AGS cells were maintained in RPMI (Life Technologies) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Life Technologies). The human umbilical vein cell line, EA.Hy926 (ATCC® CRL-2922), were maintained as non-polarized monolayers in Dulbecco's modified Eagle's medium (DMEM) (Life Technologies) supplemented with 4.5 g/L D-glucose, L-glutamine, and 110 mg/L sodium pyruvate (Invitrogen), 10% heat-inactivated FBS, and HAT supplement (Sigma-Aldrich). HUVECs (Catalog number C2519A; Lonza) were maintained as non-polarized monolayers in Endothelial Basal Medium supplemented to Endothelial Growth Medium using the EBM-2™ BulletKit™ (Lonza). Routinely cultured cells and experiments were all maintained at 37°C in a humidified 5% CO₂ incubator. For experiments where serum-starvation or serum-free conditions were required, cells were grown in culture media without growth factors, additives, or heat-inactivated FBS.

Construction of the various isogenic mutants of H. pylori strain P12 has been described in detail previously (Gorrell et al., 2013). H. pylori strain 7.13 and its isogenic ΔcagA mutant have also been described elsewhere (Franco et al., 2005). H. pylori strains were routinely cultured on GC agar (Oxoid) supplemented with 10% (v/v) horse serum (Invitrogen), vitamin mix, vancomycin, and nystatin as described previously (Kwok et al., 2002). For infection experiments, GC agar-cultured H. pylori was used to inoculate Heart Infusion (HI) broth (Oxoid) supplemented with 10% (v/v) FBS, 1% (v/v) vitamin mix and 10 μg/ml vancomycin (Sigma-Aldrich). Kanamycin sulfate (15 μg/ml) or chloramphenicol (4 μg/ml) was added as required for the culture of H. pylori mutant strains. All H. pylori cultures were grown at 37°C under microaerophilic conditions (CampyGen™ system; Oxoid); liquid cultures were incubated with gentle agitation at 120 rpm to an O.D_550nm of 0.8–1.2 prior to use in infections.

The inhibitors, AG1478 and BMS-345541, were purchased from Merck KGaA. The antibodies used are: PY99 phosphotyrosine-specific mouse monoclonal antibodies (mAb), anti-CagA rabbit polyclonal antibody, and NF-κB p65-specific mouse mAb F-6 (Santa Cruz Biotechnology); anti-EGFR rabbit mAb D38B1 (Cell Signaling); anti- α-tubulin mouse mAb B-5-1-2 (Sigma-Aldrich); goat anti-H. pylori antiserum [Kirkegaard and Perry Laboratories (KPL)]; integrin α_vβ₃-specific mouse mAb LM609 (Millipore); rat mAb AIIB2 (specific for integrin β₁) (Hall et al., 1990) and BIIG2 (specific for integrin α₅), developed by C. H. Damsky were obtained as conditioned culture media ultrafiltration concentrates from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biology, Iowa City, IA 52242. Before use in infection cultures, AIIB2 and BIIG2 concentrates were dialysed against PBS to remove residual antibiotics as described previously (Gorrell et al., 2013).

Wild-type or mutant recombinant CagL protein (rCagL), expressed as a fusion protein with a C-terminal hexahistidine-tag, was purified as described previously (Gorrell et al., 2013). Heat-denatured CagL (DN rCagL) was prepared by heating CagL in 50 mM Tris-HCl (pH 8), 100 mM NaCl and 25 mM KCl at 95°C for 30 min.

For H. pylori infection experiments, all cell-lines were seeded in 24-well plates at 3 × 10⁴ cells per well, and grown for 48 h to achieve ~70% confluence prior to treatment and/or inoculation. For infection experiments, cells were inoculated with either sterile bacterial media alone (HI), or broth-cultured H. pylori strains at a multiplicity of infection of 0.1, 1, 10, 30, or 100 colony-forming units per cell, as described for each experiment. For inhibitor studies, cells were washed with PBS and pretreated with small molecule inhibitors or antibodies for 30 min prior to H. pylori infection. Spent culture medium was collected at 6 and 24 h-post-infection (hpi) for subsequent analysis by IL-8 or IL-6 ELISA; cell lysates for immunoblot analysis were prepared using Laemmli buffer as described previously (Gorrell et al., 2013). For rCagL treatment, EA-Hy926 monolayers were washed with PBS before adding rCagL^WT, rCagL^RGA, or DN rCagL^WT diluted in serum-free growth medium; spent culture medium was collected after 24 h incubation.

The assay was performed as described previously (Kwok et al., 2007) with the following minor modifications. Microtitre plates were coated with PBS alone, or 50 μg/ml of bovine fibronectin (Sigma) or human recombinant vitronectin (Gibco) in PBS at 4°C overnight. Single cell suspensions of HUVECs or AGS were pre-treated with PBS or 2 μg/ml integrin function-blocking antibodies (LM609 or a 1:1 mixture of AIIB2 and BIIG2), for 30 min at 37°C in humidified atmosphere with 5% CO_2. Treated cells were seeded into the coated microtiter plates at 4 × 10⁴ cell/well, incubated for 2 h, and the wells washed with warm growth media without FBS to remove unbound cells. Attached cells were fixed with 3.8% (w/v) paraformaldehyde (PFA) before visualization using an Olympus CX22 brightfield microscope at 40 × magnification.

To assess the effect of AG1478 on cell viability, HUVEC monolayers (seeded at 6 × 10⁴/well in 24-well plates and incubated for 2 days) were incubated with AG1478 at various concentrations (0.5, 2, 10, or 20 μM) for 24 h. Cells were washed twice with warm growth media, trypsinized and then diluted in 0.4% (w/v) trypan blue in PBS (pH 7.2) for enumeration of viable and non-viable cells using a hemocytometer.

AGS or HUVECs grown on glass coverslips were co-cultured with H. pylori strains at MOI of 30 as described above. After 2, 4, and 5 h, samples were washed once with the corresponding growth media and then fixed with 2% PFA at 4°C for 24 h. Fixation was repeated with a fresh batch of 2% PFA at 4°C for 24 h, after which the fixative was replaced with 100 mM HEPES (pH 6.9). Samples were dehydrated and processed by critical point-drying as described previously (Rohde et al., 2003), and were examined with a field emission scanning electron microscope Zeiss DSM 982 Gemini using the Everhart Thornley SE detector and the inlens detectors in a 50:50 ratio. Assessment of the abundance of T4SS pili in each sample was performed blinded. The brightness and contrast of the micrographs were adjusted globally using Adobe Photoshop CS3.

To investigate p65 nuclear translocation during H. pylori infection, HUVECs were grown on 12-mm diameter glass coverslips and then serum-starved before H. pylori-infection. To examine the effect of the IκB kinase inhibitor BMS345541 on p65 nuclear translocation, HUVECs grown in a 24-well plate were serum-starved and then pre-treated with DMSO or BMS345541 (10 μM) for 30 min prior to co-culture with BHI or H. pylori for 3 h. At the required post-infection time points, culture supernatants were recovered and HUVECs monolayers were washed once with PBS before fixation with 4% (w/v) PFA in PBS for 15 min at room temperature. Fixed cells were washed 3 times with PBS, then blocked/permeabilized with PBS (pH 7.2) containing 5% (v/v) FBS and 0.3% (v/v) Triton X-100, before incubation (overnight, 4°C) with anti-p65 mAb and anti-H. pylori antisera diluted in antibody diluent (1% (w/v) bovine serum albumin, 0.12% (v/v) Triton X-100, in PBS, pH 7.2). Cells were then washed three times with PBS followed by incubation (2 h at room temperature) with antibody diluent containing AlexaFlour 555-conjugated donkey anti-mouse Ig and AlexaFlour 647-conjugated donkey anti-goat Ig (Invitrogen). Nuclei were counter-stained with DAPI (0.4 μg/ml in PBS; Sigma) for 5 min at room temperature. Localization of p65 and DAPI staining was captured digitally for at least 5 fields per coverslip at 60x magnification using a Leica SP5 confocal microscope. Images were colorized and overlaid using the software ImageJ.

To examine the relative abundance of total and tyrosyl phosphorylated CagA in H. pylori-AGS or H. pylori-HUVECs co-cultures, cell lysates were separated in 6% SDS-PAGE gels using the Bio-Rad mini-Protean III system according to the Laemmli buffer system. Tyrosine-phosphorylated and total CagA were detected by immunoblotting using the PY99 and anti-CagA antibodies, respectively, using procedures described previously (Kwok et al., 2007).

To detect EGFR expression in uninfected HUVECs and H. pylori-HUVECs co-culture, HUVECs cultures were lysed with radioimmunoprecipitation assay (RIPA) buffer containing 0.5% (w/v) sodium deoxycholate, 150 mM NaCl, 1% (v/v) Tergitol-type NP-40, 50 mM Tris-HCl pH 8.0, 0.1% (w/v) SDS, 10% glycerol, 5 mM EDTA, 20 mM sodium fluoride, 10 μg/mL aprotinin, 1 mM phenylmethane sulfonyl fluoride (PMSF), 10 μg/mL leupeptin, 1 mM sodium orthovanadate, 2.5 mM sodium pyrophosphate and 2.5 mM β-glycerophosphate. Lysates were collected and clarified by high-speed centrifugation. Protein concentrations were then determined with the BCA protein kit (#23225, Thermoscientific) according to the manufacturer's protocol. Protein samples (20–30 μg) were separated in 8% polyacrylamide gels, and were wet transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% (w/v) skim milk reconstituted in TBS-T buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% v/v Tween 20) for 1 h at room temperature. Membranes were then incubated with their respective primary antibody diluted in blocking buffer overnight in 4°C. Membranes were washed thrice for 10 min with TBS-T in room temperature, then probed with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibody diluted in blocking buffer. Membranes were washed thrice for 10 min with TBS-T in room temperature before signal detection using the enhanced chemiluminescence substrate kit, Western Lightning Plus-ECL (Perkin Elmer).

The amounts of IL-8 and IL-6 secreted were determined using the human IL-8 OptEIA ELISA set (BD Biosciences) and human IL-6 OptEIA ELISA set (BD Biosciences), respectively, according to manufacturer's instruction. All samples were measured in duplicate.

HUVECs were seeded in a 96-well plate at a density of 0.5 × 10⁴ cells per well (200 μl) and grown for 2 days before infection with H. pylori. At 24 hpi, culture supernatant was discarded and wells were washed twice gently with 300 μl of growth media. Cells were then fixed with 3.8% (w/v) PFA for 15 min at room temperature. After washing with PBS, wells were blocked with 10% FBS in 1 × PBS (200 μl/well) for 1 h at room temperature. After blocking, wells were washed 3 × with PBS supplemented with 0.05% TBST (PBST_0.05)_. Cells were then incubated with goat anti-H. pylori antiserum (100 μl/well) diluted 1:1,000 in blocking buffer for 1 h at room temperature. After washing with PBS three times, rabbit anti-goat IgG horseradish peroxidase-conjugated antibody (100 μl/well) diluted 1:2,000 in blocking buffer was added and incubated for 1 h at room temperature. After washing five times with PBST_0.05, cells were incubated with 3,3′,5,5′-Tetramethylbenzidine (TMB) (100 μl/well) for 25–45 min, after which the reaction was stopped by addition of 1M H₂SO₄ (50 μl/well). Optical density (O.D.) at 450 nm of each well was measured using a TECAN ELISA plate reader and background-corrected against absorbance at 570 nm.

HUVECs were seeded at 3 × 10⁴ cells per well into 24-well plates and grown to ~70% confluence (2.5 days). Cells were serum-starved for 5 h before inoculation with sterile BHI, or H. pylori P12 WT or isogenic cagL or cagPAI deletion mutant strains (MOI = 50). Cells were harvested at 0.5, 1, 2, and 3 hpi into 350 μl RLY cell lysis buffer (ISOLATE II RNA mini kit, Bioline) supplemented with 10 mM dithiothreitol, and RNA purified according to the kit protocol for “purifying total RNA from cultured cells and tissue.” RNA concentrations were estimated by Nanodrop (Thermo Fisher) and 125 ng RNA was used for cDNA production using the Superscript III first strand synthesis system with oligo d(T) primers (Thermo Fisher) according to the kit protocol. EGR1 and EGFR mRNA levels were assessed by qPCR using FastStart Universal SYBR Green Master mix (Roche) with gene-specific primers for EGR1 [EGR1F 5′-CCCGTTCGGATCCTTTCCT-3′ and EGR1R 5′-CAGCATCATCTCCTCCAGCTT-3′ (Keates et al., 2005)], EGFR [EGFR-F 5′-GCGTCTCTTGCCGGAATGT-3′ and EGFR-R 5′-GGCTCACCCTCCAGAAGGTT-3′ (Keates et al., 2007)] and GAPDH [GAPDH-F 5′ CGGGAATGCAGTTGAGGATC 3′ and GAPDH-R 5′ AGGATGGTGTAAGCGATGGC 3′ (Witta et al., 2009)]. Quantitative PCRs were prepared in triplicate and individual 25 μl reactions contained 0.4 mM primer pair and 2 μl cDNA (≈12.5 ng RNA) or nuclease-free H₂O (no-template control). Cycling conditions were: 1 cycle (95°C for 10 min); 40 cycles (95°C for 15 s, 60°C for 60 s); melting curve from 65 to 95°C, 5 s per 1°C. Output qPCR data was assembled into amplicon groups and analyzed using LinRegPCR [software version 2017.0 (Ramakers et al., 2003)]; mean PCR efficiencies were 2.01 for GAPDH, 2.03 for EGR1 and 2.06 for EGFR. Fold differences in EGR1 and EGFR mRNA levels calculated using GAPDH as the reference gene and BHI as the control sample by the ΔΔCT (2∧-((Ct_{target gene} – Ct_{ref gene})_{control sample} – (Ct_{target gene} – Ct_{ref gene})_{test sample})) and the Ruijter ((PCR efficiency^{Ct(ref gene)} / PCR efficiency^{Ct(target gene)})_{test sample} / (PCR efficiency^{Ct(ref gene)} / PCR efficiency^{Ct(target gene)})_{control sample}) methods (Ruijter et al., 2009) were indistinguishable; differential expression was reported as 2^−ΔΔCT values.

Numerical data were analyzed using Prism 6.0 (GraphPad software) and presented as mean ± standard error of the mean (SEM) or mean ± standard deviation (SD). N denotes the number of independent experiments performed. Statistical significance was determined using Student's t-test, one-way ANOVA or two-way ANOVA with appropriate post-test, as indicated in the figure legends.

Previous studies have shown that H. pylori stimulates secretion of the proinflammatory cytokines IL-8 and IL-6 upon infection of endothelial cells (Ding et al., 1997; Innocenti et al., 2002). To further understand the biological significance of these responses and the mechanism behind, we first compared the levels of IL-8 secretion induced by H. pylori upon infection of primary HUVECs, an immortalized HUVEC line (EA.Hy926), or a gastric epithelial cell line (AGS) (Figure 1A). Low multiplicities of infection (MOI) were used to mimic the relatively low abundance of H. pylori present in the gastric submucosa where the majority of blood vessels reside. At MOI of 1, similar levels of IL-8 induction were observed at 6 h post-inoculation in all three cell lines/types upon infection with the H. pylori strain P12. However, after 24 h of stimulation by H. pylori, the level of IL-8 secreted by the endothelial cell line EA.Hy926 was more than double that observed with AGS (Figure 1A). This marked response was even more pronounced with the primary endothelial cells HUVECs (Figure 1A). Moreover, these levels of IL-8 induction observed in H. pylori-infected endothelial cells at MOI of 1 are similar to or even higher than that previously observed with H. pylori infection of primary human gastric epithelial cells at MOI of 100 (Fischer, 2011; Mustapha et al., 2014). In fact, H. pylori induced IL-8 secretion by primary endothelial cells even at MOI of 0.1 (Figure 1B). Taken together, these results suggest that endothelial cells may play a more important role in mounting early proinflammatory responses toward H. pylori than previously envisaged.

To elucidate the molecular mechanism(s) involved in stimulating the potent inflammatory response in endothelial cells by H. pylori, we examined the contribution of H. pylori T4SS to IL-8 induction. HUVECs were infected with H. pylori P12 wild-type (WT) or isogenic cagPAI-deletion (ΔcagPAI) mutant. The ΔcagPAI mutant, which lacks the genes that encode the T4SS, lost the ability to induce IL-8 secretion in HUVECs compared to wild-type H. pylori (Figure 2A). Similar observations were obtained upon H. pylori infection of the endothelial cell line EA.Hy926 (Figure 2B). These findings suggest that induction of IL-8 by H. pylori is strongly dependent upon the constituents of the T4SS.

CagL is a T4SS-associated adhesin capable of binding to the human transmembrane receptor integrin α₅β₁ via an arginine-glycine-aspartate (RGD) motif (Kwok et al., 2007). We have shown previously that interaction of CagL with integrin β₁ via the RGD motif triggers secretion of IL-8 in gastric epithelial cells (Gorrell et al., 2013). To test whether CagL and its RGD motif are also important for stimulating IL-8 secretion upon H. pylori infection of endothelial cells, we infected HUVECs with a H. pylori P12 isogenic mutant deficient in CagL (P12ΔcagL) or an isogenic cagL mutant that expresses an arginine-glycine-alanine (RGA) motif instead of the RGD motif (P12ΔcagL/cagL^RGA). The ΔcagL mutant, like the ΔcagPAI mutant, was significantly attenuated in its ability to induce IL-8 secretion in HUVECs (Figure 2A), as well as the EA.Hy926 cell-line (Figure 2B). Similarly, substitution of the RGD motif with RGA in CagL (ΔcagL/cagL^RGA) resulted in severely attenuated IL-8 induction (Figure 2A). In contrast, knock-in of P12ΔcagL with wild-type cagL (P12cagL^WT) fully restored IL-8 secretion, confirming that the loss of P12ΔcagL's ability to induce IL-8 was not due to polar effects (Figures 2A,B). Adherence assays confirmed that the mutants and wild-type strains adhered to endothelial host cells to similar extents (Supplementary Figure 1). Taken together, these results suggest that CagL and its RGD motif play a major role in inducing IL-8 secretion upon H. pylori infection of HUVECs, which is reminiscent of the key role of CagL in IL-8 induction in infected gastric epithelial cells (Gorrell et al., 2013).

We have previously shown that CagL protein alone was sufficient to induce IL-8 secretion upon H. pylori infection of gastric epithelial cells (Gorrell et al., 2013). To test whether the same holds true for H. pylori-mediated IL-8 induction in endothelial cells, EA.Hy926 cells were stimulated with recombinant wild-type CagL protein (rCagL^WT), heat-denatured recombinant CagL (DN rCagL^WT) or CagL^RGA mutant protein. The results showed that rCagL^WT, but not DN rCagL^WT or the rCagL^RGA mutant, stimulated an ~3.5-fold increase in IL-8 secretion by endothelial cells (Figure 2C); the inability of DN rCagL^WT to induce an IL-8 response confirmed that the response was unlikely to be caused by any trace amount of contaminating lipopolysaccharide (LPS) as the pyrogenic effect of LPS is heat-resistant (Gao et al., 2006). These observations indicate that CagL alone is sufficient to trigger IL-8 secretion by endothelial cells in an RGD-dependent manner.

During H. pylori infection of gastric epithelial cells, CagL plays a major role in mediating the translocation of the T4SS substrate, CagA, into the host cells (Kwok et al., 2007; Gorrell et al., 2013). Moreover, translocated CagA can contribute to IL-8 induction in H. pylori-infected gastric epithelial cells (Brandt et al., 2005). It is thus possible that the CagL-dependent IL-8 induction observed in endothelial cells could be mediated by translocated CagA per se. To investigate whether CagA or CagA translocation contributes to endothelial cell proinflammatory responses, we infected HUVECs with wild-type H. pylori, cagA-deletion (ΔcagA) or virD4-deletion (ΔvirD4) mutant. The ΔvirD4 mutant is defective in CagA translocation as VirD4 is the coupling protein of the H. pylori T4SS essential for the translocation of CagA through the T4SS channel into the host cell (Fischer, 2011). In contrast to the ΔcagPAI and ΔcagL mutants, the ΔcagA or ΔvirD4 mutants were fully capable of triggering IL-8 secretion in HUVECs to levels observed with wild-type (Figure 3A). Adherence assays confirmed that these mutants and wild-type strains adhered to HUVECs to similar extents (Supplementary Figure 1). These observations therefore show that the H. pylori T4SS per se, but not its translocation substrate CagA, is a major inducer of IL-8 secretion in H. pylori-infected endothelial cells. Moreover, in agreement with the IL-8 results, analysis of IL-6 secretion in samples from this series of experiments indicated that H. pylori-mediated induction of IL-6 in infected HUVECs was also T4SS- and CagL-dependent, but CagA-independent (Figure 3B).

Given that the IL-8 induction by H. pylori in HUVECs was significantly more pronounced compared to the IL-6 response, we decided to focus on the IL-8 response in our further interrogation of the molecular mechanism by which the H. pylori T4SS triggers proinflammatory responses in endothelial cells. To further test the hypothesis that CagL can directly stimulate IL-8 induction in gastric epithelial cells in a manner independent of its role in mediating CagA translocation (Gorrell et al., 2013), we made use of the cagL^WTΔvirD4 mutant and the cagL^RGAΔvirD4 double mutant. The H. pylori cagL^WTΔvirD4 mutant, which expresses wild-type CagL but lacks VirD4, is defective in CagA translocation but still able to induce IL-8 secretion in gastric epithelial cells; in contrast, the cagL^RGAΔvirD4 double mutant is defective in both CagA translocation and IL-8 induction in infected gastric epithelial cells (Gorrell et al., 2013). Upon infection of HUVECs, the cagL^WTΔvirD4 variant was fully capable of potent IL-8 induction, but the cagL^RGAΔvirD4 mutant was significantly attenuated in its ability to induce IL-8 (Figure 3A). These results support the notion that CagL and its RGD motif contribute to IL-8 induction in endothelial cells in a manner independent of their roles in CagA translocation.

We next examined whether the CagA-independent effect is unique to the H. pylori strain P12. HUVECs were stimulated with wild-type H. pylori strain 7.13 and its isogenic ΔcagA mutant. Strain 7.13 is a carcinogenic Mongolian gerbil-adapted H. pylori human isolate which possesses a functional T4SS and is able to translocate a relatively high abundance of CagA into the gastric epithelial cell line AGS compared to other strains (Franco et al., 2005). Consistent with the hypothesis that CagA is dispensable for IL-8 induction by H. pylori upon infection of human endothelial cells, no difference in the levels of IL-8 induction was observed between wild-type 7.13 and 7.13ΔcagA during infection of HUVECs (Supplementary Figure 2).

Taken together, these novel findings support the notion that the H. pylori T4SS and its adhesin, CagL, are key drivers of IL-8 induction during H. pylori infection of endothelial cells. Moreover, this pro-inflammatory response occurs in a manner independent of CagA translocation.

The observation that CagA does not play a role in IL-8 induction in H. pylori-infected endothelial cells led us to speculate that the H. pylori T4SS may lack the ability to translocate CagA into these cells. Previous studies have shown that CagA, upon translocation by H. pylori T4SS into gastric epithelial cells, becomes phosphorylated by the host Src kinase on a number of tyrosine residues in its C-terminal region (Segal et al., 1999; Backert et al., 2000; Stein et al., 2000), which is required for CagA to trigger IL-8 secretion in H. pylori-infected gastric epithelial cells (Brandt et al., 2005). Therefore, we investigated whether H. pylori infection of HUVECs results in tyrosyl-phosphorylated CagA. No tyrosyl-phosphorylated CagA could be detected in the lysate of H. pylori-infected HUVECs up to 24 hpi, whereas the presence of tyrosyl-phosphorylated CagA was readily detectable in H. pylori-infected AGS cells (Figures 4A,B, and Supplementary Figure 3), indicating that H. pylori is able to efficiently translocate CagA into AGS, whereas in HUVECs CagA was either not translocated or not tyrosyl-phosphorylated. Supporting the proposition that CagA translocation occurs in infected AGS but not infected HUVECs is the observation that cagPAI-dependent pili-like structures were abundantly present at the interface of H. pylori and AGS (Figure 4C, left-hand panels) whereas no pili-like structures were detected at the interface of H. pylori and HUVECs (Figure 4C, right-hand panels). The elaboration of cagPAI-dependent pili-like structures at the interface of H. pylori and AGS cells has been associated with active CagA translocation into the host cell (Rohde et al., 2003; Kwok et al., 2007; Shaffer et al., 2011). Thus, taken together, these observations suggest that although the T4SS is capable of triggering proinflammatory responses in H. pylori-infected HUVECs, it does not translocate CagA into or lead to CagA phosphorylation in HUVECs.

Having ascertained that the H. pylori T4SS and, in particular, CagL, played an important role in IL-8 induction, we next examined whether the proinflammatory response is mediated by the host receptor integrin α₅β₁, as previously observed for IL-8 induction by H. pylori in AGS cells (Hutton et al., 2010; Gorrell et al., 2013). The role of RGD-binding integrin α_vβ₃ in H. pylori-mediated IL-8 secretion by endothelial cell was also investigated as integrin α_vβ₃ is abundantly expressed in HUVECs (Brooks et al., 1994; Baranska et al., 2005) and is crucial for endothelial functions such as angiogenesis and adhesion of endothelial cells to vitronectin in the extracellular matrix (Alghisi et al., 2009). To this end, we used the β₁ integrin function-blocking antibody, AIIB2, together with the α₅ integrin-function blocking antibody, BIIG2, to block α₅β₁ function; and the α_vβ₃ integrin-function blocking antibody, LM609. The specific inhibitory activities of AIIB2/BIIG2 and LM609 for cell spreading on their individual ligands fibronectin or vitronectin, respectively, was first confirmed in cell attachment assays (Supplementary Figure 4). HUVECs were then pre-treated with these antibodies prior to H. pylori infection and detection of IL-8 secretion. Integrin α₅β₁ function was not essential for IL-8 induction by H. pylori in HUVECs, as pre-treatment of HUVECs with AIIB2 and BIIG2 did not suppress IL-8 secretion in response to H. pylori (Figure 5A). Similar observations were obtained when HUVECs were pre-treated with LM609 prior to H. pylori infection (Figure 5B). These findings indicate that integrins α₅β₁ and α_vβ₃ are dispensable for H. pylori-mediated IL-8 induction upon infection of endothelial cells.

Previous studies have shown that H. pylori is capable of transactivating epidermal growth factor receptor (EGFR) and up-regulating its expression in gastric epithelial cells in a T4SS-dependent manner, and that EGFR activation contributes to IL-8 induction by H. pylori (Keates et al., 2001, 2005, 2007). To investigate whether EGFR also plays a role in the induction of IL-8 by H. pylori during infection of HUVECs, we pre-treated HUVECs with AG1478 prior to infection with H. pylori. AG1478 is a small-molecule inhibitor that specifically inhibits the tyrosine kinase activity of EGFR (Zhu et al., 2001). AG1478 strongly inhibited IL-8 secretion (Figure 5C) and IL-6 secretion (Supplementary Figure 5) by HUVECs in response to H. pylori in a dose-dependent manner without affecting cell viability at concentrations up to 20 μM (Supplementary Figure 6). These findings indicate that EGFR function is a major contributor to IL-8 induction by H. pylori in HUVECs.

Due to the rather low level of EGFR expression in HUVECs (Figure 6A), we were unable to detect activation of EGFR directly by Western blot using antibodies specific for the various tyrosine phosphorylated forms of EGFR, or by immunoprecipitating the EGFR and then blotting with such antibodies or with anti-phosphotyrosine antibodies. However, it is known that transactivation of EGFR by H. pylori upregulates expression of the transcription factor early growth response gene 1 (EGR1) in the gastric epithelial cell line AGS (Keates et al., 2005). The role of EGR1 as a downstream effector of EGFR is well established. We therefore used EGR1 upregulation as a marker for EGFR activation and examined whether T4SS or CagL is involved in the activation of EGFR during infection. First, our results showed that H. pylori P12 WT was able to efficiently upregulate EGR1 expression in HUVECs. EGR1 upregulation was detectable as early as after 0.5 hpi and was maximal at 1 hpi (14-fold of upregulation compared to uninfected), with the EGR1 expression level returning to baseline by 3 hpi (Figure 6B, upper panel). The response followed a pattern very similar to that observed upon stimulation of gastric epithelial cells by H. pylori (Keates et al., 2005). Moreover, EGR1 upregulation was dependent on T4SS and CagL as both the ΔcagPAI and ΔcagL mutants, in contrast to wild type, were unable to upregulate EGR1 expression (Figure 6B, upper panel). These findings therefore suggest that H. pylori T4SS and the T4SS adhesin CagL play essential role(s) in activating EGFR during infection of HUVECs. In addition to stimulating EGFR activity, H. pylori P12 WT also triggered a moderate upregulation of EGFR expression in HUVECs as shown by a 1.7-fold increase in EGFR mRNA level at 3 hpi compared to uninfected control (Figure 6B, lower panel). In contrast, the ΔcagPAI and ΔcagL mutants had no effect on EGFR expression (Figure 6B, lower panel), suggesting that upregulation of EGFR expression by H. pylori in HUVECs depends on T4SS and CagL. Taken together, these findings indicate that H. pylori triggers both activation and upregulation of expression of EGFR in HUVECs in a T4SS- and CagL-dependent manner.

IL-8 induction during H. pylori infection of gastric epithelial cells has been shown to require NF-κB activation (Keates et al., 2007; Gorrell et al., 2013). To test the hypothesis that IL-8 induction by H. pylori in endothelial cells is also mediated via activation of NF-κB, HUVECs were pre-treated with the highly specific IκB kinase inhibitor, BMS-345541, which specifically inhibits NF-κB activation (Burke et al., 2003), prior to H. pylori infection. BMS-345541 significantly inhibited IL-8 induction by H. pylori in HUVECs in a dose-dependent manner (Figure 7A). Trypan blue exclusion assays confirmed that the inhibitor concentrations used had no detectable effect on the viability of HUVECs (data not shown). Additionally, immunofluorescence analysis showed that H. pylori stimulated activation of NF-κB, which was measured as a function of nuclear translocation of the NF-κB p65 subunit, in a cagPAI-dependent manner at 3 hpi of HUVECs (Figure 7B) with the effect being observable up to 7 hpi (data not shown). BMS-345541 at a concentration of 10 μM significantly blocked p65 nuclear translocation in H. pylori-infected HUVECs (Supplementary Figure 7). These findings corroboratively indicate that H. pylori T4SS triggers NF-κB activation and that activation of NF-κB contributes to IL-8 induction in H. pylori-infected endothelial cells.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.