Adult females and males of I. ricinus were collected by flagging in woodlands around České Budějovice, the Czech Republic. All developmental stages (eggs, larvae, nymphs, and adults) were maintained in wet chambers with a humidity of about 95%, temperature 24°C and day/night period set to 15/9 h. Females were fed naturally on laboratory guinea pigs. The larvae were fed on guinea pigs, allowed to molt to nymphs and, after 4–6 weeks, further fed on guinea pigs or rabbits. The nymphs (pathogen free or infected with B. afzelii CB 43) and adult females (pathogen free) were used for experiments described below. All laboratory animals were treated in accordance with the Animal Protection Laws of the Czech Republic No. 246/1992 Sb., ethics approval No. 095/2012.

B. afzelii CB43 spirochetes were cultivated in BSK-H complete medium (Sigma-Aldrich) at 33°C for 5–7 days and for the assay, were diluted to a concentration of 5 × 10⁶ cells/ml. Hemolymph samples from 50 semi-engorged females (6th day of feeding) were collected into a glass capillary from the cut front leg, immediately cooled on ice and the collected pool was centrifuged at 300 × g for 10 min. The supernatant was transferred to a fresh tube and centrifuged at 9500 × g for 10 min. The hemocyte-free plasma so obtained was used for subsequent experiments. Bovine serum was prepared from manually defibrinated bovine blood as described previously (Perner et al., 2016) and inactivated bovine serum was prepared by heating at 56°C for 40 min.

The assay was performed in 96-well plates (Nunc) by adding 50 μl of B. afzelii (5 × 10⁶/ml) to 10 μl of tested sample (tick plasma, bovine serum, inactivated bovine serum, or BSK-H medium as a control), and incubated for 24 h in a wet chamber at 33°C. The number of live B. afzelii was determined using dark-field microscopy as follows. The Borrelia culture (3.5 μl) was transferred onto a microscope slide and covered with 18 × 18 mm coverslip. Spirochetes present in the view field were counted and the average number, calculated from 10 fields counts, was multiplied by the coefficient 3.9 × 10⁵ pre-determined for our microscope Olympus, model BX53 (total magnification—400x). The obtained results thus represent the number of Borrelia normalized for 1 ml culture volume.

Pathogen free, adult I. ricinus females were fed naturally for 6 days on guinea pigs. Cultivated B. afzelii (5 × 10⁴ spirochetes per tick) were injected into the hemocoel of semi-engorged females in a volume of 138 nl by microinjection (microinjector Drummond). Hemolymph samples from individual ticks were collected at defined time points (0, 1, 3, and 6 h) after injection of spirochetes and mixed with 10 μl of L15-BOFES medium supplemented with 10% fetal calf serum (PAA Laboratories) on microscope slides. Cells were fixed with 4% formaldehyde in phosphate saline buffer (PBS) for 20 min and washed 3 times with PBS. Spirochetes were stained with primary rabbit anti-B. burgdorferi (Thermo Scientific) antibody (1:200 in PBS), on the slides and incubated on a horizontal shaker at room temperature (RT) for 1 h. After washing with PBS (3 times/5 min), slides were stained with fluorescently labeled goat anti-rabbit secondary antibody (Alexa 594) (Molecular Probes) diluted 1:500 in PBS and incubated for 1 h at RT. Hemocytes were then permeabilized using 1% Triton X-100 in PBS with 1% BSA (Bovine serum albumin, Sigma-Aldrich) overnight at 4°C. The next day, spirochetes were restained with primary antibody (rabbit anti-B. burgdorferi) diluted 1:200 in 0.1% Triton in PBS (PBS-Tx) for 1 h at room temperature, and washed 3 × 5 min with 0.1 % PBS-Tx. Spirochetes were then stained with anti-rabbit secondary antibody (Alexa 488) (Molecular Probes), diluted 1:500 in PBS-Tx for 1 h at RT. Cells were then washed with PBS-Tx and nuclei were counterstained with DAPI for 10 min. After mounting in DABCO (Sigma), the number of phagocytic hemocytes was counted using a 488/594 (FITC/TexasRed) dual filter and BX51 fluorescent microscope (Olympus). For each sample, 100 hemocytes were counted.

For the experiment with latex beads (LtxB), 138 nl of 2x diluted surfactant-free red CML latex beads, 0.3 μm diameter (Interfacial Dynamics Corp.) were injected into semi-engorged fed females and, after 2 h, ticks were injected with B. afzelii CB43 (5 × 10⁴). Hemolymph from individual ticks was collected 3 h after injection of Borrelia and phagocytic activity of hemocytes was analyzed (12 ticks for PBS control group and 15 ticks for latex beads group) as described above. The phagocytic index was determined as the number of hemocytes with ingested Borrelia counted for a total 100 hemocytes in the microscopic field.

Unfed I. ricinus females (25 per group) were injected with 138 nl of 2x diluted LtxB or PBS (control) and allowed to rest for 1 day. After that, females were fed naturally on guinea pigs for 6 days and then hemolymph samples from individual females were collected on microscope slides. Cells were fixed with 4% formaldehyde in PBS for 20 min and washed 3 times with PBS. Hemocyte nuclei were counterstained with DAPI. Hemocytes were counted on the whole slide using a BX51 Olympus fluorescence microscope.

dsRNAs of nine t-teps and gfp (control) were produced as described previously (Buresova et al., 2011). For each experiment, t-teps-specific dsRNA (0.5 μl; 3 μg/μl) was injected into the hemocoel of 25 unfed I. ricinus females through to the coxae using a microinjector (Drummond). Ticks were allowed to rest for 1 day and then fed for 6 days on guinea pigs. Hemolymph samples collected from 25 semi-engorged females were mixed with L15-BOFES medium supplemented with 10% fetal calf serum (PAA Laboratories) (Buresova et al., 2011; Urbanova et al., 2015). Hemocytes (4 × 10⁴) in a volume of 150 μl were transferred onto round microscope cover slips in a 24-well culture plate, and then 10 μl of B. afzelii CB43 (10⁸ cells/ml) were added and incubated for 2 h at 28°C. Cells were fixed with 4% formaldehyde in PBS for 20 min and washed 3 times with PBS. Spirochetes were detected by indirect immunofluorescence, using the method of double staining as described above. Phagocytosed spirochetes were counted using the BX51 Olympus fluorescence microscope. For each group, 100 hemocytes were counted on each of at least 14 slides. Relative phagocytosis was calculated in relation to the number of phagocytic hemocytes in the gfp dsRNA injected control group, taken as 100% for each respective experiment.

Different species of Borrelia (B. burgdorferi NE5264, B. burgdorferi CB26, B. garinii MSLB, B. afzelii CB43) were cultivated in BSK-H complete medium (Sigma) at 33°C for 5–7 days. All Borrelia species were diluted in PBS to contain 10⁴ spirochetes in the injection dose. Unfed, pathogen free I. ricinus females were surface-sterilized by a subsequent immersion into 3% H₂O₂, 70% EtOH and sterile distilled water. A 69 nl volume of Borrelia suspension in sterile PBS, or BSK-H medium for controls, was injected into ticks using sterile glass capillaries and a microinjector (Drummond). After inoculation, ticks were allowed to rest for 12 h at room temperature, total RNA was extracted from the whole body homogenates using TRI reagent® (Sigma), treated with DNAse (Ambion), and the integrity of RNA was checked by agarose gel electrophoresis. Single-stranded cDNA was reverse-transcribed from 0.5 μg of total RNA using the Transcriptor High-Fidelity cDNA Synthesis Kit (Roche). The resulting cDNA preparations served as templates for subsequent expression analysis by quantitative real-time PCR (qPCR) using a LightCycler 480 (Roche) and SYBR green chemistry. Reaction conditions and sequences of qPCR T-TEPs forward and reverse primers have been published previously (Urbanova et al., 2015). Relative expression of t-teps was normalized to elongation factor 1 (ef-1) using the mathematical model of Pfaffl (Pfaffl, 2001). For each experimental group, five I. ricinus females were injected in three independent biological triplicates.

B. afzelii CB43 spirochetes were cultivated as described above. To prepare Borrelia-infected nymphs for the transmission experiment, C3H/HeN mice were injected intra-dermally with 10⁵ of B. afzelii spirochetes. After 4 weeks, pathogen-free larvae were fed on infected mice (~100 larvae per mouse) and after repletion were kept in wet chambers at 26°C until molting. The infected nymphs (50 per group) were injected with mixed or individual dsRNAs (3 μg/μl, 64.4 nl) specifically silencing the group of IrAMs (iram-1,2,3), IrC3s (irc3-1,2,3), IrMCRs (irmcr-1,2), IrTep (irtep), gfp (control). For experiments with latex beads, 50 unfed B. afzelii-infected nymphs were micro-injected with LtxB (32 nl, 2x diluted) and 50 with sterile PBS as a control group. Following injection, nymphs were allowed to rest for 3 days, and then were fed until repletion on clean 6-weeks old C3H/HeN mice (10 nymphs per mouse, 5 mice per each experimental group) using plastic cylinders attached to the murine back. Infection of mice with Borrelia during the early phase following tick infestation was tested in ear tissue biopsies taken at 1 week intervals. After 4 weeks the mice were sacrificed and the Borrelia spirochetes were detected in the target tissues, namely the bladder and heart. The mice tissues were first tested for Borrelia positivity using sensitive PCR amplification of a 154 bp fragment of the flagellin gene. The PCR reactions contained 12.5 μl of FastStart PCR MasterMix (Roche), 4 μl of DNA extracted using Macherey-Nagel NucleoSpin®Tissue Kit (concentration in the range of 100–300 ng), 10 pmol of each primer FlaF1 (AAGCAAATTTAGGTGCTTTCCAA), FlaR1 (GCAATCATTGCCATTGCAGA) and PCR water up to 25 μl. The amplification program consisted of denaturation at 94°C for 10 min, then 40 cycles of: denaturation at 94°C for 30 s, annealing at 60°C for 30 s and elongation at 72°C for 40 s. The program was finished by final extension at 72°C for 7 min. PCR products were visualized on a 1.5% agarose gel. Positive tissues were further analyzed by qPCR using a LightCycler 480 (Roche). qPCR was performed in a 25 μl reaction volume containing 12.5 μl of FastStart Universal Probe Master (Rox) (Roche), 5 μl of purified DNA, 10 pmol of each primer, FlaF1, FlaR1, and 5 pmol of TaqMan probe, FlaProbe1 (FAM-TGCTACAACCTCATCTGTCATTGTAGCATCTTTTATTTG-BHQ1) (Schwaiger et al., 2001). The remaining reaction volume was adjusted with PCR water. The qPCR program consisted of denaturation at 95°C for 10 min, followed by 50 cycles of: denaturation at 95°C for 15 s, annealing plus elongation at 60°C for 1 min. The number of spirochetes in tissues was normalized to the number of murine genomes as described previously (Dai et al., 2009).

The appropriate statistical analyses (non-parametric Kruskal-Wallis test, non-parametric Mann-Whitney test or un-paired t-test) were selected for the specific data-sets and specified in the legends to the corresponding figures. All statistics was performed using GraphPadPrism (version 6.00 for Windows, GraphPad Software, San Diego, CA, USA). A P-value of < 0.05 was considered to be statistically significant.

Complement systems in sera of various vertebrate animals exhibit different borreliacidal effects against different Borrelia genospecies (Kurtenbach et al., 2002; Bhide et al., 2005; Ticha et al., 2016). Because Ixodes sp. ticks possess a primordial complement system involving three molecules related to the C3 complement component and putative convertases (Buresova et al., 2011; Kopacek et al., 2012; Urbanova et al., 2014) we tested for possible effects of tick hemolymph on Borrelia viability. Cultivated B. afzelii spirochetes were incubated with tick cell-free plasma, bovine serum, heat-inactivated bovine serum or BSK-H medium and tested for Borrelia survival after 24 h of incubation in vitro. Incubation of bovine serum with B. afzelii resulted in spirochete immobilization, lysis and cluster formation. This effect was markedly reduced by heat inactivation of serum complement. In contrast, no borreliacidal effect was observed upon incubation of spirochetes with tick plasma or BSK-H medium used as a negative control (Figure 1).

As no humoral reaction against B. afzelii was observed in tick plasma, we further investigated phagocytic activity of tick hemocytes against spirochetes injected into the tick hemocoel. B. afzelii spirochetes were injected into semi-engorged females, and phagocytosis was examined in hemolymph collected at different time intervals post injection. In order to distinguish between Borrelia spirochetes that were ingested by tick hemocytes from attached or free spirochetes, a dual-labeling assay was exploited (Figure 2A). We observed that spirochetes were phagocytosed immediately after injection and a phagocytic rate of about 25% was reached after 1 h; this was maintained for at least 6 h (Figure 2B).

Following the evidence that injection of latex or polystyrene beads suppresses phagocytosis in fruit fly (Nehme et al., 2011) or ticks (Liu et al., 2011), we performed an experiment whereby LtxB was injected into the hemocoel of semi-engorged I. ricinus females 2 h prior to injection of B. afzelii. Phagocytosis was evaluated as described above, 3 h after spirochete injection (Figure 3A). Pre-injection of LtxB resulted in a significant reduction in spirochete phagocytosis, where the phagocytic index decreased from 27% for the PBS control to 4% for LtxB pre-injection, while the numbers of hemocytes 5 h after LtxB or PBS injections were the same (Figure 3B).

Intriguingly, injection of LtxB into the hemocoel of unfed females that were further allowed to feed naturally for 6 days resulted in almost complete clearance of hemocytes from tick hemolymph compared to ticks pre-injected with PBS as a control (Figure 4). Despite this striking phenotype, the ticks were capable of feeding with no obvious impact on their fitness or fecundity.

In previous work, we demonstrated that different T-TEPs play non-redundant roles in the phagocytosis of Gram-negative bacteria (Buresova et al., 2011) or the yeast C. albicans (Urbanova et al., 2015). A similar experimental setup combining RNAi-mediated silencing of individual T-TEPs followed by an in vitro phagocytosis assay was used to identify T-TEPs playing a role in the phagocytosis of Borrelia spirochetes by tick hemocytes. Unfed I. ricinus females were injected with gene-specific t-teps dsRNA or gfp dsRNA as a negative control. Ticks were allowed to feed naturally for 6 days, then the hemolymph was collected from semi-engorged females and used for an in vitro phagocytosis assay based on B. afzelii double immunostaining. Out of nine T-TEPs tested, only silencing of irc3-2 and irc3-3 significantly decreased phagocytosis of B. afzelii. In contrast, knockdown (KD) of the insect-type irtep led to a surprising increase in phagocytosis of spirochetes, by about 20% compared to the GFP control (Figure 5).

We have previously shown that expression of genes encoding I. ricinus T-TEPs responds differentially to different model microbes (E. coli, Micrococcus luteus, or C. albicans) or to aseptic injury (Urbanova et al., 2015). Here we have analyzed the expression response of t-teps to injection of available species of the B. burgdorferi sensu lato complex. Surface-sterilized unfed I. ricinus females were injected with sterile PBS as an aseptic injection control (injury), four different cultivated Borrelia species, and BSK-H medium alone as a mock. Total RNA was isolated 12 h after injection from whole body homogenates and mRNA levels of the genes encoding t-teps were determined by qPCR. Gene irc3-1 was the only t-tep for which, expression seemed to be up-regulated upon injection of the tested Borrelia genospecies (2–3 times, in relation to the PBS and BSK-H injection controls) (Figure 6). Expression of other t-teps did not change in response to any Borrelia species or injection injury (Figure S1).

In order to examine whether or not immune reactions in the tick hemocoel affect Borrelia transmission to the host, we adapted the laboratory model for Borrelia transmission developed for B. burgdorferi sensu stricto and I. scapularis (Ramamoorthi et al., 2005; Dai et al., 2009) and applied it for I. ricinus nymphs infected with B. afzelii CB43 as described above. Groups of unfed, infected nymphs were injected with four combinations of dsRNAs, corresponding to the four classes of tick TEPs: (i) α₂-macroglobulins (IrA₂M-1,2,3); (ii) C3-complement component (IrC3-1,2,3); (iii) macroglobulin-complement-related (IrMcr-1,2), and (iv) insect-type IrTep, respectively. The efficiency of RNAi combinatorial KD was verified by qRT-PCR using cDNA prepared from a pool of five randomly selected nymphs. Additionally, we also tested whether the elimination of phagocytosis that followed pre-injection of LtxB (Figure 3B) affected transmission of B. afzelii. Mice infected with Borrelia during the early phase following tick infestation were tested in ear tissue biopsies taken at 1 week intervals. After 4 weeks, the mice were sacrificed and Borrelia spirochetes were detected in the bladder and heart (Table 1). The Borrelia numbers in ear biopsies fluctuated, ranging from a few to several thousand spirochetes, usually reaching a maxima from the 2nd to 3rd week following infestation and then gradually decreasing (Table S1). The spirochete burdens in bladders and hearts in the 4th week after infestation were relatively stable, in the range of several hundreds of spirochetes per murine genome (Figure 7). The only statistically significant decrease of Borrelia load compared to the GFP control was observed in mice heart upon group silencing of irc3-1,2,3 genes. Based on these results we conclude that T-TEPS and phagocytosis do not substantially affect the competence of I. ricinus to act as a vector for Lyme disease.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.