<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell. Infect. Microbiol.</journal-id>
<journal-title>Frontiers in Cellular and Infection Microbiology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell. Infect. Microbiol.</abbrev-journal-title>
<issn pub-type="epub">2235-2988</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fcimb.2022.1110684</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cellular and Infection Microbiology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>A droplet digital PCR assay for detection and quantification of <italic>Verticillium nonalfalfae</italic> and <italic>V. albo-atrum</italic>
</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Di</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1871769"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Enliang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="author-notes" rid="fn003">
<sup>&#x2020;</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1892075"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Liu</surname>
<given-names>Haiyang</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/677954"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Jin</surname>
<given-names>Xi</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Niu</surname>
<given-names>Chunyan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Gao</surname>
<given-names>Yunhua</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2106711"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Su</surname>
<given-names>Xiaofeng</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/354485"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Center for Advanced Measurement Science, National Institute of Metrology</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Institute of Grain Crops, Xinjiang Academy of Agricultural Sciences</institution>, <addr-line>Urumqi</addr-line>, <country>China</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences</institution>, <addr-line>Urumqi</addr-line>, <country>China</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Hebei Technology Innovation Center for Green Management of Soil-Borne Diseases, Baoding University</institution>, <addr-line>Hebei</addr-line>, <country>China</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Biotechnology Research Institute, Chinese Academy of Agricultural Sciences</institution>, <addr-line>Beijing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Tingting Dai, Nanjing Forestry University, China</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Mir Muhammad Nizamani, Guizhou University, China; Danyu Shen, Nanjing Agricultural University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Yunhua Gao, <email xlink:href="mailto:gaoyh@nim.ac.cn">gaoyh@nim.ac.cn</email>; Xiaofeng Su, <email xlink:href="mailto:suxiaofeng@caas.cn">suxiaofeng@caas.cn</email>
</p>
</fn>
<fn fn-type="equal" id="fn003">
<p>&#x2020;These authors have contributed equally to this work</p>
</fn>
<fn fn-type="other" id="fn002">
<p>This article was submitted to Fungal Pathogenesis, a section of the journal Frontiers in Cellular and Infection Microbiology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>11</day>
<month>01</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>12</volume>
<elocation-id>1110684</elocation-id>
<history>
<date date-type="received">
<day>29</day>
<month>11</month>
<year>2022</year>
</date>
<date date-type="accepted">
<day>20</day>
<month>12</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Wang, Liu, Liu, Jin, Niu, Gao and Su</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Wang, Liu, Liu, Jin, Niu, Gao and Su</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>
<italic>Verticillium nonalfalfae</italic> and <italic>V. albo-atrum</italic> are notorious pathogenic fungi that cause a destructive vascular disease called Verticillium wilt worldwide. Thus, timely and quantitative monitoring of fungal progression is highly desirable for early diagnosis and risk assessment. In this study, we developed a droplet digital polymerase chain reaction (ddPCR) assay to detect and quantify <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>. The performance of this assay was validated in comparison with that of a quantitative real-time polymerase chain reaction (qPCR) assay. The standard curve analysis of the ddPCR assay showed good linearity. The ddPCR assay indicated similar detection sensitivity to that of qPCR on pure genomic DNA, while it enhanced the positive rate for low-abundance fungi, especially in alfalfa stems. Receiver operating characteristic analysis revealed that ddPCR provided superior diagnostic performance on field tissues compared to qPCR, and the area under curve values were 0.94 and 0.90 for alfalfa roots and stems, respectively. Additionally, the quantitative results of the two methods were highly concordant (roots: R<sup>2</sup> = 0.91; stems: R<sup>2</sup> = 0.76); however, the concentrations determined by ddPCR were generally higher than those determined by qPCR. This discrepancy was potentially caused by differing amplification efficiencies for qPCR between cultured and field samples. Furthermore, the ddPCR assays appreciably improved quantitative precision, as reflected by lower coefficients of variation. Overall, the ddPCR method enables sensitive detection and accurate quantification of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, providing a valuable tool for evaluating disease progression and enacting effective disease control.</p>
</abstract>
<kwd-group>
<kwd>droplet digital PCR</kwd>
<kwd>quantitative real-time PCR</kwd>
<kwd>diagnostic performance</kwd>
<kwd>accuracy</kwd>
<kwd>precision</kwd>
</kwd-group>
<counts>
<fig-count count="8"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="40"/>
<page-count count="13"/>
<word-count count="4892"/>
</counts>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Verticillium wilt (VW), a major vascular plant disease, causes considerable yield and economic losses worldwide. Typical symptoms of VW are plant stunting, discoloration, wilting, and eventual mortality (<xref ref-type="bibr" rid="B20">Klosterman et&#xa0;al., 2011</xref>). VW is caused by soil-borne and pathogenic <italic>Verticillium</italic> spp., mainly <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, which both have a broad host range (<xref ref-type="bibr" rid="B28">Pegg and Brady, 2002</xref>). <italic>V. nonalfalfae</italic> (a relatively new species in the genus) can infect potato, spinach, solanaceous crops, and trees (<xref ref-type="bibr" rid="B10">Flajsman et&#xa0;al., 2017</xref>). The primary hosts of <italic>V. albo-atrum</italic> are cotton, potato, tomato, hop, ornamental plants, fruit trees, and, especially, alfalfa. Among of them, alfalfa, an important forage resource with high yield and good palatability, is widely planted around the world and known as &#x201c;the king of forage&#x201d;. In the United States and Canada, VW is among the most destructive diseases in alfalfa (<xref ref-type="bibr" rid="B22">Larsen et&#xa0;al., 2007</xref>). The quarantine of all the alfalfa products from abroad was forcible in China (Announcement No. 351 of the Ministry of Agriculture and Rural Affairs of PRC, 2020). In the field, dormant structures (microsclerotia) are triggered to germinate by exudates from the roots of the host plant. Subsequently, hyphae infect the host through the root hairs or lateral roots (<xref ref-type="bibr" rid="B13">Fradin and Thomma, 2006</xref>). After invading the xylem vessels, the hyphae infest the adjacent vasculature and grow along the vascular system toward the tip of the plant (<xref ref-type="bibr" rid="B40">Zhao et&#xa0;al., 2014</xref>; <xref ref-type="bibr" rid="B35">Su et&#xa0;al., 2018</xref>). Ultimately, the pathogen reproduces and blocks the vascular system, interfering with the transport of water throughout the host and causing wilt symptoms (<xref ref-type="bibr" rid="B11">Floerl et&#xa0;al., 2008</xref>; <xref ref-type="bibr" rid="B37">Wang et&#xa0;al., 2021</xref>).</p>
<p>Given the tremendously devastating effects and the difficulty of prevention, developing an accurate method to qualitatively and quantitively detect these two fungi provides an effective and economical management strategy. Traditional methods of isolation and biological assays have long operation cycles, poor time efficiency, and relatively low sensitivity, and immunological methods exhibit cross-reactivity, poor reproducibility, and cumbersome operation steps (<xref ref-type="bibr" rid="B19">Isaac, 1946</xref>; <xref ref-type="bibr" rid="B34">Skadow, 1966</xref>; <xref ref-type="bibr" rid="B16">Griffiths, 1971</xref>). Recently, quantitative real-time polymerase chain reaction (qPCR) assays have been widely implemented for pathogen load testing, with greatly improved sensitivity and shortened detection times (<xref ref-type="bibr" rid="B26">Pasche et&#xa0;al., 2013</xref>). However, quantification by qPCR depends on external standard curves, which are a major source of variability (<xref ref-type="bibr" rid="B4">Bustin et&#xa0;al., 2009</xref>). In practice, applicable reference standards are often not readily available except for the most common target analytes; furthermore, qPCR efficiency often varies within and between laboratories (<xref ref-type="bibr" rid="B36">Svec et&#xa0;al., 2015</xref>). Thus, a lack of standardization and relatively poor measurement precision limits its usefulness.</p>
<p>Digital polymerase chain reaction (dPCR) is an emerging technique that performs absolute quantification by counting nucleic acid molecules, providing a simple, standardized quantification strategy (<xref ref-type="bibr" rid="B18">Huggett et&#xa0;al., 2015</xref>). It has potentially unique advantages over qPCR, including absolute quantification in a &#x201c;calibration-free&#x201d; manner and robustness to variations in PCR efficiency (<xref ref-type="bibr" rid="B33">Sanders et&#xa0;al., 2011</xref>). Furthermore, sample partitioning enables dPCR to tolerate inhibitors and decreases background noise, thereby reducing false negatives (<xref ref-type="bibr" rid="B1">Alikian et&#xa0;al., 2017</xref>). Additionally, perhaps most importantly, dPCR is reported to improve accuracy and precision in quantification in comparison with qPCR (<xref ref-type="bibr" rid="B30">Pinheiro et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B17">Hindson et&#xa0;al., 2013</xref>). Therefore, digital PCR technique holds promise as a highly sensitive and accurate measurement method (<xref ref-type="bibr" rid="B2">Baker, 2012</xref>).</p>    <p>Although dPCR is increasingly utilized to quantify target nucleic acids in various fields (<xref ref-type="bibr" rid="B39">Whale et&#xa0;al., 2012</xref>; <xref ref-type="bibr" rid="B9">F&#xe9;lix-Urqu&#xed;dez et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B32">Salipante and Jerome, 2020</xref>), its application for the quantitative detection of plant pathogens has been limited; moreover, the systematic evaluation of its performance against a background matrix is understudied. In this study, we established and validated a sensitive and accurate droplet digital PCR (ddPCR) system for the detection and quantification of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, to explore whether this method has the advantages over the analog qPCR assay for plant pathogen diagnosis. Key performance parameters, including diagnostic performance, detection sensitivity, quantitative agreement, accuracy, and repeatability regarding field samples, for the ddPCR assay were assessed in comparison with standard qPCR.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Fungal, bacterial, soil, and plant samples</title>
<p>The <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> strains were stored in our laboratory. Eight fungal isolates (<italic>Exserohilum turcicum</italic>, <italic>V. nigrescens</italic>, <italic>Magnaporthe oryzae</italic>, <italic>Bipolaris maydis</italic>, <italic>Rhizoctonia cerealis</italic>, <italic>Fusarium oxysporum</italic> f. sp. <italic>conglutinans</italic>, <italic>Ustilaginoidea virens</italic>, and <italic>Fusarium pseudograminearum</italic>) and five bacterial isolates (<italic>Acidovorax citrulli</italic>, <italic>Xanthomonas oryzae</italic> pv. <italic>oryzae</italic>, <italic>Pseudomonas syringae</italic>, <italic>Ralstonia solanacearum</italic>, and <italic>Xanthomonas campestris</italic> pv. <italic>campestris</italic>) were obtained from the Chinese Academy of Agricultural Sciences and China Agricultural University. All samples were stored in 25% glycerol at -80&#xb0;C.</p>
<p>Samples of alfalfa stems and roots were collected in an experimental field (Langfang, Hebei Province, China, 39&#xb0;51&#x2019;N, 116&#xb0;60&#x2019;E) and quickly frozen in liquid nitrogen. The plot had been sampled and tested numerous times previously for infection by <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>; therefore, the infection status of each alfalfa plant was known.</p>
<p>We excised 200 mg fresh alfalfa stems and roots from each sample, respectively. They were each homogenized separately in 4 mL lysis buffer. Nucleic acid quality and quantity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).</p>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Phylogenetic tree construction</title>
<p>The internal transcribed spacer regions (ITS) sequences of <italic>V. albo-atrum</italic> (MH856937.1), <italic>V. nonalfalfae</italic> (KT362917.1), <italic>V. alfalfae</italic> (NR 126129.1), <italic>V. longisporum</italic> (MH864843.1), <italic>V. nubilum</italic> (MH856939.1), <italic>Ilyonectria radicicola</italic> (KM503139.1), <italic>V. dahliae</italic> (MH864842.1), <italic>Volutella ciliata</italic> (JQ647447.1), <italic>V. zaregamsianum</italic> (JN188008.1), <italic>V. tricorpus</italic> (MH857388.1), <italic>V. klebahnii</italic> (NR 126128.1), <italic>V. tricorpus</italic> (GO336726.1), <italic>Acremonium nepalense</italic> (LR590100.1), <italic>Plectosphaerella cucumerina</italic> (KM357306.1), and <italic>Brunneochlamydosporium nepalense</italic> (MH860634.1) were downloaded from the National Center for Biological Information (<uri xlink:href="https://www.ncbi.nlm.nih.gov/">https://www.ncbi.nlm.nih.gov/</uri>). To construct a phylogenetic tree, the ITS sequences were compared using the ClustalW program (<uri xlink:href="http://www.clustal.org/clustal2/">http://www.clustal.org/clustal2/</uri>), and the neighbor-joining approach was applied using the MEGA software (version 7.0.26, Auckland, New Zealand).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>DNA extraction</title>
<p>The biological samples were re-cultured in complete medium and Luria-Bertani liquid medium at temperatures of 25&#xb0;C and 37&#xb0;C, respectively. Samples were harvested by centrifugation at 3000 &#xd7;g for 10&#xa0;min. Subsequently, DNA was extracted following the manufacturer&#x2019;s instructions (KG203; Tiangen, Beijing, China). DNA was extracted from alfalfa stems following the instructions of the Hi-DNAsecure Plant Kit (DP350; Tiangen, Beijing, China). Genomic DNA was isolated from the soil samples using a TIANamp Soil DNA Kit according to the manufacturer&#x2019;s protocol (DP336; Tiangen, Beijing, China). The quality and concentration of genomic DNA were detected <italic>via</italic> 1% agarose gel electrophoresis and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Subsequently, samples were aliquoted and stored in refrigerator at -80&#xb0;C.</p>
<p>The ITS sequences were amplified with the primers 5&#x2019;-TCCGTAGGTGAACCTGCGG-3&#x2019; and 5&#x2019;-TCCTCCGCTTATTGATATGC-3&#x2019; in <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> strains and sequenced by Sangon Biotech Co., Ltd. (Shanghai, China). The results were aligned using the Basic Local Alignment Search Tool (<uri xlink:href="https://blast.ncbi.nlm.nih.gov/Blast.cgi">https://blast.ncbi.nlm.nih.gov/Blast.cgi</uri>).</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Primer and probe assessment</title>
<p>The primer/probe sets used in the qPCR and ddPCR experiments (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) were preliminarily screened and evaluated to confirm the complete identity using only the target sequences.</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Primers and probes used in this study.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Name</th>
<th valign="middle" align="center">Target</th>
<th valign="middle" align="center">Oligo sequence (5&#x2019;-3&#x2019;)</th>
<th valign="middle" align="center">Product length (bp)</th>
<th valign="middle" align="center">Citation</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="middle" rowspan="3" align="left">va1</td>
<td valign="middle" rowspan="3" align="center">SCAR (DQ333342)</td>
<td valign="top" align="left">F: GGCCACGCTAGCCTTCACTA</td>
<td valign="middle" rowspan="3" align="center">75</td>
<td valign="middle" rowspan="3" align="left">(<xref ref-type="bibr" rid="B22">Larsen et&#xa0;al., 2007</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">R: CGAGTTCGCGGCAGGTA</td>
</tr>
<tr>
<td valign="top" align="left">P: TTTCGACCTGCCGTGCGCG</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="left">va2</td>
<td valign="middle" rowspan="3" align="center">V357I (DQ266246.1)</td>
<td valign="top" align="left">F: GGCTTTTGCTTTCTCTTG</td>
<td valign="middle" rowspan="3" align="center">150</td>
<td valign="middle" rowspan="3" align="left">(<xref ref-type="bibr" rid="B25">Maurer et&#xa0;al., 2013</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">R: GACCAAATGTAATTGTCCAG</td>
</tr>
<tr>
<td valign="top" align="left">P: AGGTATAAGGTCCATATCCAACACGAG</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="left">va3</td>
<td valign="middle" rowspan="3" align="center">tef1a (LR026334.1)</td>
<td valign="top" align="left">F: CGTACGATTGAGAAGTTTGAGATAAGTG</td>
<td valign="middle" rowspan="3" align="center">100</td>
<td valign="middle" rowspan="3" align="left">(<xref ref-type="bibr" rid="B15">General Administration of Customs of the People's Republic of China., 2019</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">R: CGTCGGAAACCATGAAAACA</td>
</tr>
<tr>
<td valign="top" align="left">P: CTGCTTGAATCTACAC</td>
</tr>
<tr>
<td valign="middle" rowspan="3" align="left">va4</td>
<td valign="middle" rowspan="3" align="center">ITS (MH856937.1)</td>
<td valign="top" align="left">F: CCGGTACATCAGTCTCTTTA</td>
<td valign="middle" rowspan="3" align="center">330</td>
<td valign="middle" rowspan="3" align="left">(<xref ref-type="bibr" rid="B26">General Administration of Quality Supervision, Inspection and Quarantine of the People&#x2019;s Republic of China., 2014</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">R: CTCCGATGCGAGCTGTAAT</td>
</tr>
<tr>
<td valign="top" align="left">P: ATGCCTGTCCGAGCGTCGTTTCA</td>
</tr>
</tbody>
</table>
</table-wrap>
<p>Probes were synthesized and labeled with 6-carboxy-fluorescein reporter dye and black hole quencher 1 on the 5&#x2019;- and 3&#x2019;-terminal nucleotides, respectively (Sangon Biotech). The concentration was diluted to 100 &#x3bc;M as stock solution, stored at -20&#xb0;C, and diluted to 10 &#x3bc;M for the assay.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>qPCR</title>
<p>The qPCR amplification was accomplished using the ABI 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The final reaction was in a 20 &#x3bc;L volume containing 10 &#x3bc;L of 2&#xd7;AceQ Universal U+ Probe Master Mix V2 (Vazyme Biotech Co., Ltd, Nanjing, China), 0.4 &#x3bc;L each of the forward and reverse primers, 0.2 &#x3bc;L of the probe solution, 2 &#x3bc;L of genomic DNA, and 7 &#x3bc;L of nuclease-free H<sub>2</sub>O. The amplification was performed as follows: denaturation at 95&#xb0;C for 5&#xa0;min, followed by 40 cycles of denaturation at 95&#xb0;C for 10 s and annealing and elongation at 60&#xb0;C for 50 s. The cycle threshold (Ct) values were calculated using 7500 software v2.3 (Applied Biosystems, USA).</p>
<p>A standard curve for qPCR was constructed using the genomic DNA of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>. DNA concentration was measured using a NanoDrop 2000 (Thermo Scientific). The standard curve was plotted according to the Ct values from qPCR for various sample amounts, which were obtained by serial dilution of the genomic DNA of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>.</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>ddPCR reaction</title>
<p>The ddPCR assay was optimized with respect to the annealing temperature, primer concentration, and probe concentration. Temperatures of 54&#xb0;C, 56&#xb0;C, 58&#xb0;C, 60&#xb0;C, and 62&#xb0;C were examined using a Veriti&#x2122; 96-Well Thermal Cycler (Applied Biosystems, USA) with a primer/probe concentration of 500 nM/250 nM. Primer/probe concentrations of 600 nM/400 nM, 500 nM/250 nM, and 400 nM/100 nM were examined using a thermal cycler at 56&#xb0;C.</p>
<p>The ddPCR reactions were performed using 500 nM solutions of each forward and reverse primer, a 250 nM solution of the 2 &#xd7; ddPCR supermix for probes (Bio-Rad, Pleasanton, CA, USA) (after optimization), and 2 &#x3bc;L of genomic DNA. The total reaction volume was 20 &#x3bc;L. The reaction mixture was added to an 8-well cartridge using a droplet generator (Bio-Rad), and the wells were injected with 70 &#x3bc;L of droplet generation oil (Bio-Rad). The emulsion (70 &#x3bc;L) was transferred to a 96-well ddPCR plate (Bio-Rad) and amplified as follows with a ramp rate of 2&#xb0;C s<sup>&#x2212;1</sup>: denaturation at 94&#xb0;C for 10&#xa0;min, followed by 45 cycles of denaturation at 94&#xb0;C for 30 s and annealing at 56 &#xb0;C (optimized temperature) for 50 s, followed by a final denaturation at 98&#xb0;C for 10&#xa0;min. Subsequently, the 96-well plate was shifted to an QX200 droplet reader (Bio-Rad), and the data analysis was performed using QuantaSoft Version 1.7.4.0917 (Bio-Rad). The ddPCR analysis was performed in triplicate to accurately quantify the amounts of genomic DNA.</p>
</sec>
<sec id="s2_7">
<label>2.7</label>
<title>Linear regression curve of the ddPCR assay</title>
<p>Linear regression curves were constructed using ten-fold serial dilutions of genomic DNA as templates, ranging from 4 to 4 &#xd7;10<sup>4</sup> copies/reaction and 6 to 6 &#xd7;10<sup>4</sup> copies/reaction for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, respectively. Three independent experiments were performed with four reactions at each concentration. The linear regression curves were generated by plotting the copy number concentrations measured by ddPCR against the expected dilution values.</p>
</sec>
<sec id="s2_8">
<label>2.8</label>
<title>Limit of quantification and limit of detection at 95% probability</title>
<p>The limit of quantification (LoQ) was determined as the lowest concentration where all runs were positive and the coefficient of variation (CV) of the measured copy number was up to 25% (<xref ref-type="bibr" rid="B21">Kralik and Ricchi, 2017</xref>).</p>
<p>The limit of detection at 95% probability (LoD95%) was defined as the lowest concentration at which at least 95% of the replicates produced positive results, regardless of the accuracy or precision (<xref ref-type="bibr" rid="B12">Forootan et&#xa0;al., 2017</xref>). The LoD95% of each assay was estimated using a probit analysis with the target concentration (dilution level) as an explanatory variable and the positive detection rate (positive/total) as a response variable (<xref ref-type="bibr" rid="B7">Corman et&#xa0;al., 2020</xref>). The probit analysis was conducted with 95% confidence intervals (95% CI) using the SPSS software (version 20.0; SPSS, Chicago, IL, USA).</p>
<p>To obtain the LoQ and LoD95% of the ddPCR and qPCR assays, a series of two-fold dilutions of genomic DNA (from 1.1 to 294 copies/reaction for <italic>V. nonalfalfae</italic> and from 1.8 to 236 copies/reaction for <italic>V. albo-atrum</italic>) were tested to ascertain the end-point dilutions. Two independent experiments were performed over two consecutive days, with five replicates of each concentration on each day (<xref ref-type="bibr" rid="B27">Pav&#x161;i&#x10d; et&#xa0;al., 2016</xref>). These experiments were tested in parallel, and the template DNA was only frozen and thaw once. The distilled water was used as a negative control.</p>
</sec>
<sec id="s2_9">
<label>2.9</label>
<title>Analytical specificity evaluation</title>
<p>A specificity evaluation panel was used to explore the specificity of the ddPCR assays for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> and included the eight fungal and five bacterial isolates listed in the &#x201c;Fungal, bacterial, soil, and plant samples&#x201d; section above.</p>
</sec>
<sec id="s2_10">
<label>2.10</label>
<title>Evaluation of diagnostic performance, quantitative agreement, and precision with filed samples</title>
<p>Receiver operating characteristic (ROC) curves were generated to compare the diagnostic performance of the ddPCR and qPCR assays. True positive alfalfa roots and stems that were infected with <italic>V. nonalfalfae</italic> or <italic>V. albo-atrum</italic> were used to generate the ROC curves based on previous data. ROC curves were constructed using the SPSS software (version 20.0; SPSS, Chicago, IL, USA).</p>
<p>Quantitative agreement between ddPCR and qPCR was investigated using the method of Bland and Altman (<xref ref-type="bibr" rid="B3">Bland and Altman, 1986</xref>), which utilized the log<sub>10</sub>-transformed concentration of each sample. The inhibition effect of the residual matrix on both ddPCR and qPCR assays was evaluated by quantifying a constant amount of gDNA in the presence of alfalfa stem and root extracts. We spiked the reactions with the same amount of gDNA from cultured isolates (<italic>V. nonalfalfae</italic>: 1.6 &#xd7;10<sup>4</sup> ITS molecules; <italic>V. albo-atrum</italic>: 2.4&#xd7;10<sup>4</sup> ITS molecules), and 5 &#x3bc;l of extracts from healthy cotton stems and roots. The exact preparation process described by Maheshwari et&#xa0;al. (<xref ref-type="bibr" rid="B24">Maheshwari et&#xa0;al., 2017</xref>).</p>
<p>For each alfalfa field sample, CV values for ddPCR and qPCR were determined by calculating the standard deviation within each set of triplicates (n = 4) and dividing each of these by their respective average concentration values. The CV values for qPCR were determined using linear-scale copy number concentrations rather than the Ct values, which were directly comparable to those of ddPCR.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>Development of the ddPCR assay</title>
<p>To analyze the position of <italic>Verticillium</italic> in a broader fungal phylogenetic context, the phylogenetic relationships among major <italic>Verticillium</italic> spp. and other fungi were analyzed using ITS sequences. Phylogenetic analysis indicated that the 15 selected species were divided into two distinct clades, and <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> had the closest phylogenetic relationship (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1A</bold>
</xref>). This is consistent with the fact that both <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> belong to <italic>Verticillium</italic> and share a similar pathogenic mechanism that results in symptoms of plant stunting, wilting, and early senescence. Hence, we aimed to develop a ddPCR assay that enables the quantitative detection of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> simultaneously, to improve the efficiency of fungal diagnoses.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Construction of the phylogenetic tree for <italic>Verticillium</italic> and other fungi. <bold>(A)</bold> Binding sites of va4 primer/probe sets for ITS sequence in <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> genomes <bold>(B)</bold>. Phylogenetic tree was constructed based on ITS sequence of 15 species of fungi, and the numbers at the nodes exhibit confidence level.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g001.tif"/>
</fig>
<p>To develop an optimal ddPCR assay, four reported primer/probe sets targeting the different regions of the two fungi (KT362917.1 and MH856937.1 in the Genebank database) were initially validated using qPCR systems. The results showed that Va4 primer/probe set performed better than the other primer/probe sets, obtaining the target amplicons with low Ct values for both fungal samples (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S1</bold>
</xref>; <xref ref-type="supplementary-material" rid="SM1">
<bold>Figure S1</bold>
</xref>). Based on the sequence alignment, the amplification sequence of the Va4 primer/probe set was identical for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> (<xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1B</bold>
</xref>). Therefore, Va4 primer/probe set was selected for further establishment of the ddPCR assay.</p>
<p>The ddPCR reaction conditions were optimized with respect to annealing temperature and primer/probe concentrations by evaluating five temperatures (ranging from 54&#xb0;C to 62&#xb0;C) and three primer/probe concentrations (600/400 nM, 500/250 nM, and 400/100 nM). As shown in <xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2</bold>
</xref>, the optimal annealing temperature and primer/probe concentrations were 56&#xb0;C and 500/250 nM, respectively, which enabled the best separation of the positive and negative droplets, with a low abundance of &#x201c;rain&#x201d; (droplets falling between the positive and negative populations).</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Optimization of annealing temperatures and primer/probe concentrations for <italic>V. nonalfalfae</italic> <bold>(A, B)</bold> and <italic>V. albo-atrum.</italic> <bold>(C, D)</bold> The blue spots represent positive droplets, and the gray spots represent negative droplets.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g002.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>Dynamic range and specificity testing for the ddPCR assay</title>
<p>For the linear regression analysis, serial dilutions of genomic DNA extracted from the two cultured isolates were prepared. The ddPCR assays exhibited good linearity between the measured and anticipated values for each interval for <italic>V. nonalfalfae</italic> (R<sup>2</sup> = 0.9996 and 0.94&lt;Slope&lt;1.03) and <italic>V. albo-atrum</italic> (R<sup>2</sup> = 0.9997 and 0.96&lt;Slope&lt;1.04) over a dynamic range from approximately 10<sup>1</sup> to 10<sup>4</sup> copies/reaction (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3A, B</bold>
</xref>). The LoQ of the ddPCR assay was 43 and 30 copies for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, respectively, which met the criterion for a LoQ with a CV lower than 25% (<xref ref-type="fig" rid="f3">
<bold>Figures&#xa0;3C, D</bold>
</xref>).</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Linear range and precision analysis for ddPCR quantification of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>. <bold>(A, B)</bold> Linear regression of the ddPCR assays for <italic>V. nonalfalfae</italic> <bold>(A)</bold> and <italic>V. albo-atrum</italic> <bold>(B)</bold> (<italic>p</italic> &lt; 0.0001). Data are shown as mean and standard deviation for each dilution series (n =4). <bold>(C, D)</bold> Inter-assay precision profiles for ddPCR at each low-concentration dilution for <italic>V. nonalfalfae</italic> <bold>(C)</bold> and <italic>V. albo-atrum</italic> <bold>(D)</bold> The L<sub>O</sub>Q was set at the copies/reaction that corresponded to a CV of 25% (intersecting dotted lines on the plots).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g003.tif"/>
</fig>
<p>Specificity evaluation indicated that the runs were specific for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, and no cross-reactivity was observed with the other eight similar fungal and five bacterial samples (<xref ref-type="supplementary-material" rid="SM1">
<bold>Table S2</bold>
</xref>).</p>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>Comparison of the LoD95% between ddPCR and qPCR on pure genomic DNA</title>
<p>To determine the LoD95% for ddPCR and qPCR, a series of two-fold dilutions of genomic DNA of the two fungi were prepared as templates at concentrations near the detection end points determined in preliminary experiments. As shown in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref>, the probit analysis of the ddPCR assay indicated a LoD95% of 6.8 copies/reaction (95% CI: 5.1&#x2013;19.3) for <italic>V. nonalfalfae</italic> and 7.2 copies/reaction for <italic>V. albo-atrum</italic> (95% CI: 5.6&#x2013;14.2) (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4A, B</bold>
</xref>). In contrast, the estimated LoD95% values for qPCR were slightly lower, at 5.6 copies/reaction (95% CI: 4.4&#x2013;12.8) and 5.2 copies/reaction (95% CI: 4.0&#x2013;15.7) for <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>, respectively (<xref ref-type="fig" rid="f4">
<bold>Figures&#xa0;4C, D</bold>
</xref>). The results indicated that the two methods showed similar sensitivity for the pure genomic DNA of both fungi, and the resulting LoD95% values of ddPCR were slightly higher than those of qPCR for the two fungi.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Comparation of the limits of detection of the ddPCR and qPCR assays based on pure genomic DNA of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>. Probit analysis determined the LoD95% of ddPCR <bold>(A, B)</bold> and qPCR <bold>(C, D)</bold>. The <italic>y</italic> axis shows the fraction of positive results in 10 parallel reactions performed at each given concentration, which is indicated on the <italic>x</italic> axis. The inner line is a probit curve (dose-response rule). The outer lines are the 95% confidence interval (95% CI). Intersecting dotted lines indicate the dilution level where the estimated probability of detection is 95% (LoD95%).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g004.tif"/>
</fig>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Evaluation of the diagnostic performance of ddPCR on field samples in comparison with that of qPCR</title>
<p>We further investigated the applicability of ddPCR <italic>via</italic> a comparison with qPCR using field samples. We collected stems and roots from 60 alfalfa plants in the field, each including 10 healthy tissue controls and 50&#xa0;V<italic>. nonalfalfae</italic>- or <italic>V. albo-atrum</italic>-infected samples, which had been previously confirmed.</p>
<p>ROC analysis showed that for ddPCR, the area under curve (AUC) values were 0.94 (standard error 0.03, 95% CI: 0.88&#x2013;0.99) and 0.90 (standard error 0.04, 95% CI: 0.82&#x2013;0.97) for roots and stems, respectively (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5A, B</bold>
</xref>). In contrast, the AUC values for qPCR were 0.86 (standard error 0.05, 95% CI: 0.78&#x2013;0.95) and 0.76 (standard error 0.06, 95% CI: 0.63&#x2013;0.89) for roots and stems, respectively (<xref ref-type="fig" rid="f5">
<bold>Figures&#xa0;5C, D</bold>
</xref>). The AUC values of the ddPCR assays were broader than those of the qPCR assays, especially for the stems. Therefore, the ddPCR method provided a more robust diagnostic performance than that of qPCR for distinguishing the <italic>V. nonalfalfae</italic>- and <italic>V. albo-atrum</italic>-positive cases from healthy samples.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Diagnostic performance comparison between ddPCR <bold>(A, B)</bold> and qPCR <bold>(C, D)</bold> assays for the identification of healthy and infected alfalfa samples (roots and stems).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g005.tif"/>
</fig>
<p>In addition, the cut-off points of the qPCR assays were determined based on the ROC curves, with values of 36 for the stem and 35 for the root samples. Among the 50 positive cases, ten stem and eight root samples were reported to be negative by qPCR. However, six out of the ten false-negative stems and four out of the eight false-negative roots tested positive by ddPCR. Furthermore, the qPCR-negative but ddPCR-positive roots and stems had an average load of 17 and 30 copies, respectively. Hence, ddPCR showed improved detection sensitivity compared to qPCR, especially regarding stem samples.</p>
</sec>
<sec id="s3_5">
<label>3.5</label>
<title>Evaluation of the quantification performance of ddPCR on field samples in comparison with that of qPCR</title>
<p>The copy number concentrations for ddPCR and qPCR were compared using the samples that tested positive by both methods. Linear regression analysis indicated that the copy numbers determined by ddPCR correlated well with those determined by qPCR in both alfalfa tissues (roots, R<sup>2</sup> = 0.91; stems, R<sup>2</sup> = 0.76) (<xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6A, B</bold>
</xref>).</p>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Quantitative comparison between ddPCR and qPCR. <bold>(A, B)</bold> Linear regression of the copy number concentration measured by ddPCR and qPCR assays in alfalfa roots <bold>(A)</bold> and stems <bold>(B)</bold>. The grey dashed lines represent the line of equality (y = x). The 95% confidence limits (red areas) are interval estimates for the regression line. <bold>(C, D)</bold> Bland&#x2013;Altman plot analysis of the differences in log<sub>10</sub> concentration for the two methods in alfalfa roots <bold>(C)</bold> and stems <bold>(D)</bold>. The solid lines in the center indicate average differences in concentration between the two methods and the dashed lines represent 95% limits of agreement (mean &#xb1; 1.96 SD) (root, n = 42; stem, n = 40).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g006.tif"/>
</fig>
<p>Regarding quantitative agreement, ddPCR produced the higher copy numbers of ITS than qPCR in most tested samples. As shown in <xref ref-type="fig" rid="f6">
<bold>Figures&#xa0;6C, D</bold>
</xref>, Band&#x2013;Altman plots showed that the bias for the agreement ranged from -0.21 to 0.51 log<sub>10</sub> and -0.31 to 0.82 log<sub>10</sub> for roots and stems, respectively, with most points falling inside the 95% CI. The average difference in quantification between the two methods was 0.16 log<sub>10</sub> (a difference of 1.45 times on a normal scale) for roots and 0.25 log<sub>10</sub> (1.78 times) for stem samples. Moreover, the intervals defined by the 95% CI for root samples were narrower than those for stem samples. To determine whether the residual matrix of field samples caused the quantification difference, we quantified the samples that spiked with equal amounts of gDNA from cultured isolates and extracts from healthy alfalfa stems and roots. The extracts inhibited the quantification of the spiked DNA by both methods, but the concentrations determined by the ddPCR were significantly higher than qPCR (<xref ref-type="fig" rid="f7">
<bold>Figure&#xa0;7</bold>
</xref>).In addition, absolute quantification by ddPCR revealed greater precision in <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> abundance compared to those of qPCR, and the CV values were 18&#x2013;72% and 28&#x2013;76% lower than those of qPCR with respect to overall variation for alfalfa roots and stems, respectively (<xref ref-type="fig" rid="f8">
<bold>Figure&#xa0;8</bold>
</xref>).</p>
<fig id="f7" position="float">
<label>Figure&#xa0;7</label>
<caption>
<p>Influence of alfalfa root and stem extracts on quantification of <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> by ddPCR and qPCR assays. Samples spiked with an equal amount of alfalfa root and stem extracts and genomic DNA. Error bars represent the standard error of inhibition between four replicates. Asterisks (*) indicate significantly (<italic>p</italic> &lt; 0.05) different qPCR tests, compared to ddPCR.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g007.tif"/>
</fig>
<fig id="f8" position="float">
<label>Figure&#xa0;8</label>
<caption>
<p>Precision experiments comparing the ddPCR and qPCR assays using CVs for the alfalfa root and stem samples (n=4).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fcimb-12-1110684-g008.tif"/>
</fig>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>dPCR offers highly accurate and precise quantification by directly counting nucleic acid molecules and is commonly used as a reference measurement method to assign values for reference materials (<xref ref-type="bibr" rid="B9">F&#xe9;lix-Urqu&#xed;dez et&#xa0;al., 2016</xref>; <xref ref-type="bibr" rid="B23">Lee et&#xa0;al., 2022</xref>). In this study, we established a ddPCR assay to detect and quantify <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> and compared its performance with that of the qPCR assay to investigate whether this method is more reliable for pathogen diagnosis. Overall, our data suggest that, compared to those of qPCR, ddPCR exhibits higher sensitivity, accuracy, and precision for the quantitative detection of the two fungi in field samples.</p>
<p>Due to sample partitioning and the end-point PCR approach, dPCR exhibits increased tolerance to suboptimal PCR reactions, such as PCR inhibitors in the samples (<xref ref-type="bibr" rid="B8">Dingle et&#xa0;al., 2013</xref>; <xref ref-type="bibr" rid="B38">Wang et&#xa0;al., 2022</xref>). In contrast, such inhibitory substances markedly influence the amplification efficiency of qPCR, introducing significant variations in its detection sensitivity and quantification accuracy (<xref ref-type="bibr" rid="B4">Bustin et&#xa0;al., 2009</xref>).</p>
<p>For the alfalfa field samples, ddPCR was more sensitive than qPCR for diagnosing <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic> at low abundances, although the two methods had similar LoD95% values when testing pure genomic DNA. We speculate that the existence of PCR-inhibitory substances in the matrix of the field samples might have been the primary cause of the reduced detection capability of qPCR; this is in agreement with previous observations (<xref ref-type="bibr" rid="B24">Maheshwari et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B5">Cao et&#xa0;al., 2020</xref>). Interestingly, compared to qPCR, ddPCR largely increased the AUC (from 0.76 to 0.90) for alfalfa stems, whereas for root samples, the difference between the two methods was less (0.86 versus 0.94). Alfalfa stems contain more polysaccharides, a type of amplification inhibitor, than roots do; therefore, the residual matrix inhibitors might have caused these discrepancies in detection sensitivity and diagnostic performance between pure genomic DNA and field samples.</p>
<p>A major advantage of dPCR over qPCR is that it enables absolute quantification without an external calibration curve, which facilitates the robustness of dPCR to variations in PCR efficiency (<xref ref-type="bibr" rid="B33">Sanders et&#xa0;al., 2011</xref>; <xref ref-type="bibr" rid="B31">Ra&#x10d;ki et&#xa0;al., 2014</xref>). In this study, the quantitative results of the positive field samples were highly concordant between methods; nevertheless, the concentrations determined by ddPCR were generally higher than those determined by qPCR, which was also found in previous studies (<xref ref-type="bibr" rid="B24">Maheshwari et&#xa0;al., 2017</xref>; <xref ref-type="bibr" rid="B29">Persson et&#xa0;al., 2018</xref>). Notably, the inhibition analysis showed that ddPCR was more tolerant to residual matrix for the quantification of targets compared with qPCR. Thus, we speculate that the interfering substances in field samples potentially markedly reduced the amplification efficiency of the qPCR, and caused the difference in PCR efficiency between the pure genomic DNA and samples, thereby resulting in the underestimation of the target concentrations (<xref ref-type="bibr" rid="B6">Corbisier et&#xa0;al., 2015</xref>). Additionally, the ddPCR assay showed appreciably decreased intra-experiment variability than those of qPCR for the most alfalfa stems and roots we examined. Hence, these strengths enable ddPCR to overcome the drawbacks of qPCR for quantitative detection in a reproducible manner.</p>
<p>Although this study did not further validate more target genes across multiple instruments with different sample types, our approach to ddPCR evaluation provides a valuable step toward ensuring accurate and reliable analytical and field performance for the quantitative monitoring of plant pathogens. Currently, the application of dPCR is limited, largely owing to its complicated operational workflow and high cost. Considering that these issues will likely improve with ongoing technological development, we consider that dPCR methods will play an increasingly important role in sensitive and accurate quantitative detection in various fields.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>In conclusion, this study aimed to develop and validate a sensitive and accurate ddPCR assay to quantitatively detect <italic>V. nonalfalfae</italic> and <italic>V. albo-atrum</italic>. Our results demonstrate that the dPCR method is sensitive and robust for detecting field samples with low-titer pathogens and residual matrix inhibitors. Furthermore, it can provide an accurate and reproducible alternative to qPCR for diagnostic applications. Finally, dPCR is of higher metrological quality, which facilitates measurement standardization and can be used for inter-laboratory comparisons.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/<xref ref-type="supplementary-material" rid="SM1">
<bold>Supplementary Material</bold>
</xref>.</p>
</sec>
<sec id="s7" sec-type="author-contributions">
<title>Author contributions</title>
<p>Conceptualization, XS and YG. Methodology, DW and EL. Software, XJ and CN. Data curation, EL, HL, and CN. Writing-original draft preparation, review and editing, DW, YG and XS. Funding acquisition, DW, HL and XS. All authors have read and agreed to the published version of the manuscript.</p>
</sec>
</body>
<back>
<sec id="s8" sec-type="funding-information">
<title>Funding</title>
<p>This research was funded by grants from the Quality and Basic Ability Construction Project of National Institute of Metrology, China (ANL2202), the National Natural Science Foundation of China (32160624), and Central Public-interest Scientific Institution Basal Research Fund (Y2022CG05), and the Hebei Technology Innovation Center for Green Management of Soil-borne Diseases (Baoding University) (2022K01).</p>
</sec>
<sec id="s9" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s10" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11" sec-type="supplementary-material">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fcimb.2022.1110684/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fcimb.2022.1110684/full#supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet_1.docx" id="SM1" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Alikian</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Whale</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Akiki</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Piechocki</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Torrado</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Myint</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>RT-qPCR and RT-digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia</article-title>. <source>Clin. Chem.</source> <volume>63</volume>, <fpage>525</fpage>&#x2013;<lpage>531</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1373/clinchem.2016.262824</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baker</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Digital PCR hits its stride</article-title>. <source>Nat. Methods</source> <volume>9</volume>, <fpage>541</fpage>&#x2013;<lpage>544</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.2027</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bland</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Altman</surname> <given-names>D. G.</given-names>
</name>
</person-group> (<year>1986</year>). <article-title>Statistical methods for assessing agreement between two methods of clinical measurement</article-title>. <source>Lancet</source> <volume>1</volume>, <fpage>307</fpage>&#x2013;<lpage>310</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/S0140-6736(86)90837-8</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bustin</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>Benes</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Garson</surname> <given-names>J. A.</given-names>
</name>
<name>
<surname>Hellemans</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Huggett</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kubista</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2009</year>). <article-title>The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments</article-title>. <source>Clin. Chem.</source> <volume>55</volume>, <fpage>611</fpage>&#x2013;<lpage>622</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1373/clinchem.2008.112797</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Chang</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Shi</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Species identification and quantification of silver pomfret using the droplet digital PCR assay</article-title>. <source>Food Chem.</source> <volume>302</volume>, <fpage>125331</fpage>&#x2013;<lpage>125337</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.foodchem.2019.125331</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corbisier</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Pinheiro</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Mazoua</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kortekaas</surname> <given-names>A. M.</given-names>
</name>
<name>
<surname>Chung</surname> <given-names>P. Y. J.</given-names>
</name>
<name>
<surname>Gerganova</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>DNA copy number concentration measured by digital and droplet digital quantitative PCR using certified reference materials</article-title>. <source>Anal. Bioanal. Chem.</source> <volume>407</volume>, <fpage>1831</fpage>&#x2013;<lpage>1840</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00216-015-8458-z</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Corman</surname> <given-names>V. M.</given-names>
</name>
<name>
<surname>Landt</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Kaiser</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Molenkamp</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Meijer</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Chu</surname> <given-names>D. K.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Detection of 2019 novel coronavirus, (2019-nCoV) by real-time RT-PCR</article-title>. <source>Euro. Surveill.</source> <volume>25</volume>, <fpage>2000045</fpage>&#x2013;<lpage>52</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.2807/1560-7917.es.2020.25.3.2000045</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dingle</surname> <given-names>T. C.</given-names>
</name>
<name>
<surname>Sedlak</surname> <given-names>R. H.</given-names>
</name>
<name>
<surname>Cook</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Jerome</surname> <given-names>K. R.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Tolerance of droplet-digital PCR vs real-time quantitative PCR to inhibitory substances</article-title>. <source>Clin. Chem.</source> <volume>59</volume>, <fpage>1670</fpage>&#x2013;<lpage>1672</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1373/clinchem.2013.211045</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>F&#xe9;lix-Urqu&#xed;dez</surname> <given-names>D.</given-names>
</name>
<name>
<surname>P&#xe9;rez-Urquiza</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Valdez Torres</surname> <given-names>J. B.</given-names>
</name>
<name>
<surname>Le&#xf3;n-F&#xe9;lix</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Garc&#xed;a-Estrada</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Acatzi-Silva</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Development, optimization, and evaluation of a duplex droplet digital pcr assay to quantify the T-nos/hmg copy number ratio in genetically modified maize</article-title>. <source>Anal. Chem.</source> <volume>88</volume>, <fpage>812</fpage>&#x2013;<lpage>819</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/acs.analchem.5b03238</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Flajsman</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Radisek</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Javornik</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Pathogenicity assay of <italic>Verticillium nonalfalfae</italic> on hop plants</article-title>. <source>Bio Protoc.</source> <volume>7</volume>, <fpage>e2171</fpage>&#x2013;<lpage>e2180</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.21769/BioProtoc.2171</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Floerl</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Druebert</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Majcherczyk</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Karlovsky</surname> <given-names>P.</given-names>
</name>
<name>
<surname>K&#xfc;es</surname> <given-names>U.</given-names>
</name>
<name>
<surname>Polle</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Defence reactions in the apoplastic proteome of oilseed rape (<italic>Brassica napus</italic> var. napus) attenuate <italic>Verticillium longisporum</italic> growth but not disease symptoms</article-title>. <source>BMC Plant Biol.</source> <volume>8</volume>, <fpage>129</fpage>&#x2013;<lpage>129</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1186/1471-2229-8-129</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Forootan</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Sjoback</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Bjorkman</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Sjogreen</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Linz</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Kubista</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR)</article-title>. <source>Biomol. Detect Quantif.</source> <volume>12</volume>, <fpage>1</fpage>&#x2013;<lpage>6</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bdq.2017.04.001</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fradin</surname> <given-names>E. F.</given-names>
</name>
<name>
<surname>Thomma</surname> <given-names>B. P.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Physiology and molecular aspects of Verticillium wilt diseases caused by <italic>V. dahliae and V. albo-atrum</italic>
</article-title>. <source>Mol. Plant Pathol.</source> <volume>7</volume>, <fpage>71</fpage>&#x2013;<lpage>86</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1364-3703.2006.00323.x</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="book">
<person-group person-group-type="author">
<collab>General Administration of Quality Supervision, Inspection and Quarantine of the People&#x2019;s Republic of China</collab></person-group> (<year>2014</year>). <source>Detetion and identification of Verticillium albo-atrum Reinke &amp; Berthold. SN/T 1145-2014</source>.</citation>
</ref>
<ref id="B15">
<citation citation-type="book">
<person-group person-group-type="author">
<collab>General Administration of Customs of the People's Republic of China</collab></person-group> (<year>2019</year>). <source>Detetion and identification of Verticillium dahliae Kleb. SN/T</source> <page-range>5138&#x2013;2019</page-range>.</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Griffiths</surname> <given-names>D. A.</given-names>
</name>
</person-group> (<year>1971</year>). <article-title>The development of lignitubers in roots after infection by <italic>Verticillium dahliae</italic> kleb</article-title>. <source>Can. J. Microbiol.</source> <volume>17</volume>, <fpage>441</fpage>&#x2013;<lpage>444</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1139/m71-074</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hindson</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Chevillet</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Briggs</surname> <given-names>H. A.</given-names>
</name>
<name>
<surname>Gallichotte</surname> <given-names>E. N.</given-names>
</name>
<name>
<surname>Ruf</surname> <given-names>I. K.</given-names>
</name>
<name>
<surname>Hindson</surname> <given-names>B. J.</given-names>
</name>
<etal/>
</person-group>. (<year>2013</year>). <article-title>Absolute quantification by droplet digital PCR versus analog real-time PCR</article-title>. <source>Nat. Methods</source> <volume>10</volume>, <fpage>1003</fpage>&#x2013;<lpage>1005</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1038/nmeth.2633</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huggett</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Cowen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Foy</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Considerations for digital PCR as an accurate molecular diagnostic tool</article-title>. <source>Clin. Chem.</source> <volume>61</volume>, <fpage>79</fpage>&#x2013;<lpage>88</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1373/clinchem.2014.221366</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Isaac</surname> <given-names>I.</given-names>
</name>
</person-group> (<year>1946</year>). <article-title>Verticillium wilt of sainfoin</article-title>. <source>Ann. Appl. Biol.</source> <volume>33</volume>, <fpage>28</fpage>&#x2013;<lpage>34</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1111/j.1744-7348.1946.tb06269.x</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Klosterman</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Subbarao</surname> <given-names>K. V.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Veronese</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Gold</surname> <given-names>S. E.</given-names>
</name>
<name>
<surname>Thomma</surname> <given-names>B. P.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Comparative genomics yields insights into niche adaptation of plant vascular wilt pathogens</article-title>. <source>PloS Pathog.</source> <volume>7</volume>, <fpage>e1002137</fpage>&#x2013;<lpage>1002155</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.ppat.1002137</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kralik</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ricchi</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything</article-title>. <source>Front. Microbiol.</source> <volume>8</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fmicb.2017.00108</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Larsen</surname> <given-names>R. C.</given-names>
</name>
<name>
<surname>Vandemark</surname> <given-names>G. J.</given-names>
</name>
<name>
<surname>Hughes</surname> <given-names>T. J.</given-names>
</name>
<name>
<surname>Grau</surname> <given-names>C. R.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Development of a real-time polymerase chain reaction assay for quantifying <italic>Verticillium albo-atrum</italic> DNA in resistant and susceptible alfalfa</article-title>. <source>Phytopathology</source> <volume>97</volume>, <fpage>1519</fpage>&#x2013;<lpage>1525</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PHYTO-97-11-1519</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yoo</surname> <given-names>H. M.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>D. H.</given-names>
</name>
<name>
<surname>Bae</surname> <given-names>Y. K.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Development of SARS-CoV-2 packaged RNA reference material for nucleic acid testing</article-title>. <source>Anal. Bioanal. Chem.</source> <volume>414</volume>, <fpage>1773</fpage>&#x2013;<lpage>1785</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00216-021-03846-y</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maheshwari</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Selvaraj</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Hajeri</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Yokomi</surname> <given-names>R.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Application of droplet digital PCR for quantitative detection of spiroplasma citri in comparison with real time PCR</article-title>. <source>PloS One</source> <volume>12</volume>, <fpage>e0184751</fpage>&#x2013;<lpage>0184766</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1371/journal.pone.0184751</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maurer</surname> <given-names>K. A.</given-names>
</name>
<name>
<surname>Radi&#x161;ek</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Berg</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Seefelder</surname> <given-names>S.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Real-time PCR assay to detect <italic>Verticillium albo-atrum and V. dahliae</italic> in hops: Development and comparison with a standard PCR method</article-title>. <source>J. Plant Dis. Protect</source> <volume>120</volume>, <fpage>105</fpage>&#x2013;<lpage>114</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/BF03356461</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pasche</surname> <given-names>J. S.</given-names>
</name>
<name>
<surname>Mallik</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Anderson</surname> <given-names>N. R.</given-names>
</name>
<name>
<surname>Gudmestad</surname> <given-names>N. C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Development and validation of a real-time PCR assay for the quantification of <italic>Verticillium dahliae</italic> in potato</article-title>. <source>Plant Dis.</source> <volume>97</volume>, <fpage>608</fpage>&#x2013;<lpage>618</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1094/PDIS-06-12-0554-RE</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pav&#x161;i&#x10d;</surname> <given-names>J.</given-names>
</name>
<name>
<surname>&#x17d;el</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Milavec</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Assessment of the real-time PCR and different digital PCR platforms for DNA quantification</article-title>. <source>Anal. Bioanal. Chem.</source> <volume>408</volume>, <fpage>107</fpage>&#x2013;<lpage>121</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00216-015-9107-2</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Pegg</surname> <given-names>G. F.</given-names>
</name>
<name>
<surname>Brady</surname> <given-names>B. L.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Verticillium wilts</article-title> Vol. <volume>151</volume> (<publisher-name>CABI Publishing</publisher-name>), <fpage>109</fpage>&#x2013;<lpage>110</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1079/9780851995298.0000</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Persson</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Eriksson</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Lowther</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ellstrom</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Simonsson</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Comparison between RT droplet digital PCR and RT real-time PCR for quantification of noroviruses in oysters</article-title>. <source>Int. J. Food Microbiol.</source> <volume>284</volume>, <fpage>73</fpage>&#x2013;<lpage>83</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.ijfoodmicro.2018.06.022</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinheiro</surname> <given-names>L. B.</given-names>
</name>
<name>
<surname>Coleman</surname> <given-names>V. A.</given-names>
</name>
<name>
<surname>Hindson</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Herrmann</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Hindson</surname> <given-names>B. J.</given-names>
</name>
<name>
<surname>Bhat</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification</article-title>. <source>Anal. Chem.</source> <volume>84</volume>, <fpage>1003</fpage>&#x2013;<lpage>1011</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ac202578x</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ra&#x10d;ki</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Morisset</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Gutierrez-Aguirre</surname> <given-names>I.</given-names>
</name>
<name>
<surname>Ravnikar</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>One-step RT-droplet digital PCR: a breakthrough in the quantification of waterborne RNA viruses</article-title>. <source>Anal. Bioanal. Chem.</source> <volume>406</volume>, <fpage>661</fpage>&#x2013;<lpage>667</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s00216-013-7476-y</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salipante</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Jerome</surname> <given-names>K. R.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Digital PCR-an emerging technology with broad applications in microbiology</article-title>. <source>Clin. Chem.</source> <volume>66</volume>, <fpage>117</fpage>&#x2013;<lpage>123</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1373/clinchem.2019.304048</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sanders</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Huggett</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Bushell</surname> <given-names>C. A.</given-names>
</name>
<name>
<surname>Cowen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Scott</surname> <given-names>D. J.</given-names>
</name>
<name>
<surname>Foy</surname> <given-names>C. A.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Evaluation of digital PCR for absolute DNA quantification</article-title>. <source>Anal. Chem.</source> <volume>83</volume>, <fpage>6474</fpage>&#x2013;<lpage>6484</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1021/ac103230c</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Skadow</surname> <given-names>K.</given-names>
</name>
</person-group> (<year>1966</year>). <article-title>Weeds as host-plants for <italic>Verticillium albo-atrum</italic> rke. et berth. including <italic>Verticillium dahliae</italic> kleb</article-title>. <source>Zentralbl. Bakteriol. Parasitenkd Infektionskr Hyg.</source> <volume>120</volume>, <fpage>49</fpage>&#x2013;<lpage>59</lpage>.</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Su</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Rehman</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Sun</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>
<italic>mcherry</italic>-labeled <italic>Verticillium dahliae</italic> could be utilized to investigate its pathogenicity process in <italic>Nicotiana benthamiana</italic>
</article-title>. <source>Genes</source> <volume>9</volume>, <fpage>508</fpage>&#x2013;<lpage>520</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.3390/genes9100508</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Svec</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Tichopad</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Novosadova</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Pfaffl</surname> <given-names>M. W.</given-names>
</name>
<name>
<surname>Kubista</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments</article-title>. <source>Biomol. Detect Quantif.</source> <volume>3</volume>, <fpage>9</fpage>&#x2013;<lpage>16</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1016/j.bdq.2015.01.005</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>CHen</surname> <given-names>J. Y.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Klosterman</surname> <given-names>S. J.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>R.</given-names>
</name>
<etal/>
</person-group>. (<year>2021</year>). <article-title>Cytotoxic function of xylanase VdXyn4 in the plant vascular wilt pathogen <italic>Verticillium dahliae</italic>
</article-title>. <source>Plant Physiol.</source> <volume>187</volume>, <fpage>1</fpage>&#x2013;<lpage>21</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/plphys/kiab274</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Jiao</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Cheng</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Detection and quantification of <italic>Verticillium dahliae and V. longisporum</italic> by droplet digital PCR versus quantitative real-time PCR</article-title>. <source>Front. Cell Infect. Microbiol.</source> <volume>12</volume>. doi:&#xa0;<pub-id pub-id-type="doi">10.3389/fcimb.2022.995705</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Whale</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Huggett</surname> <given-names>J. F.</given-names>
</name>
<name>
<surname>Cowen</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Speirs</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Shaw</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Ellison</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2012</year>). <article-title>Comparison of microfluidic digital PCR and conventional quantitative PCR for measuring copy number variation</article-title>. <source>Nucleic Acids Res.</source> <volume>40</volume>, <fpage>e82</fpage>&#x2013;<lpage>e90</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1093/nar/gks203</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Y. L.</given-names>
</name>
<name>
<surname>Jin</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H. S.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Colonization process of <italic>Arabidopsis thaliana</italic> roots by a green fluorescent protein-tagged isolate of <italic>Verticillium dahliae</italic>
</article-title>. <source>Protein Cell</source> <volume>5</volume>, <fpage>94</fpage>&#x2013;<lpage>98</lpage>. doi:&#xa0;<pub-id pub-id-type="doi">10.1007/s13238-013-0009</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>