Wild-caught unfed I. ricinus females were collected by flagging around Ceske Budejovice, Czech Republic. All tick life stages were maintained under controlled conditions (temperature: 24°C and humidity: 95%) in the rearing facility at the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences. All laboratory animals were treated in accordance with the Animal Protection Law of the Czech Republic No. 246/1992 Sb., ethics approval No. 25/2018. The study was approved by the Institute of Parasitology, Biology Centre CAS and Central Committee for Animal Welfare, Czech Republic (Protocol No. 1/2015).

Wild-caught Ixodes ricinus adult females were fed defibrinated bovine blood via an ex vivo membrane feeding system (Kröber and Guerin, 2007). Every 12 hours for a period of 10 days, the feeding chambers were washed with a multipurpose disinfectant, 0.5% (w/v) Virkon S (Chemours), followed by a sterile solution NaCl (0.9%) and placed in clean cell culture plate-wells filled with 3.1 mL of fresh blood supplemented with 50 µg/mL or 5 µg/mL tetracycline (Sigma-Aldrich: T3383). The antibiotic low- and high-dosage is very similar to the previously published amounts of antibiotics used for blood meal supplementation (Oliver et al., 2021). These working concentrations were obtained by 1000 × dilution from their stock solutions prepared in DMSO. The blood was freshly supplemented with every 12h blood exchange regime. Individual I. ricinus females were thus dosed with 100 µmol or 10 µmol of tetracycline, respectively, assuming a 1mL uptake of blood meal. Fully fed females that spontaneously detached from the membrane were randomly placed into two groups: in one of these, the females had their ovaries dissected out for DNA isolation, and in the other, the females were placed individually into glass vials kept at 24°C and 95% humidity to allow egg laying and subsequent hatching of larvae. The first generation was initiated by placing 15 mg of unfed I. ricinus larvae from M. mitochondrii-reduced (from I. ricinus females dosed with 100 µmol of tetracycline) and control females on guinea pigs, and the second generation was initiated by placing 20 mg of unfed I. ricinus larvae from M. mitochondrii-free and control females. For comparison, wild-caught I. ricinus females were fed naturally on laboratory guinea pigs, and freshly engorged females were micro-injected into the haemoceol with 350 nL of tetracycline, which was solubilized in MilliQ H₂O as 150 mg/mL, 15 mg/mL, or 1.5 mg/mL stock solutions. Individual I. ricinus females were thus dosed with 112 nmol, 11.2 nmol, and 1.12 nmol of tetracycline, respectively.

Larvae, nymphs and adult ticks from control and Midichloria-free groups were naturally fed to repletion on guinea pigs in separated compartments. Control ticks used in this study originated from the progeny of wild-caught adult females ticks naturally fed on lab-reared hosts. Guinea pigs were examined once a day for the presence of fully fed ticks. Fully fed larvae and nymphs were placed in glass vials to molt to the following life stage. Fully engorged females were allowed to perform egg laying and subsequent hatching of larvae. Larval engorgement was calculated by the number of larvae that fully engorged and dropped off the host. Nymphal and adult female engorgement successes were evaluated by the percentage of ticks that fed until repletion, detaching spontaneously from the host. Nymphal and adult molting successes were calculated by the percentage of nymphs and adults molted from engorged larva and nymphs, respectively.

Total DNA was isolated from either dissected ovary (from individual adult females under sterile PBS), eggs (n = 30), or the whole tick at different life stages using the PowerSoil Kit (Mobio) according to the manufacturer’s instructions. DNA was eluted in 100 μL with concentrations ranging from 1.8 ng/μL to 14.7 ng/μL. Midichloria mitochondrii was quantified as described by (Sassera et al., 2008). The real-time PCR reaction mixture contained 2 μL of DNA, 10 μL of SYBR green (Roche, 4913914001), 1 μL of each primer (10 pmol) (F: 5’CTTGAGAGCAGAACCACCTA 3’; R: 5’CAAGCTCTGCC GAAATATCTT 3’) and DNA-free water (Top-Bio, Praha, Czech Republic) to 20 μL. The I. ricinus single-copy gene elongation factor-1α (ef-1α; ID: GU074769.1) was used as a reference for data normalization and also as a control for the DNA isolation procedure (F: 5’ACGAGGCTCTGACGGAAG 3’; R: 5’CACGACGCAACTCCTTCAC 3’). The reaction was carried out in a QuantStudio 6 qPCR instrument (Applied Biosystems) with 50 cycles at 95 °CC (10 s), 60 °CC (10 s), and 72 °CC (10 s) following an initial denaturation at 95 °CC (10 min). The samples were considered free of M. mitochondrii when no specific amplification of the bacterium could be detected within 50 cycles.

The I. ricinus embryonic cell line (IRE/CTVM19) (Bell-Sakyi et al., 2007) was propagated in Leibovitz L-15 medium (Biosera, LM-L1050), supplemented with 20% (v/v) human serum (Sigma- Aldrich, H4522), Tryptose Phosphate Broth (10% w/v) (Sigma-Aldrich, T8159), Antibiotic and Antimycotic (1% w/v; Biosera XC-A4110), and L-glutamine (1% w/v; Biowest, X0550). To test the sensitivity of tick mitochondrial proteosynthesis to individual antibiotics, 6mL cell cultures (6 × 10⁵ cells/mL media) were transferred to a medium without the antibiotic and antimycotic supplement and were instead supplemented with 400 µg/mL (final concentration) of tetracycline, chloramphenicol (Sigma-Aldrich: C0378), or gentamicin (Sigma-Aldrich: G1914) according to (Moullan et al., 2015). Cells were cultured for 72 hours and then centrifuged at 160 × g for 5 min, rinsed with 1× phosphate-buffered saline (PBS), and again centrifuged at 160 × g for 5 min. Cellular pellets were homogenized and proteins were solubilized in 500 µL of 1× PBS pH 7.4, 1mM EDTA, 1µM E-64 (Merck: E3132) by three freeze-thaw cycles in liquid nitrogen. The homogenate was clarified by centrifuging at 10 000 × g, 10 min, 4°C. The consequent soluble fraction was discarded and the membrane protein-enriched pellets were solubilized in reducing Laemmli buffer.

Ovaries from fully engorged I. ricinus females were dissected under DEPC-treated PBS. Three individual ovaries were used for RNA extraction and three individual ovaries were homogenized and used for protein solubilization as described above. Protein homogenates of tick ovarian tissue or embryonic cell line were adjusted to the equal protein load and separated by reducing SDS-PAGE in 4–20% Stain-free gels (BioRad: 4568095). Protein separation was visualized in the stain-free mode and proteins were transferred to 0.2µm pore PVDF membrane (BioRad: 1704272) for Western blotting. The membrane was blocked in non-fat milk suspended in PBS-Tween for 1 hour at room temperature. Primary antibodies anti-ATP5A (Abcam: ab14748) and anti-MTCO1(Thermo Fisher Scientific: 459600) were diluted in PBS-Tween 1:500 and 1:1000, respectively, and incubated with the membrane overnight. Immunodetection was performed by anti-mouse peroxidase-conjugated immunoglobulin (Sigma-Aldrich: A9044), diluted 1: 10 000 in PBS-Tween, and the signal was visualized by Clarity™ Western ECL substrate (BioRad: 170-5061) using ChemiDoc (BioRad).

RNA was extracted from ovaries using a NucleoSpinRNA II kit (Macherey-Nagel, Germany). The quality of RNA was checked by gel electrophoresis on an agarose gel (1%, w/vol), and stored at -80 °C prior to cDNA synthesis. cDNA preparations were made from 0.5 μg of total RNA in independent triplicates using the Transcriptor High-Fidelity cDNA Synthesis Kit (Roche Diagnostics, Germany). The cDNA served as templates for subsequent quantitative expression analyses by RT-qPCR. Samples were analyzed by a LightCycler 480 (Roche) using Fast Start Universal SYBR Green Master Kit (Roche). Relative expressions were calculated using the ΔΔCt method (Livak and Schmittgen, 2001). The expression profiles were normalized to I. ricinus elongation factor 1α (ef-1α; ID: GU074769.1). Primers used were: ir-atp5A (F: 5’GCTACCTGGACAAGTTGGACC 3’, R: 5’CTTCTGTGTCGACCTGATGTG 3’), ir-mtco1 (F: 5’GTTTTTGATTATTACCCCCTTCTTT 3’, R: 5’ACTGTTCATCCAGTTCCTGCC 3’).

The target sequence for RNAi was obtained by PCR using the following primers: ir-atp5A (F: 5’ atgggccCGACAGGCAGACTGGTAAG 3’, R: 5’ attctaGAGAGATCGTCGTAGATGATAAG 3’), ir-mtco1 (F: 5’atgggccCTCTTCCTGTTCTTGCTGGAG 3’, R: 5’attctagaCTCGAGCTTACTTTACAGCTGC 3’). dsRNA of ir-atp5A (GenBank: GIYG01000932.1), ir-mtco1 (GIXL01030069.1), or gfp (green fluorescent protein) used as a control were synthesized using the MEGAscript T7 transcription kit (Ambion, Lithuania) according to the previously described protocol (Hajdusek et al., 2009; Perner et al., 2018). This resulted in a synthesis and hybridization of dsRNA products of 309 bp (ir-atp5a) and 331 bp (ir-mtco1). I. ricinus females were injected into the haemocoel through to the coxae with these dsRNAs (0.5 μL; 3 μg/μL) or control gfp dsRNA (0.5 μL; 3 μg/μL) using a glass capilary of the outer dimater of 20 – 25 µm and a microinjector (Narishige), allowed to rest for one day and then fed naturally for 7 days on guinea pigs. The efficiency of RNA-mediated silencing of ir-atp5A gene expression was verified both at the transcript level by RT-qPCR and at the protein level by Western blot analysis using αATP5A antibodies. In this way, we validated specificity of commercial antibodies against non-tick immunogen to recognize its tick homologue.

Statistical analyses were performed using GraphPad Prism software (version 8). Differences in DNA amplicon abundances, tick engorged weights, or weights of egg clutches were calculated using the t-test. The values were considered statistically significant with p<0.05 denoted as *, p<0.005 denoted as **, and p<0.0001 denoted as ****.

We previously determined that ovaries of I. ricinus females were virtually exclusively colonized by a single bacterial species, M. mitochondrii (Guizzo et al., 2020). As a proxy for the effectiveness of bacterial clearance from fully engorged I. ricinus females, we determined the relative amounts of M. mitochondrii in tick ovaries ( Figure 1A ). First, we performed a one-time microinjection of fully engorged I. ricinus females with tetracycline in a concentration series, and quantified levels of M. mitochondrii three and six days after feeding (and injection). At both time-points, there was no reduction in levels of M. mitochondrii in tick ovaries ( Figure 1B ). To increase the overall dosage of tetracycline achieved in ticks, we performed ex vivo tick membrane blood feeding supplemented with two different concentrations (50 µg/mL and 5 µg/mL; final concentrations) of tetracycline. With this approach, we achieved a significant reduction in M. mitochondrii levels in tick ovaries, three and six days after engorgement ( Figure 1C ). We noted, however, that at higher concentration of tetracycline, these I. ricinus females were less successful than control ticks in their capacity to fully engorge (see below).

In order to evaluate the potential of off-target tetracycline activity to inhibit mitochondrial proteosynthesis, as reported in other eukaryotes (Moullan et al., 2015), we designed a Western blot assay detecting two mitochondrial proteins; one encoded by the nuclear genome and the other by the mitochondrial genome. ATP synthase F1 subunit alpha (ATP5A) is encoded by the nuclear genome, is translated in the cytosol, and only then is transported into the mitochondria, while the Mitochondrially Encoded Cytochrome C Oxidase I (MTCO1) is encoded in the genome of mitochondria, where it is also synthesized by the mitochondrial-based translation apparatus ( Figure 2A ). Upon specificity validation of the commercial antibodies against non-tick homologues ( Figure 2B ), we noted that tetracycline treatment reduced the levels of MTCO1 in tick mitochondria while the levels of ATP5A remained unchanged ( Figure 2C ). These data show that tetracycline inhibited tick mitochondrial proteosynthesis and thus may elicit activity affecting tick fitness. Using RNAi, we could only validate specificity against ATP5A, as we could not achieve RNAi silencing for the mitochondrial protein MTCO1 ( Supplementary Figure S1 ). Instead, we confirmed the anti-MTCO1 specificity of the commercial antibodies using chloramphenicol as a specific inhibitor of mitochondrial proteosynthesis (Richter et al., 2019) ( Figure 2C ).

In order to avoid possible immediate mitochondrial toxicity of tetracycline, we set out to produce a strain of I. ricinus ticks that would be distanced in time from the administered tetracycline ( Figure 3A ). Ixodes ricinus females were fed tetracycline-supplemented blood meal ( Figure 3B ) via the ex vivo membrane feeding system, and the larvae were used as starting progenies for the M. mitochondrii-free strain. These progenies were monitored for two following generations and assessed for their capacity to blood-feed, develop, and reproduce. In a generation subsequent to adult bacterial clearance by feeding, larvae exhibited a reduced capacity to engorge in vivo on laboratory animals. Engorgement was reduced to 57% in the first generation and to 61% in the second generation ( Figure 3C ). The failure of the cohort to normally blood-feed was manifested in profoundly reduced numbers of larvae reaching engorgement in 48 hours ( Supplementary Figure S2 ). Larvae that fed successfully then developed into nymphs with a rate similar to that of the control group ( Figure 3D ). Furthermore, nymphs also displayed no deviation from controls ( Figures 3E, F ). While we observed an impairment of females during the clearance feeding itself ( Figure 3B ) with a longer time to engorge and lower engorged weight, we did not observe any reduced capacity of adult females to blood-feed in the generation after clearance ( Figures 3G, H ), strongly suggesting an off-target effect of the higher dose of tetracycline. The egg mass produced by M. mitochondrii-free and control groups of the second generation of I. ricinus females were not statistically significant either ( Figure 3I ). The extent of reduction of M. mitochondrii levels through the two generations cycle was monitored by qPCR ( Supplementary Figure S3 ). These data clearly indicated that the use of tetracycline in the ex vivo blood feeding system led to an immediate reduction in M. mitochondrii in this parenting generation (F₀), but eventually reached complete elimination (i.e. beyond the limits of real time PCR detection) of M. mitochondrii in the following generation of I. ricinus females (F₁) ( Supplementary Figure S3 ). These data show a clear correlation between the partial failure of larvae to blood-feed and the M. mitochondrii-free status of their female ancestor. The causative link, however, still remains to be unambiguously determined.