Epimastigotes of T. cruzi (Dm28c strain) were maintained at 28°C in stationary phase by using brain heart infusion (BHI) medium supplemented with 10% FBS, 30 μM hemin, and 1% penicillin–streptomycin cocktail (regular medium, RM). Iron-depleted medium (IDM) was prepared using BHI medium without hemin and supplemented with 10% iron-free FBS, following the protocol described in Dick et al. (2020). The viability of the parasites was assayed by evaluating the mitochondrial transmembrane potential. When this potential is generated and maintained, the 3-(4,5-dimethylthiazol)-2,5-diphenyltetrazolium (MTT) bromide (Sigma-Aldrich, Saint Louis, MO, USA) is converted to insoluble formazan. The concentration of formazan was spectrophotometrically determined at 570 nm after its solubilization with Triton X-100.

For the assay of epimastigote proliferation, the parasites were inoculated (10⁶ cells/ml) on the 6th day of culture into the BHI medium (RM or IDM, with or without G418). Cell proliferation was assessed every day by counting the number of cells in a hemocytometer. Metacyclogenesis was induced as described in Contreras et al. (1985) and Koeller et al. (2014). Briefly, epimastigotes in transition from logarithmic to stationary phase were adjusted to 5 × 10⁸ parasites/ml in triatomine artificial urine (TAU) medium [190 mM NaCl, 17 mM KCl, 2 mM MgCl₂, 2 mM CaCl₂, 0.035% (w/v) NaHCO₃, and 8 mM phosphate buffer at pH 6.0]. After 2 h at 28°C, the cultures were diluted 100-fold in 10 ml TAU medium supplemented with 10 mM L-proline, 50 mM glutamic acid, 2 mM aspartic acid and 10 mM glucose (TAU3AAG), and 500 µg/ml G418 (Sigma-Aldrich) and transferred to T25 flasks—lying at an angle of 45° to increase the area in contact with O₂—and maintained at 28°C to promote metacyclogenesis. After 3–5 days, the parasites were quantified by hemocytometry, and the percentage of metacyclic trypomastigotes was estimated by their morphology after Giemsa staining.

The percentage of trypomastigotes was also quantified by cytometry as previously described (Bayer-Santos et al., 2013). Briefly, live parasites (4 × 10⁷) were incubated for 30 min on ice with the monoclonal antibody 1G7 against GP90, diluted in 1% bovine serum albumin in phosphate-buffered saline (BSA/PBS). Later, the cells were washed in PBS and were fixed with 4% paraformaldehyde (PFA) in PBS for 15 min. Then, after washings in PBS, the parasites were incubated with Alexa Fluor 488-conjugated anti-mouse IgG diluted in 1% BSA/PBS for 1 h at room temperature. Subsequently, after two more washes, fluorescence was determined on a FACSCalibur II cytometer (Becton Dickinson, Franklin Lakes, NJ, USA), and data analysis was performed using the CellQuest software (Becton Dickinson).

From the in-silico analysis of the genome of the Dm28c strain of T. cruzi (available through the TriTryp database under the accession no. TCDM_06386) (Grisard et al., 2014), we found a homolog (TcIT) to the Fe transporter of L. major (available from the TriTryp database under the accession no. LmjF.31.3070-LIT). The model of TcIT was constructed using the protein structure prediction PHYRE (www.sbg.bio.ic.ac.uk/phyre/) (Kelley and Sternberg, 2009), which is based on the model of the SERCA ATPase and visualized with the standard molecular viewer PyMOL 2002 (PyMOL Molecular Graphics System, DeLano Scientific, San Carlos, CA, USA; http://pymol.sourceforge.net/). Phylogenetic analysis used the MEGA 7 software. The evolutionary history was inferred using the neighbor-joining method (Saitou and Nei, 1987). Amino-acid multiple sequence alignments were obtained by using Clustal W and Clustal X software version 2.0 (http://www.ebi.ac.uk/Tools/msa/clustalw2).

The full-length TcIT coding region was amplified from Dm28c gDNA, by using designated primers FTcIT (5′-GGATCCATGAACAACGTTGAGTCAAGTGACGCG-CACCT) introducing the BamHI restriction site at the 5′-end and RTcITHA (5′-AAGCTTTTAAGCGTAATCTGGAACATCGTATGGGTACGCCCACTTCCCAAGGAGCGTCATAA), with the addition of HindIII restriction site with the hemagglutinin (HA) epitope tag at the 3′-end, thus generating the TcIT-HA insert. The amplicon was subcloned into pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA), released by digestion with BamHI and HindIII (sites underlined above), and ligated into similarly digested expression vector pTEX (Kelly et al., 1992). The shuttle vector pTEX-TcIT-HA, which replicates in E. coli and T. cruzi, was used as the vehicle for the expression of TcIT-HA in T. cruzi. Cell electroporation was performed with an Amaxa Nucleofector II device with human T-cell buffer (Lonza, Basel, Switzerland). A total of 5 × 10⁷ epimastigotes were transfected with pTEX-TcIT-HA or empty pTEX (pTEX-Ø) vectors (10 μg DNA). After electroporation, the cells were cultured for 48 h in standard medium and 500 µg/ml G418 (Sigma-Aldrich) was added. Non-DNA control cells died after 3 to 4 weeks. Cultures were 5-fold diluted with fresh G418-containing medium after 5–10 days. Stable resistant cells were obtained ~30 days after transfection, indicating resistance to G418.

The concentration of intracellular Fe accumulated under different conditions and by different strains (wild type and mutants obtained as described above) was determined by a colorimetric assay based on the use of ferrozine. Suspensions containing 10⁸ parasites were collected from different cultures and washed three times with PBS pretreated with 5 g/100 ml Chelex resin (Sigma-Aldrich). The cells were lysed with 100 μl 50 mM NaOH, followed by the addition of 100 μl 10 mM HCl; the release of ionic Fe bound to intracellular structures was achieved by adding 100 μl of a mixture of 1.4 M HCl and 4.5% (w/v) KMnO₄ (1:1) to the cell lysate, followed by incubation at 60°C for 2 h. Then, 30 μl Fe detection reagent (6.5 mM ferrozine, 6.5 mM neocuproine, 2.5 M ammonium acetate, and 1 M ascorbic acid) was added. After 30 min of incubation at room temperature, the absorbance of the sample was recorded at 550 nm. The concentration of Fe was determined using a standard curve with known FeCl₃ concentrations (0–75 μM) (Mittra et al., 2013).

Mutant epimastigotes (5 × 10⁹ cells) in late log phase of growth were harvested by centrifugation and washed three times in cold PBS. The plasma membrane fraction/PM was obtained as previously reported (Gottlieb and Dwyer, 1983; Pinheiro et al., 2006; Dick et al., 2020), with slight modifications. The washed organisms, overexpressing pTEX-TcIT or pTEX-Ø, were resuspended in Tris–EDTA buffer (10 mM Tris–HCl at pH 8.0, 125 mM sucrose, 3 mM MgCl₂, 2 mM EDTA, and 1 mM phenylmethanesulfonyl fluoride) and maintained on ice for 30 min. The parasites were mixed with glass beads (1:4) and disrupted by abrasion for 10 min on an ice bath. After grinding, glass beads, unbroken cells, and large cell debris were removed by centrifugation at 1,000×g for 15 min at 4°C. The supernatant (total homogenate/HG) was centrifuged at 200,000×g for 1 h. The resulting pellet (total membranes/TM) was resuspended in 50 mM Tris–HCl (pH 8.0) and subsequently applied to a continuous density gradient of 18% Percoll in 0.25 M sucrose and 12 mM Tris–HCl (pH 7.4), to obtain the PM-enriched fraction. After centrifugation at 40,000×g for 1 h, the bands were removed by aspiration, analyzed for 5′-nucleotidase activity [the marker of PM in epimastigote forms of T. cruzi (Zingales et al., 1979) and Fe-reductase activity, and the two fractions (TM and PM) were kept at −80°C, along with aliquots of HG, for further assays. Protein concentration was determined by the Lowry method (Lowry et al., 1951), using BSA as standard. Supplementary Figure S1 depicts the assays of 5′-nucleotidase and Fe-reductase activities, demonstrating i) the enrichment of the PM fraction with both enzymes and ii) that these activities were barely detectable in the supernatant recovered after centrifugation of HG at 200,000×g for 1 h (the cytosolic fraction/C).

For Western blotting detection, the proteins of the fractions obtained as described above (30 µg/lane) were separated by 12% SDS-PAGE and transferred to nitrocellulose membranes (Merck Millipore, Burlington, MA, USA), which were blocked with 5% milk in PBS plus 0.1% (w/v) Tween 20, probed overnight at 4°C with the primary rabbit anti-HA antibody (1:1,000, Sigma-Aldrich), and detected using an HRP-conjugated anti-rabbit IgG secondary antibody (1:10,000, Santa Cruz Biotechnology, Dallas, TX, USA). Ponceau red was used as loading control.

Immunofluorescence was assayed as previously described, with minor modifications (Dick et al., 2020). The mutant T. cruzi epimastigotes (10⁷ cells, pTEX-TcIT or pTEX-Ø) were washed three times in 0.5 ml PBS and the suspension was fixed with 500 μl formaldehyde 4% (w/v) in PBS for 1 h at room temperature. The samples were washed twice with 0.5 ml PBS, suspended in 40 μl PBS, and settled on poly-L-lysine-coated coverslips for 15 min. The coverslips were incubated in 0.4% (w/v) saponin in PGN [PBS at pH 7.2, supplemented with 0.2% (w/v) gelatin and 0.1% (w/v) NaN₃] for 15 min to allow parasite permeabilization. The samples were incubated with anti-HA antibody raised in rabbit (1:1,000, Sigma-Aldrich) and mouse anti-TcSMP (surface membrane proteins) antibody (1:100), prepared and used as described by Martins et al. (2015) in PGN with 0.1% saponin, and incubated overnight at 4°C. After washing with PGN, the samples were incubated with anti-rabbit FITC conjugated (1:100, Sigma-Aldrich) and anti-mouse Alexa 594 (1:1,000, Sigma-Aldrich) in PGN for 1 h at room temperature. Coverslips were washed in PBS and incubated with 0.1 µg/ml 4′,6-diamino-2-phenylindole (DAPI, Sigma-Aldrich) for 30 min. After washing, coverslips were mounted on slides in Miowol (Antifade) reagent. Images were taken with a Leica TCS-SPE confocal microscope and processed with Leica confocal software.

Cells were fixed by using 2.5% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2) for 1 h at room temperature and post-fixed using an osmium-thiocarbohydrazide-osmium (OTO) protocol (Willingham and Rutherford, 1984). Briefly, the cells were incubated in a post-fixative solution [1% (v/v) OsO₄, 0.8% (v/v) potassium ferrocyanide, and 5 mM CaCl₂ in 0.1 M cacodylate buffer (pH 7.2)] for 40 min, washed twice in water, and then incubated in a solution of 1% (w/v) thiocarbohydrazide (TCH, Sigma-Aldrich) in water for 5 min. After three washes in water, the cells were incubated again in the post-fixative solution for 3 min. Samples were dehydrated in an acetone series and embedded in epoxy resin. Ultrathin sections (70 nm) were stained post-embedding with 5% (w/v) uranyl acetate and lead citrate and observed by using a Tecnai Spirit electron microscope (FEI Co., Hillsboro, OR, USA) operating at 120 kV.

Total T. cruzi RNA was extracted using a Direct-zol RNA MiniPrep Kit (Zymo Research, Orange, CA, USA) from epimastigotes maintained at RM or IDM for 6 days, or mutants pTEX-TcIT or pTEX-Ø (as indicated in the figure legends). Total RNA was subjected to reverse transcription using the High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). For RT-PCR, 100 ng/μl cDNA per well was used (15 μl total volume), along with 5 μM primer mix and 7 μl PowerUp SYBR green master mix (Thermo Fisher Scientific). The primers 5′-TCTGGTCGC-TTCTCTTCTCG and 5′-TAAAGA-CTCCGGCACACAGT were used to amplify a 152-bp fragment of the TcIT gene. The primers 5′-AGCGCGCGTCTAAGACTTACA and 5′-TG-GAGCTGCGGTTGTCATT that amplify the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) constitutive gene were used to provide an endogenous control.

Oxygen consumption was measured using intact epimastigotes (5 × 10⁷ parasites/chamber; pTEX-TcIT or pTEX-Ø). Analyses used an O2k-system high-resolution oxygraph (Oroboros Instruments, Innsbruck, Austria). The cells were suspended in 2 ml respiration solution containing 100 mM sucrose, 50 mM KCl, and 50 mM Tris–HCl (pH 7.2) at 28°C with continuous stirring, and 50 μM digitonin was added to permeabilize the parasites. Oxygen concentrations and O₂ consumption were recorded using DatLab software coupled to Oxygraph-2K (basal O₂ consumption). Subsequently, 10 mM succinate and 200 μM ADP were added. Uncoupled respiration was stimulated after adding 3 μM FCCP and respiration was inhibited by adding 2.5 μg/ml antimycin A to measure residual O₂ consumption (Nogueira et al., 2017). In a series of experiments, titration with substrates and inhibitors was not carried out, and O₂ consumption was measured only in the presence of endogenous substrates (basal consumption) over all recordings.

Superoxide dismutase (SOD) activity was measured as described in Winterbourn et al. (1975), with modifications, based on SOD inhibiting the reduction of nitro blue tetrazolium (NBT) by O 2 · − . Epimastigote cells were harvested by centrifugation, washed three times in cold PBS, and disrupted by freeze–thaw. The protein concentration of the total homogenate was quantified by the Lowry method (Lowry et al., 1951). The homogenates (using known quantities of protein in the range of 10–50 µg) were incubated in reaction medium (200 µl, final volume) containing 45 mM potassium phosphate buffer (pH 7.8), 6.5 mM EDTA, and 50 mM NBT. The reaction was initiated by adding 2 mM riboflavin. After 12 min in a light box, the absorbance of the sample was recorded at 560 nm. The percent inhibition was measured for each amount of protein, and SOD activity was expressed as the amount of enzyme inhibiting NBT reduction by 50%.

The intracellular ATP was quantified by using an ATP bioluminescent somatic cell assay kit (Sigma-Aldrich). Briefly, mutant epimastigotes (10⁷ parasites per tube, 0.1 ml) were incubated in a solution containing 100 mM sucrose, 50 mM KCl, and 50 mM Tris–HCl (pH 7.2 adjusted with HCl). Cellular extracts were prepared by mixing 0.1 ml epimastigotes with 0.1 ml somatic cell ATP releasing reagent and the mixture was left on ice for 1 min. Half of the cellular extract (0.1 ml) was transferred to MTS-11C minitubes (Axygen, Union City, CA, USA) containing 0.1 ml ATP assay mix and stirred for 10 s at room temperature. The total amount of light emitted was measured with a GloMax Multi JR detection system (Promega, Madison, WI, USA). Total intracellular ATP concentration per cell number was calculated using a standard ATP curve, prepared, and analyzed in each experiment (Carvalho-Kelly et al., 2020).

The production of H₂O₂ in mutants overexpressing TcIT was assayed by the rate of H₂O₂ reduction to H₂O, which is stoichiometrically coupled (1:1) to the simultaneous oxidation of the non-fluorescent Amplex^® Red probe to the fluorescent resorufin (Dos-Santos et al., 2019). Briefly, assays containing 0.1 μM H₂O₂ were incubated with 10⁷ parasites/ml for 30 min at room temperature in 5 mM Tris–HCl (pH 7.4), 1.7 μM Amplex^® Red (Invitrogen, Carlsbad, CA, USA), and 6.7 U/ml horseradish peroxidase (Sigma-Aldrich) in a final volume of 100 μl. The evolution of fluorescence was followed at excitation/emission wavelengths of 563/587 nm (slit 5 nm).

Metacyclogenesis was induced as described above in section 2.1. After 3 days, the parasites were collected and purified using the ion-exchange chromatography technique Sepharose membrane-DEAE (Cruz-Saavedra et al., 2017) to obtain a preparation enriched with metacyclic trypomastigotes. Then, the parasites were incubated with LLC-MK2 cells (CCL-7; ATCC, Rockville, MD, USA) (50 parasites:1 cell) in RPMI 1640 medium supplemented with 10% FBS in a 96-well PS F-bottom microplate (Greiner Bio-One Brazil Ltd., Americana, Brazil) for 24 h at 37°C under 5% CO₂ in air. After removing the medium containing parasites not adhered to the cells, adding the fresh medium, and incubating further (48 h), the cells were fixed with 4% paraformaldehyde in PBS for 10 min. After incubation with Hoechst 33342 (Invitrogen) (1:5,000 dilution) for 60 min at room temperature in the dark, the wells were washed with Milli-Q deionized water and analyzed in a high-content screening system ImageXpress Micro XL (Molecular Devices, San José, CA, USA) using the MetaXpress 6.0 software. The interaction parasites:cells was quantified by counting the respective nuclei.

Data are presented as mean ± SE. Means were compared by using unpaired Student’s t-test and GraphPad Prism 7.0 (San Diego, CA, USA). When more than two means were compared, one-way ANOVA followed by Tukey’s test or two-way ANOVA with multiple comparisons was used, as indicated in the text or in the figure legends.

A putative zinc–iron (Zn–Fe) transporter sequence was found in the genome database of T. cruzi (TriTrypDB: TCDM_06386) following a BLAST search, using the Fe transporter LIT1 from L. amazonensis (TritrypDB: LmjF.31.3060) (Huynh et al., 2006) as target. The TCDM_06386 was named TcIT and has 1,119 bp, and the deduced amino-acid sequence of the peptide comprises 372 residues, thus resulting in a predicted molecular mass of 39.8 kDa. The deduced protein TcIT has a structural model ( Figure 1A ) in which its eight possible transmembrane domains can be seen (TMpred Server) (Hofmann and Stoffel, 1993). TcIT has a highly conserved domain corresponding to the zinc iron permeases (ZIP) superfamily domain (permeases classified as 2.A.5 in the Transporter Classification Database/TCDB, Saier Lab. Bioinformatics Group). We encountered the domain in Zn and Fe transporter proteins by using the Conserved Domain Database (CDD, National Center for Biotechnology Information/NCBI). This domain has conserved amino acids corresponding to Zn/Fe binding, such as those labeled H105, H223, S224, H249, and E253 in Figure 1A , which are located along the inner surface of the channel formed by the transmembrane domains and bind the metal during the transport process (Jacques et al., 2010).

TcIT alignment had 34% identity and 53% similarity to the LIT1 from L. amazonensis and 28% identity and 46% similarity to the IRT1 from A. thaliana ( Figure 1B ), with 30% identity between the sequences of L. amazonensis and A. thaliana (Jacques et al., 2010). Analysis showed that all three sequences have eight transmembrane domains (underlined in Figure 1B ) and the same residues for Zn/Fe binding (residues H105, H223, S224, H249, and E253, red boxes in Figure 1B ). To analyze the phylogenetic relationship with the ZIP superfamily, we compared the amino-acid sequence of TcIT with sequences of putative and functionally characterized Fe transporters from several organisms, using MEGA 7 software ( Figure 1C ).

Impaired growth was seen in epimastigotes maintained in IDM compared with those grown in RM ( Figure 2A ). The decrease in cell number was not due to cell death: MTT assays showed that viability of the cells was similar ( Figure 2B ). Although cells in IDM possess TcIT transcripts that increased with Fe removal from the culture medium ( Figure 2C ), this was insufficient for maintaining Fe intracellular content: epimastigotes from IDM had 50% lower intracellular Fe content compared with epimastigotes from RM ( Figure 2D ). In addition, Fe depletion lowered basal O₂ consumption (representative recordings in Figure 2E ), comparatively quantified in Figure 2F .

By using immunofluorescence assays, we determined that the labeling of the tagged protein TcIT-HA colocalizes with the labeling of the plasma membrane protein TcSMP, indicating that the Fe transporter is localized in the plasma membrane of epimastigotes ( Figure 3A ).

As negative control, parasites transfected with pTEX-Ø did not stain with HA. Mutants overexpressing TcIT had a higher Fe intracellular content compared with the basal content of the mutant transfected with pTEX-Ø ( Figure 3B ), together with very high transcription levels of TcIT ( Figure 3C ). In agreement with the immunofluorescence results, the plasma membrane-enriched fraction (PM) from pTEX-TcIT had a 39-kDa band corresponding to TcIT. Figure 3D shows a representative Western blot image, where the arrow points to the 39-kDa band; no bands were observed in pTEX-Ø epimastigotes ( Figure 3E ). The densitometric analysis of pTEX-TcIT Western blots (n = 3) of the HG, total membranes, and PM gave, respectively, the following values in arbitrary units: 52.9 ± 8.6, 59.6 ± 2.4, and 133.0 ± 2.9. One-way ANOVA followed by Tukey’s test demonstrated that the enrichment of TcIT in PM with respect to HG (160%) and TM (130%) was highly significant (P < 0.0001 and P = 0.0001, respectively). Ponceau red loading controls are presented in Figures 3F (pTEX-TcIT) and Figure 3G (pTEX-Ø).

In Figures 2E, F , we showed that Fe depletion in culture decreases O₂ consumption by T. cruzi. Figures 4A (representative traces) and Figure 4B (quantification of O₂ consumption in different respiratory states) show that higher respiration rates are encountered—in phosphorylating and uncoupled conditions—when TcIT is overexpressed. Permeabilization with digitonin did not alter the profile of basal respiration (data not shown). After adding succinate (the LEAK O₂ consumption), there was no difference in O₂ consumption between pTEX-Ø and pTEX-TcIT epimastigotes, but the subsequent addition of ADP (corresponding to the oxidative phosphorylation—OXPHOS—state) that caused a significant increase of respiration by the two classes of mutants, O₂ consumption of TcIT mutants was higher compared with pTEX-Ø mutants. There were a further increase and uncoupled respiration rates (EST, electron transfer system uncoupled from phosphorylation) after the addition of FCCP (a H⁺ ionophore), again higher in overexpressing TcIT. The addition of antimycin A completely abolished mitochondrial respiration in both mutants.

Higher mitochondrial O₂ consumption can be coupled to both increased oxidative phosphorylation and higher ROS production. Therefore, we measured total intracellular ATP concentration ( Figure 4C ) and H2O2 formation ( Figure 4D ) in both mutants. Parasites overexpressing TcIT had higher intracellular ATP (ATPi) content, as was expected, and a 2-fold higher content of H₂O₂. Nevertheless, there was no difference between the mutants in their activity of the antioxidant enzyme SOD ( Figure 4E ).

Possible ultrastructural changes in epimastigotes that overexpress TcIT were analyzed by transmission electron microscopy ( Figure 5 ). As control, we used parasites transfected with pTEX-Ø. Control epimastigotes presented normal cell and organelle morphology and positioning ( Figures 5A–C ). We could not find any alteration in the major cellular organelles, including kinetoplast, nucleus, and organelles of the endocytic pathway such as cytostome–cytopharynx complex and reservosomes. Most organelles had normal morphology and positioning in epimastigotes that overexpress TcIT ( Figures 5D–H ), except for the mitochondria. In mutant parasites, we frequently observed mitochondrial swelling, increase in cristae density, inner membrane vesiculation ( Figures 5E–G ), and mitochondrial disorganization ( Figure 5H ). These findings may reflect the increase in mitochondrial activity found in the case of parasites overexpressing TcIT.

Overexpression of TcIT in T. cruzi epimastigotes did not interfere with their in-vitro proliferation ( Figure 6A ), since these mutants proliferate at the same rate as the epimastigotes transfected with the empty vector pTEX-Ø. However, when epimastigotes transfected with pTEX-TcIT were subjected to in-vitro differentiation in TAU medium, almost 40% of the forms present after 96 h were trypomastigotes, whereas transfection with pTEX-Ø for the same time led to only 20% of the organisms as trypomastigotes ( Figure 6B ). This indicates that overexpression of the TcIT transporter favors in-vitro differentiation. The cytometric analysis ( Figure 6C ) using the 1G7 antibody against the marker of metacyclogenesis GP90 demonstrated, after the 4th day in TAU, a higher number of GP90(+) cells in parasites transfected with TcIT than in those transfected with pTEX-Ø (54.5% vs. 46%). In contrast, the number of GP90(−) cells was higher in pTEX-Ø parasites (54% vs. 46.4%). The hypothesis that TcIT overexpression stimulates metacyclogenesis is also supported by the fact that trypomastigotes have higher levels of TcIT mRNA than epimastigote forms ( Figure 6D ). In fact, LLC-MK2 cells infected with metacyclic trypomastigotes derived from epimastigotes pTEX-TcIT present a higher replication rate of amastigotes (parasites/LLC-MK2 cells) when compared with those LLC-MK2 cells infected with pTEX-Ø metacyclics ( Figure 6E ). Representative images of the amastigote forms inside LLC-MK2 cells are shown in Figure 6F .