;huin</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Duplomb</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ruiz Velasco</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Fortun</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Heymann</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Padrines</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Key Roles of the OPG-RANK-RANKL System in Bone Oncology</article-title>. <source>Expert Rev. Anticancer Ther.</source> <volume>7</volume>, <fpage>221</fpage>&#x2013;<lpage>232</lpage>. doi: <pub-id pub-id-type="doi">10.1586/14737140.7.2.221</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bergh</surname> <given-names>J. J.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Farach-Carson</surname> <given-names>M. C.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Osteoprotegerin Expression and Secretion Are Regulated by Calcium Influx Through the L-Type Voltage-Sensitive Calcium Channel</article-title>. <source>Endocrinology</source> <volume>145</volume>, <fpage>426</fpage>&#x2013;<lpage>436</lpage>. doi: <pub-id pub-id-type="doi">10.1210/en.2003-0319</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bost</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Bento</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Petty</surname> <given-names>C. C.</given-names>
</name>
<name>
<surname>Schrum</surname> <given-names>L. W.</given-names>
</name>
<name>
<surname>Hudson</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Marriott</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Monocyte Chemoattractant Protein-1 Expression by Osteoblasts Following Infection With Staphylococcus Aureus or Salmonella</article-title>. <source>J. Interferon Cytokine Res.</source> <volume>21</volume>, <fpage>297</fpage>&#x2013;<lpage>304</lpage>. doi: <pub-id pub-id-type="doi">10.1089/107999001300177484</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bost</surname> <given-names>K. L.</given-names>
</name>
<name>
<surname>Ramp</surname> <given-names>W. K.</given-names>
</name>
<name>
<surname>Nicholson</surname> <given-names>N. C.</given-names>
</name>
<name>
<surname>Bento</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Marriott</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Hudson</surname> <given-names>M. C.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Staphylococcus Aureus Infection of Mouse or Human Osteoblasts Induces High Levels of Interleukin-6 and Interleukin-12 Production</article-title>. <source>J. Infect. Dis.</source> <volume>180</volume>, <fpage>1912</fpage>&#x2013;<lpage>1920</lpage>. doi: <pub-id pub-id-type="doi">10.1086/315138</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boyce</surname> <given-names>B. F.</given-names>
</name>
<name>
<surname>Xing</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Biology of RANK, RANKL, and Osteoprotegerin</article-title>. <source>Arthritis Res. Ther.</source> <volume>9 Suppl 1</volume>, <fpage>S1</fpage>. doi: <pub-id pub-id-type="doi">10.1186/ar2165</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bucay</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Sarosi</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Dunstan</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Morony</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Tarpley</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Capparelli</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>1998</year>). <article-title>Osteoprotegerin-Deficient Mice Develop Early Onset Osteoporosis and Arterial Calcification</article-title>. <source>Genes Dev.</source> <volume>12</volume>, <fpage>1260</fpage>&#x2013;<lpage>1268</lpage>. doi: <pub-id pub-id-type="doi">10.1101/gad.12.9.1260</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Burgess</surname> <given-names>T. L.</given-names>
</name>
<name>
<surname>Qian</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Kaufman</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Ring</surname> <given-names>B. D.</given-names>
</name>
<name>
<surname>Van</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Capparelli</surname> <given-names>C.</given-names>
</name>
<etal/>
</person-group>. (<year>1999</year>). <article-title>The Ligand for Osteoprotegerin (OPGL) Directly Activates Mature Osteoclasts</article-title>. <source>J. Cell Biol.</source> <volume>145</volume>, <fpage>527</fpage>&#x2013;<lpage>538</lpage>. doi: <pub-id pub-id-type="doi">10.1083/jcb.145.3.527</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Calderhead</surname> <given-names>D. M.</given-names>
</name>
<name>
<surname>Kosaka</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Manning</surname> <given-names>E. M.</given-names>
</name>
<name>
<surname>Noelle</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>CD40-CD154 Interactions in B-Cell Signaling</article-title>. <source>Curr. Top. Microbiol. Immunol.</source> <volume>245</volume>, <fpage>73</fpage>&#x2013;<lpage>99</lpage>. doi: <pub-id pub-id-type="doi">10.1007/978-3-642-59641-4_4</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chakravarti</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Marceau</surname> <given-names>A. A.</given-names>
</name>
<name>
<surname>Flamand</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Poubelle</surname> <given-names>P. E.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Normal Human Primary CD4+ T Lymphocytes Synthesize and Release Functional Osteoprotegerin In Vitro</article-title>. <source>Lab. Invest.</source> <volume>88</volume>, <fpage>171</fpage>&#x2013;<lpage>184</lpage>. doi: <pub-id pub-id-type="doi">10.1038/labinvest.3700701</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Checkley</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Wyllie</surname> <given-names>D. H.</given-names>
</name>
<name>
<surname>Scriba</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Golubchik</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Hill</surname> <given-names>A. V.</given-names>
</name>
<name>
<surname>Hanekom</surname> <given-names>W. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Identification of Antigens Specific to Non-Tuberculous Mycobacteria: The Mce Family of Proteins as a Target of T Cell Immune Responses</article-title>. <source>PloS One</source> <volume>6</volume>, <elocation-id>e26434</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0026434</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Datta</surname> <given-names>H. K.</given-names>
</name>
<name>
<surname>Ng</surname> <given-names>W. F.</given-names>
</name>
<name>
<surname>Walker</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Tuck</surname> <given-names>S. P.</given-names>
</name>
<name>
<surname>Varanasi</surname> <given-names>S. S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>The Cell Biology of Bone Metabolism</article-title>. <source>J. Clin. Pathol.</source> <volume>61</volume>, <fpage>577</fpage>&#x2013;<lpage>587</lpage>. doi: <pub-id pub-id-type="doi">10.1136/jcp.2007.048868</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dirckx</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Moorer</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Clemens</surname> <given-names>T. L.</given-names>
</name>
<name>
<surname>Riddle</surname> <given-names>R. C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The Role of Osteoblasts in Energy Homeostasis</article-title>. <source>Nat. Rev. Endocrinol.</source> <volume>15</volume>, <fpage>651</fpage>&#x2013;<lpage>665</lpage>. doi: <pub-id pub-id-type="doi">10.1038/s41574-019-0246-y</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Enelow</surname> <given-names>R. I.</given-names>
</name>
<name>
<surname>Sullivan</surname> <given-names>G. W.</given-names>
</name>
<name>
<surname>Carper</surname> <given-names>H. T.</given-names>
</name>
<name>
<surname>Mandell</surname> <given-names>G. L.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Induction of Multinucleated Giant Cell Formation From <italic>In Vitro</italic> Culture of Human Monocytes With Interleukin-3 and Interferon-Gamma: Comparison With Other Stimulating Factors</article-title>. <source>Am. J. Respir. Cell Mol. Biol.</source> <volume>6</volume>, <fpage>57</fpage>&#x2013;<lpage>62</lpage>. doi: <pub-id pub-id-type="doi">10.1165/ajrcmb/6.1.57</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eriksen</surname> <given-names>E. F.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Cellular Mechanisms of Bone Remodeling</article-title>. <source>Rev. Endocr. Metab. Disord.</source> <volume>11</volume>, <fpage>219</fpage>&#x2013;<lpage>227</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s11154-010-9153-1</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Graves</surname> <given-names>D. T.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Valente</surname> <given-names>A. J.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Regulated Expression of MCP-1 by Osteoblastic Cells <italic>In Vitro</italic> and In Vivo</article-title>. <source>Histol. Histopathol.</source> <volume>14</volume>, <fpage>1347</fpage>&#x2013;<lpage>1354</lpage>. doi: <pub-id pub-id-type="doi">10.14670/HH-14.1347</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haynes</surname> <given-names>D. R.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Bone Lysis and Inflammation</article-title>. <source>Inflamm Res.</source> <volume>53</volume>, <fpage>596</fpage>&#x2013;<lpage>600</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00011-004-1303-z</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoshino</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Hanada</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yamada</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Mii</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Takahashi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mitarai</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2014</year>). <article-title>Mycobacterium Tuberculosis Escapes From the Phagosomes of Infected Human Osteoclasts Reprograms Osteoclast Development <italic>via</italic> Dysregulation of Cytokines and Chemokines</article-title>. <source>Pathog. Dis.</source> <volume>70</volume>, <fpage>28</fpage>&#x2013;<lpage>39</lpage>. doi: <pub-id pub-id-type="doi">10.1111/2049-632X.12082</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hsu</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Lacey</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Dunstan</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Solovyev</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Colombero</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Timms</surname> <given-names>E.</given-names>
</name>
<etal/>
</person-group>. (<year>1999</year>). <article-title>Tumor Necrosis Factor Receptor Family Member RANK Mediates Osteoclast Differentiation and Activation Induced by Osteoprotegerin Ligand</article-title>. <source>Proc. Natl. Acad. Sci. U.S.A.</source> <volume>96</volume>, <fpage>3540</fpage>&#x2013;<lpage>3545</lpage>. doi: <pub-id pub-id-type="doi">10.1073/pnas.96.7.3540</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Izawa</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Histological Analysis of Bone Destruction in Spinal Tuberculosis</article-title>. <source>Kekkaku</source> <volume>90</volume>, <fpage>415</fpage>&#x2013;<lpage>420</lpage>.</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Khanna</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Sabharwal</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Spinal Tuberculosis: A Comprehensive Review for the Modern Spine Surgeon</article-title>. <source>Spine J.</source> <volume>19</volume>, <fpage>1858</fpage>&#x2013;<lpage>1870</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.spinee.2019.05.002</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kong</surname> <given-names>Y. Y.</given-names>
</name>
<name>
<surname>Boyle</surname> <given-names>W. J.</given-names>
</name>
<name>
<surname>Penninger</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Osteoprotegerin Ligand: A Regulator of Immune Responses and Bone Physiology</article-title>. <source>Immunol. Today</source> <volume>21</volume>, <fpage>495</fpage>&#x2013;<lpage>502</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0167-5699(00)01718-7</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kuroda</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Maruyama</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Fujii</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Sugawara</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ko</surname> <given-names>S. B.</given-names>
</name>
<name>
<surname>Yasuda</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2016</year>). <article-title>Osteoprotegerin Regulates Pancreatic Beta-Cell Homeostasis Upon Microbial Invasion</article-title>. <source>PloS One</source> <volume>11</volume>, <elocation-id>e0146544</elocation-id>. doi: <pub-id pub-id-type="doi">10.1371/journal.pone.0146544</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sarosi</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>X.-Q.</given-names>
</name>
<name>
<surname>Morony</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Capparelli</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Tan</surname> <given-names>H.-L.</given-names>
</name>
<etal/>
</person-group>. (<year>2000</year>). <article-title>RANK Is the Intrinsic Hematopoietic Cell Surface Receptor That Controls Osteoclastogenesis and Regulation of Bone Mass and Calcium Metabolism</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>97</volume>, <fpage>1566</fpage>&#x2013;<lpage>1571</lpage>. doi: <pub-id pub-id-type="doi">10.1073/pnas.97.4.1566</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Malik</surname> <given-names>Z. A.</given-names>
</name>
<name>
<surname>Denning</surname> <given-names>G. M.</given-names>
</name>
<name>
<surname>Kusner</surname> <given-names>D. J.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Inhibition of Ca(2+) Signaling by Mycobacterium Tuberculosis is Associated With Reduced Phagosome-Lysosome Fusion and Increased Survival Within Human Macrophages</article-title>. <source>J. Exp. Med.</source> <volume>191</volume>, <fpage>287</fpage>&#x2013;<lpage>302</lpage>. doi: <pub-id pub-id-type="doi">10.1084/jem.191.2.287</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Morony</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Capparelli</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Shimamoto</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Boone</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Lacey</surname> <given-names>D. L.</given-names>
</name>
<etal/>
</person-group>. (<year>1999</year>). <article-title>A Chimeric Form of Osteoprotegerin Inhibits Hypercalcemia and Bone Resorption Induced by IL-1beta, TNF-Alpha, PTH, PTHrP, and 1, 25(OH)2D3</article-title>. <source>J. Bone Miner. Res.</source> <volume>14</volume>, <fpage>1478</fpage>&#x2013;<lpage>1485</lpage>. doi: <pub-id pub-id-type="doi">10.1359/jbmr.1999.14.9.1478</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mundy</surname> <given-names>G. R.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Osteoporosis and Inflammation</article-title>. <source>Nutr. Rev.</source> <volume>65</volume>, <fpage>S147</fpage>&#x2013;<lpage>S151</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1753-4887.2007.tb00353.x</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Netea</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Meer</surname> <given-names>J. W.</given-names>
</name>
<name>
<surname>Verschueren</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Kullberg</surname> <given-names>B. J.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>CD40/CD40 Ligand Interactions in the Host Defense Against Disseminated Candida Albicans Infection: The Role of Macrophage-Derived Nitric Oxide</article-title>. <source>Eur. J. Immunol.</source> <volume>32</volume>, <fpage>1455</fpage>&#x2013;<lpage>1463</lpage>. doi: <pub-id pub-id-type="doi">10.1002/1521-4141(200205)32:5&lt;1455::AID-IMMU1455&gt;3.0.CO;2-C</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Noelle</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>CD40 and its Ligand in Host Defense</article-title>. <source>Immunity</source> <volume>4</volume>, <fpage>415</fpage>&#x2013;<lpage>419</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S1074-7613(00)80408-2</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ominsky</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Asuncion</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>Barrero</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Warmington</surname> <given-names>K. S.</given-names>
</name>
<name>
<surname>Dwyer</surname> <given-names>D.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>RANKL Inhibition With Osteoprotegerin Increases Bone Strength by Improving Cortical and Trabecular Bone Architecture in Ovariectomized Rats</article-title>. <source>J. Bone Miner. Res.</source> <volume>23</volume>, <fpage>672</fpage>&#x2013;<lpage>682</lpage>. doi: <pub-id pub-id-type="doi">10.1359/jbmr.080109</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Roberts</surname> <given-names>E. A.</given-names>
</name>
<name>
<surname>Clark</surname> <given-names>A.</given-names>
</name>
<name>
<surname>McBeth</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Friedman</surname> <given-names>R. L.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Molecular Characterization of the Eis Promoter of Mycobacterium Tuberculosis</article-title>. <source>J. Bacteriol.</source> <volume>186</volume>, <fpage>5410</fpage>&#x2013;<lpage>5417</lpage>. doi: <pub-id pub-id-type="doi">10.1128/JB.186.16.5410-5417.2004</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Rowe</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Koller</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <source>Physiology, Bone Remodeling</source> (<publisher-loc>Treasure Island (FL</publisher-loc>: <publisher-name>StatPearls</publisher-name>).</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saini</surname> <given-names>N. K.</given-names>
</name>
<name>
<surname>Sharma</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chandolia</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Pasricha</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Brahmachari</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Bose</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Characterization of Mce4A Protein of Mycobacterium Tuberculosis: Role in Invasion and Survival</article-title>. <source>BMC Microbiol.</source> <volume>8</volume>, <fpage>200</fpage>. doi: <pub-id pub-id-type="doi">10.1186/1471-2180-8-200</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sakai</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Okafuji</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Nishikomori</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Abe</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Izawa</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Kambe</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>The CD40-CD40L Axis and IFN-Gamma Play Critical Roles in Langhans Giant Cell Formation</article-title>. <source>Int. Immunol.</source> <volume>24</volume>, <fpage>5</fpage>&#x2013;<lpage>15</lpage>. doi: <pub-id pub-id-type="doi">10.1093/intimm/dxr088</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schrum</surname> <given-names>L. W.</given-names>
</name>
<name>
<surname>Marriott</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Butler</surname> <given-names>B. R.</given-names>
</name>
<name>
<surname>Thomas</surname> <given-names>E. K.</given-names>
</name>
<name>
<surname>Hudson</surname> <given-names>M. C.</given-names>
</name>
<name>
<surname>Bost</surname> <given-names>K. L.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Functional CD40 Expression Induced Following Bacterial Infection of Mouse and Human Osteoblasts</article-title>. <source>Infect. Immun.</source> <volume>71</volume>, <fpage>1209</fpage>&#x2013;<lpage>1216</lpage>. doi: <pub-id pub-id-type="doi">10.1128/IAI.71.3.1209-1216.2003</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shibuya</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Hirata</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Omuta</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sugamata</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Katori</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Saito</surname> <given-names>N.</given-names>
</name>
<etal/>
</person-group>. (<year>2005</year>). <article-title>Granuloma and Cryptococcosis</article-title>. <source>J. Infect. Chemother.</source> <volume>11</volume>, <fpage>115</fpage>&#x2013;<lpage>122</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10156-005-0387-X</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sia</surname> <given-names>J. K.</given-names>
</name>
<name>
<surname>Bizzell</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Madan-Lala</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Rengarajan</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Engaging the CD40-CD40L Pathway Augments T-Helper Cell Responses and Improves Control of Mycobacterium Tuberculosis Infection</article-title>. <source>PloS Pathog.</source> <volume>13</volume>, <fpage>e1006530</fpage>. doi: <pub-id pub-id-type="doi">10.1371/journal.ppat.1006530</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Simonet</surname> <given-names>W. S.</given-names>
</name>
<name>
<surname>Lacey</surname> <given-names>D. L.</given-names>
</name>
<name>
<surname>Dunstan</surname> <given-names>C. R.</given-names>
</name>
<name>
<surname>Kelley</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Luthy</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>1997</year>). <article-title>Osteoprotegerin: A Novel Secreted Protein Involved in the Regulation of Bone Density</article-title>. <source>Cell</source> <volume>89</volume>, <fpage>309</fpage>&#x2013;<lpage>319</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0092-8674(00)80209-3</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sordillo</surname> <given-names>E. M.</given-names>
</name>
<name>
<surname>Pearse</surname> <given-names>R. N.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>RANK-Fc: A Therapeutic Antagonist for RANK-L in Myeloma</article-title>. <source>Cancer</source> <volume>97</volume>, <fpage>802</fpage>&#x2013;<lpage>812</lpage>. doi: <pub-id pub-id-type="doi">10.1002/cncr.11134</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stout</surname> <given-names>R. D.</given-names>
</name>
<name>
<surname>Suttles</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Xu</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Grewal</surname> <given-names>I. S.</given-names>
</name>
<name>
<surname>Flavell</surname> <given-names>R. A.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Impaired T Cell-Mediated Macrophage Activation in CD40 Ligand-Deficient Mice</article-title>. <source>J. Immunol.</source> <volume>156</volume>, <fpage>8</fpage>&#x2013;<lpage>11</lpage>.</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taichman</surname> <given-names>R. S.</given-names>
</name>
<name>
<surname>Emerson</surname> <given-names>S. G.</given-names>
</name>
</person-group> (<year>1994</year>). <article-title>Human Osteoblasts Support Hematopoiesis Through the Production of Granulocyte Colony-Stimulating Factor</article-title>. <source>J. Exp. Med.</source> <volume>179</volume>, <fpage>1677</fpage>&#x2013;<lpage>1682</lpage>. doi: <pub-id pub-id-type="doi">10.1084/jem.179.5.1677</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takashima</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Ohnishi</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Tsuyuguchi</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Kishimoto</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>1993</year>). <article-title>Differential Regulation of Formation of Multinucleated Giant Cells From Concanavalin A-Stimulated Human Blood Monocytes by IFN-Gamma and IL-4</article-title>. <source>J. Immunol.</source> <volume>150</volume>, <fpage>3002</fpage>&#x2013;<lpage>3010</lpage>.</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tanaka</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Nakayamada</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Okada</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Osteoblasts and Osteoclasts in Bone Remodeling and Inflammation</article-title>. <source>Curr. Drug Targets Inflamm Allergy</source> <volume>4</volume>, <fpage>325</fpage>&#x2013;<lpage>328</lpage>. doi: <pub-id pub-id-type="doi">10.2174/1568010054022015</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Taubman</surname> <given-names>M. A.</given-names>
</name>
<name>
<surname>Kawai</surname> <given-names>T.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Involvement of T-Lymphocytes in Periodontal Disease and in Direct and Indirect Induction of Bone Resorption</article-title>. <source>Crit. Rev. Oral. Biol. Med.</source> <volume>12</volume>, <fpage>125</fpage>&#x2013;<lpage>135</lpage>. doi: <pub-id pub-id-type="doi">10.1177/10454411010120020301</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Thompson</surname> <given-names>W. R.</given-names>
</name>
<name>
<surname>Rubin</surname> <given-names>C. T.</given-names>
</name>
<name>
<surname>Rubin</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Mechanical Regulation of Signaling Pathways in Bone</article-title>. <source>Gene</source> <volume>503</volume>, <fpage>179</fpage>&#x2013;<lpage>193</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.gene.2012.04.076</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tobeiha</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Moghadasian</surname> <given-names>M. H.</given-names>
</name>
<name>
<surname>Amin</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Jafarnejad</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>RANKL/RANK/OPG Pathway: A Mechanism Involved in Exercise-Induced Bone Remodeling</article-title>. <source>BioMed. Res. Int.</source> <volume>2020</volume>, <fpage>6910312</fpage>. doi: <pub-id pub-id-type="doi">10.1155/2020/6910312</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>van Kooten</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Immune Regulation by CD40-CD40-L Interactions - 2; Y2K Update</article-title>. <source>Front. Biosci.</source> <volume>5</volume>, <fpage>D880</fpage>&#x2013;<lpage>D693</lpage>. doi: <pub-id pub-id-type="doi">10.2741/A557</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Veedu</surname> <given-names>R. N.</given-names>
</name>
<name>
<surname>Wengel</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Locked Nucleic Acid as a Novel Class of Therapeutic Agents</article-title>. <source>RNA Biol.</source> <volume>6</volume>, <fpage>321</fpage>&#x2013;<lpage>323</lpage>. doi: <pub-id pub-id-type="doi">10.4161/rna.6.3.8807</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wright</surname> <given-names>K. M.</given-names>
</name>
<name>
<surname>Friedland</surname> <given-names>J. S.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Differential Regulation of Chemokine Secretion in Tuberculous and Staphylococcal Osteomyelitis</article-title>. <source>J. Bone Miner. Res.</source> <volume>17</volume>, <fpage>1680</fpage>&#x2013;<lpage>1690</lpage>. doi: <pub-id pub-id-type="doi">10.1359/jbmr.2002.17.9.1680</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Bai</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Mycobacterium Tuberculosis 10-kDa Co-Chaperonin Regulates the Expression Levels of Receptor Activator of Nuclear Factor-kappaB Ligand and Osteoprotegerin in Human Osteoblasts</article-title>. <source>Exp. Ther. Med.</source> <volume>9</volume>, <fpage>919</fpage>&#x2013;<lpage>924</lpage>. doi: <pub-id pub-id-type="doi">10.3892/etm.2014.2153</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Qu</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Liao</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Kraft</surname> <given-names>P.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Down-Modulation of Cancer Targets Using Locked Nucleic Acid (LNA)-Based Antisense Oligonucleotides Without Transfection</article-title>. <source>Gene Ther.</source> <volume>18</volume>, <fpage>326</fpage>&#x2013;<lpage>333</lpage>. doi: <pub-id pub-id-type="doi">10.1038/gt.2010.133</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>