To confirm whether anti-DENV-2 antibodies could induce ADE to DENV-1 infection, we collected six DENV-2 infected human sera (α-DENV-2). Dengue IgG in the sera was detected by ELISA. Results showed five of them were considered positive of dengue IgG. The average optical density values (O.D.) of DENV IgG in α-DENV-2 and control group were 0.439 ± 0.278 and 0.137 ± 0.056, respectively (Figure 1A). To confirm whether proteins of DENV-1 cross-reactive with human anti-DENV-2 sera and a commercial mouse DENV-2 prM mAb, we used DENV-1 as antigens and the mixed sera of six patients or prM mAb as the first antibody for western blot. Results showed human anti-DENV-2 sera contained corresponding anbodies for prM, M, NS1 and E protein of DENV-1. Anti-DENV-2 prM mAb could react with DENV-1 prM protein (Figure 1B).

Dengue virus (DENV) mainly infected monocytes, macrophages and dendritic cells in patients (Jessie et al., 2004). Human monocyte cell line K562 (Fc receptor-bearing) was a common cell type to demonstrate the ADE of DENV in vitro. To confirm whether the human anti-DENV-2 sera could induce ADE, we infected K562 cells with DENV-1, then determined the viral load in the supernatant by qRT-PCR and detected infected cell number by flow cytometry. PCR results showed 10–100 fold enhancement of infection in four human anti-DENV-2 sera (Figure 1C). Similarly, anti-DENV-2 sera also led to a significant increase of infected cells (Figure 1D).

Next, to determine ADE effect of mouse prM mAb, we incubated K562 cells with DENV-1 (MOI = 1) and a series of diluted prM mAb for 72 h. Results showed that prM mAb had strong enhancement effect for DENV-1 infection in a concentration-dependent manner. A 100-fold enhancement of DENV replication was detected with 0.1, 0.25 and 0.5 μg/ml prM mAb when analyzed by qRT-PCR (Figure 2A). Less than one percent of monocytes were infected with DENV-1 without prM mAb. However, the percent of infected cells displayed an increased trend along with higher prM mAb concentration. The largest DENV-1 infected cell percentage was detected when the added prM mAb concentration was increased to 0.25 μg/mL(Figure 2B). These results illustrated that prM mAb could enhance the infection of heterotypic virus and might played a vital role in dengue disease.

Then, to prevent ADE induced by prM mAb, we developed anti-idiotypic antibodies (prM-AIDs) specific to prM mAb by immunizing balb/c mice. prM-AIDs in immunized mice were detected by ELISA and the titer was increased continually from day 7 after mouse immunization (Figure 3A). When the titer of anti-sera reached 1:40000 at day 35 (Figure 3A), mice were sacrificed to collect blood. prM-AIDs in the sera and naive mouse antibodies (NM-Abs) were purified by Protein-G column. The quantity and quality of purified prM-AIDs was determined by SDS-PAGE and ELISA. Results showed the purified antibody's heavy chain (about 55KDa) and light chain (about 25KDa) (Figure 3B). The optical density values of prM-AIDs in the naive mouse antibodies (NM-Abs) or immunized mouse antibodies (IM-Abs) and 0.093 ± 0.014 and 0.28 ± 0.073, respectively (Figure 3C). These data demonstrated balb/c mice immunized with prM mAb produced a high level of prM-AIDs.

To determine whether our purified prM-AIDs could inhibit ADE of DENV infection, K562 cells were infected with DENV-1 virus and prM antibody and various concentrations of prM-AIDs. prM mAb was added instead of prM-AIDs as a control group. The results showed that if only adding prM mAb and DENV-1, viral load in supernatant was significantly higher than the DENV-1 alone group. But when we added prM-AIDs, the viral load was decreased in a dose-dependent manner. Compared with the prM mAb group (8.2 ± 2.8 × 10⁸ copies/mL), the viral load in the supernatant with prM-AIDs (25 μg/mL) was dramatically decreased to 7.8 ± 3.4 × 10⁷ copies/mL (Figure 4A). Therefore, prM-AIDs significantly diminished ADE induced by prM mAb through decreasing 90% viral replication (Figure 4B).

To assess the ability of prM-AIDs to block ADE in vivo, we utilized a recently described AG6 mouse model (interferon-α and γ receptor deficient mice) for ADE of dengue infection. (Figure 5A) prM mAb with or without prM-AIDs were transferred into AG6 mice by i.v. prior to infection with DENV-1. Antibodies from naive mouse sera were purified as control antibodies (NM-Abs). Viral RNA load in blood cells was detected by qRT-PCR (Figure 5B), while infective viral particles in plasma was detected by plaque assay (Figure 5C). QA peak viremia titer in blood cells was detected at day 3 post infection (Figure 5B). Compared with the NM-Abs group, the viremia titer was 1-fold higher in the prM mAb group (Figure 5B). At day 3 after inoculation, the platelet counts in DENV-1 injected mice were significantly lower than that of uninfected mice. Challenging with prM mAbs significantly reduced platelets (Figure 5D).

To further explore the inflammation response and liver damage of ADE infection, we also detected ALT (Figure 5E) and IL-10 (Figure 5F) in the plasma of mice at days 3 post infection by ELISA assay. Compared with the uninfected groups, a significant higher level of ALT and IL-10 were observed in the DENV infected groups (Figures 5E,F). Compared to the pure DENV-1 infected mice group, the level of ALT and IL-10 were increased in the prM mAb mice group. These data show that ADE of DENV-1 infection in AG6 mice by passive transfer prM antibody.

However, by comparison, a significant difference in viral load of blood cell between the mice that received prM-AID and the mice that received prM mAb at day 3 post infection (Figure 5B). Similarly, the viral load in the plasma also showed a peak at day 3 post infection. Although the viral titer in the prM-AIDs group displayed the lowest trend, there was no statistically significant difference among all the groups. Compared with the prM mAb group, the mean viremia titer in the prM-AIDs group decreased about 1-fold (Figure 5C).

Interestingly, the number of the platelets in the prM-AIDs challenged mice was significantly higher than that of NM-Abs group at day 3 post infection (Figure 5D). Besides, challenged with prM-AIDs showed decreased trend of the level of ALT and IL-10 than the prM mAb mice group and naive mouse antibodies group (Figures 5E,F).

All patient samples and data were assigned institution-specific identification numbers to ensure patient anonymity.Balb/c mice were purchased from Guangdong medical Laboratory Animal Center. The mice were bred and maintained under SPF animal house in Shenzhen Center for Disease Control and Prevention. C57BL/6 mice deficient in type I and type II interferon (IFN) receptors (AG6 mice) were purchased from Institute Pasteur of Shanghai, Chinese Academy of Science, which is bred and maintained under SPF animal house in Tsinghua University. All experiments procedures were approved and performed according to the guidelines of the Experimental Animal Welfare and Ethics Committee of Shenzhen Center for Disease Control and Prevention.

The Aedesalbopictus cell line C6/36 and Baby Hamster Kidney-21 (BHK-21) cell line were cultured in Dulbecco's modification of Eagle's medium (DMEM). Human erythroleukaemic K562 cells were grown in Roswell Park Memorial Institute (RPMI) 1640 medium. All media were supplemented with 10% fetal bovine sera, 100 U/mL penicillin, and 100 μg/mL streptomycin. C6/36 cells were propagated at 28°C and BHK-21 and K562 cells were propagated at 37°C. All the materials used for cell culture were purchased from GIBOCO and cells were from China Center for Type Culture Collection.

DENV-1 was isolated in our laboratory from a patient during a DENV outbreak in Shenzhen, China in 2014. Virus was propagated in C6/36 cell line. After 3-4 days, the supernatant was harvested, and cell debrises were removed by centrifuge at 10000 rpm for 10 min at 4°C. DENV-1 was used after being passaged for 3 times in C6/36 cells. To increase the virus titer, the supernatant were concentrated by centrifuge at 4,000 g for 30 min at 4°C using filtration device (Millipore, Cat. No# UFC901008). Virus stocks were stored at −80°C.

Human anti-DENV-2 sera samples were obtained from patients during a DENV outbreak in Guangdong, China. Human anti-DENV-2 sera samples and native human sera samples were collected from Shenzhen Center for Disease Control and Prevention.

Dengue virus (DENV) type 2 prM IgG1 monoclonal antibody, directed against pre-membrane glycoprotein of DENV serotype 2 was purchased from Thermo (Cat. No#, MA1-71252). To remove sodium azide in the supernatant, the antibody was further purified by the Montage Prosep-G kit (Millipore, Cat. No# P36491) and quantitated by the BCA Protein Quantitate Kit (Thermo Scientific, Cat.No# 23225) ccording to manufacturer's instructions.

The titer of virus was determined by plaque assay in BHK-21 cells. BHK-21 cells were seeded in 6-well plate in DMEM with 10% FBS at 37°C. Next day, virus was serially diluted with DMEM medium and incubated with BHK cells for 1 h. Subsequently, the viral suspension was removed, and DMEM medium containing 2% FBS and 1% low-melting point agarose were added. After incubation at 37°C for 6 days, cells were fixed with 4% formaldehyde for 2 h. After the overlay was removed, cells were stained by crystal violet for a few minutes and washed carefully by water. Plaques were calculated by naked eyes.

The DENV-1 supernatant was electrophoresed through 12% SDS/polyacrylamide gels and then electrotransferred to nitrocellulose membrane (Millipore). The membrane was blocked with 5% BSA in TBST before incubation overnight with human anti-DENV sera (1:100 diluted) or prM mAb at 4°C. Wash the membrane with TBST four times. Peroxidase-Labeled Antibody to Human IgG (KPL, Cat. No# 04-10-20, 1:2,000 dilute) or Peroxidase-Labeled Antibody to mice IgG (Abcam,Cat. No#ab6789, 1:100,000 dilute) was added in TBST with 5% BSA for 2 h at room temperature. After washing the membrane, bands were detected by using SuperSignal West Pico chemiluminescent substrate (Thermo Scientific, Cat. No#HF104626).

Human sera or prM mAb was incubated with DENV-1 at an MOI of 1 for 1 h at 25°C in shaking table at 80 rpm to form virus-antibody complexes. The mixtures infected K562 cells in 24-well plates (1 × 10⁵ cells/well) at 37°C for 72 h. The number of infected cells was determined by flow cytometry. The virus in the supernatant was determined by qRT-PCR.

DENV-1 infected and mock K562 cells were harvested and washed with cold phosphate buffered saline (PBS). To block cell surface FcR, incubate cells with 0.5 μg Human BD Fc Block™(BD, Cat. No#564220) for 20 min at room temperature. Fixation, permeabilized and intracellular fluorescence labeling were performed by Fixation/Permeabilization solution (BD, Cat. No#554714) according to manufacturer's instructions. For labeling, cells were incubated with anti-dengue virus E glycoprotein antibody (abcam, Cat. No# ab41329, 1:20 dilute) and then labeled with Donkey F(ab')2 Anti-Mouse IgG H&L (Alexa Fluor® 488,abcam, Cat. No#ab181289). Finally, cells were suspended in PBS containing 1% FBS and subjected to flow cytometry.

RNA in the supernatant was extracted using Viral RNA kit (Roche, Cat. No#13438700). qRT-PCR was carried out with DENV General-type Real Time RT-PCR Kit (Shanghai ZJ, Cat. No#ER-0101-02). Amplification conditions were 45°C for 10 min, 95°C for 15 min and 40 cycles of 95°C for 15 s, 60°C for 1 min.

To obtain prM-AID, six female Balb/c mice (6 weeks of age) were subcutaneously immunized with dengue prM mAb three times at 2-week intervals in Freund's complete(sigma, Cat. No#F5881) or incomplete adjuvant (sigma, Cat. No#F5506). Blood samples were collected from the tail vein of immunized mice to determinate the titer of antibody. Seven days after the final immunization, mice were sacrificed to take the blood. The sera were separated from the blood by centrifuge at 2,500 g for 30 min at 4°C and the products was purified from sera using the Montage Prosep-G kit (Millipore Cat. No#P36491). The polyclonal antibodies were concentrated using centrifugal filter device (Millipore) and quantitated by the BCA Protein Quantitate Kit (Thermo, Cat. No#23225) according to manufacturer's instructions. The purity of polyclonal antibodies was identified by sodium dodecyl sulfate-poly-acrylamide gel electrophoresis (SDS-PAGE) on 12% polyacrylamide gels under denaturating and reducing conditions and evaluated by Coomassie blue staining.

To dectect prM-AIDs titer in the immunized sera, serially diluted control and immunized sera were coated in 96-well plates at 4°C overnight. And to identify prM-AIDs in purify antibodies, antibodies purified from naive mice as negative control, and purify anti-idiotypic antibodies from immunized mice were coated in 96-well plates at 4°C overnight. The plates were blocked by 2% BSA in PBST for 1 h at room temperature. The prM mAb was biotinylated by using NH2-reactive biotin (Elabscience, Cat. No#EBLK0002). After washing with TBST, biotinylated prM mAb was added and incubated for 1 h at 37°C. Plates were washed four times with TBST. Streptavidin-HRP (1:10,000 diluted, Beyotime, Cat. No#A0303) were added and incubated for 30 h at 37°C. Wash the plates as above. TMB was added as the substrate, and the reaction was stopped by H₂SO₄ stop solution. The OD at 450 nm was measured with an iMarkTM Microplate Reader. Samples were considered positive if P/N ration>2.1.

prM-AIDs was incubated for 1 h at 25°C in shaking table at 80 rpm with DENV-1 and prM mAb at an MOI of 1. The mixtures infected K562 cells in 24-well plates at 37°C with 5% CO₂ for 72 h. The virus in the supernatant was determined by qRT-PCR.

Twenty six to eight week-old AG6 mice were randomly into four groups. Antibodies were purified from naive mouse sera (NM-Abs) as control antibodies. Mice were injected 100 μg NM-Abs, 20 μg prM mAb and 100 μg NM-Abs or 20 μg prM mAb and 100 μg prM-AID by intravenous injection (i.v) into the tail vein then intraperitoneal (i.p) infected 24 h later with 10⁶ PFU of DENV-1. Blood samples from each mice were collected from the tail vein daily for the next 5 days. Viremia titers were detected from day 1 to day 5 post infection. Platelets were count from day 1 to day 5 post infection. The level of IL-10 and ALT were determined at day 3 post infection.

10 μl whole blood was collected each day after viral challenge into tubes containing sodium citrate. Samples were centrifuged at 6,000 g and 4°C for 5 min to separate plasma and blood cells. Viral load in the plasma was determined by plaque. RNA was extracted from blood cells using an RNA Mini kit (Qiagen, Cat. No#154025157) and reverse transcripted into cDNA using an iScript cDNA kit (Bio-Rad, Cat. No#1708891). Viral genomes were quantified via TaqMan qPCR amplification. The DENV-1 primer pairs were GCTCCCACGTCGGAAATACA and TGTTCTAGGTGAGCAGTCCAATG. The probe was FAM 5′CTGACTGACTACGGAGCC-3′ TAMRA. The sequence of mouse actin primer pairs were AGCCATGTACGTAGCCATCCA and TCTCCGGAGTCCATCACAATG. The probe was FAM 5′-TGTCCCTGTATGCCTCTGGTCGTACCAC-3′ TAMRA. Gene quantities were normalized against mouse actin.

IL-10 (Abcam,Cat. No#ab46103) and ALT (Cloud-clone, Cat. No#SEA207Mu) in the infected and mock-infected mice was quantified using commercially available ELISA kits. The experiment was performed according to manufacturer's instructions.

Unpaired t-test was used to comparison of viral road and percentage of infection in ADE and ADE inhibition assay. Non-parametric Mann-Whitney test were used for pairwise comparisons of viral road, IL-10, ALT and platelets in AG6 mice. All calculations were performed in GraphPad Prism 5.0 software.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.