<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell Dev. Biol.</journal-id>
<journal-title>Frontiers in Cell and Developmental Biology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell Dev. Biol.</abbrev-journal-title>
<issn pub-type="epub">2296-634X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1622998</article-id>
<article-id pub-id-type="doi">10.3389/fcell.2025.1622998</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Cell and Developmental Biology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Excessive progesterone impairs mouse decidualization via the Kyn-AhR pathway</article-title>
<alt-title alt-title-type="left-running-head">Luo et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fcell.2025.1622998">10.3389/fcell.2025.1622998</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Luo</surname>
<given-names>Hui-Na</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3149325/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/validation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Yang</surname>
<given-names>Hong-Yuan</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/3091153/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Zai-Mei</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Luo</surname>
<given-names>Jia-Mei</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhang</surname>
<given-names>Tong-Tong</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/data-curation/"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Yang</surname>
<given-names>Zeng-Ming</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1961509/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>College of Veterinary Medicine, South China Agricultural University</institution>, <addr-line>Guangzhou</addr-line>, <country>China</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountain Region, College of Animal Science, Guizhou University</institution>, <addr-line>Guiyang</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/263481/overview">V&#xed;ctor Carriel</ext-link>, University of Granada, Spain</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2015137/overview">Zhenshan Yang</ext-link>, Lund University, Sweden</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2588258/overview">Yali Hu</ext-link>, Nanjing Drum Tower Hospital, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/3085284/overview">Medhi Wangpaichitr</ext-link>, Miami VA Healthcare System, Veterans Health Administration, United States Department of Veterans Affairs, United States</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Zeng-Ming Yang, <email>yangzm@gzu.edu.cn</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>22</day>
<month>09</month>
<year>2025</year>
</pub-date>
<pub-date pub-type="collection">
<year>2025</year>
</pub-date>
<volume>13</volume>
<elocation-id>1622998</elocation-id>
<history>
<date date-type="received">
<day>05</day>
<month>05</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>08</day>
<month>09</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Luo, Yang, Wang, Luo, Zhang and Yang.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Luo, Yang, Wang, Luo, Zhang and Yang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Progesterone (P<sub>4</sub>) is essential for pregnancy establishment and maintenance. Clinically, P<sub>4</sub> is widely used to regulate the menstrual cycle, maintain pregnancy, and treat luteal phase deficiency. However, P<sub>4</sub> administration protocols, particularly regarding routes, dosage, and timing remain poorly defined. Although excessive P<sub>4</sub> impairs embryo implantation and decidualization in mice, the underlying mechanism remains unclear. Our data show that decidualization in day 8 pregnant mice and artificial decidualization in day 8 pseudopregnant mice are impaired by 4 mg or 8 mg/mouse P<sub>4</sub>. The mRNA levels of <italic>Prl8a2 and Prl3c1,</italic> markers of <italic>in vitro</italic> decidualization are significantly downregulated by 10 or 20 &#x3bc;M P<sub>4</sub>. The uterine fluorescent signal of indoleamine 2,3-dioxygenase 1 (IDO1) and protein levels of tryptophan 2,3-dioxygenase (TDO) are increased after ovariectomized mice are treated with excessive P<sub>4</sub>. Treatment of uterine stromal cells with excessive P<sub>4</sub> also significantly upregulates the protein levels of IDO1 and TDO, and kynurenine (Kyn) secretion. Epacadostat (IDO1 antagonist) or RU486 (progesterone receptor antagonist) effectively block P<sub>4</sub>-induced Kyn elevation. The mRNA levels of <italic>Prl8a2</italic> and <italic>Prl3c1 and</italic> the protein levels of BMP2 are significantly inhibited by Kyn. The high-dose of P<sub>4</sub> activates the aryl hydrocarbon receptor (AhR) and its downstream targets CYP1A1 and CYP1B1. Under <italic>in vitro</italic> decidualization, the mRNA levels of <italic>Prl8a2</italic> and <italic>Prl3c1</italic> are inhibited by 2-OH-E<sub>2</sub> and 4-OH-E<sub>2</sub>, the catalytic products of CYP1A1 and CYP1B1, respectively. CH-223191, a specific AhR antagonist, effectively counteracts the effects of Kyn on <italic>Cyp1a1</italic>, <italic>Cyp1b1</italic>, and <italic>Prl8a2</italic> expression. Additionally, nucleolar size in stromal cells is increased both <italic>in vivo</italic> and <italic>in vitro</italic> following excessive P<sub>4</sub> treatment. Our findings suggest that excessive P<sub>4</sub> impairs mouse decidualization via the Kyn-AhR pathway.</p>
</abstract>
<kwd-group>
<kwd>decidualization</kwd>
<kwd>progesterone</kwd>
<kwd>IDO1</kwd>
<kwd>TDO</kwd>
<kwd>KYN</kwd>
<kwd>AhR</kwd>
<kwd>nucleolin</kwd>
</kwd-group>
<contract-num rid="cn001">32171114 and 31871511</contract-num>
<contract-sponsor id="cn001">National Natural Science Foundation of China<named-content content-type="fundref-id">10.13039/501100001809</named-content>
</contract-sponsor>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Embryonic Development</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1">
<title>1 Introduction</title>
<p>Embryo implantation and decidualization are pivotal steps for a successful pregnancy. Decidualization involves the conversion of endometrial fibroblastic stromal cells into specialized decidual cells, which establish a nutrient and immunologically privileged environment for fetal development (<xref ref-type="bibr" rid="B21">Gellersen and Brosens, 2014</xref>). Deficiency in embryo implantation and decidualization can lead to adverse pregnancy outcomes, including delayed embryo development, preeclampsia, miscarriage, and preterm birth (<xref ref-type="bibr" rid="B12">Cheng et al., 2023</xref>). Ovarian estrogen (E<sub>2</sub>) and progesterone (P<sub>4</sub>) closely regulate this process in mice and humans (<xref ref-type="bibr" rid="B65">Paria et al., 2000</xref>). P<sub>4</sub> is essential for embryo implantation in all studied species (<xref ref-type="bibr" rid="B80">Wetendorf and DeMayo, 2012</xref>). In mice, pregnancy maintenance until parturition relies on continuous P<sub>4</sub> secretion from the corpus luteum (<xref ref-type="bibr" rid="B56">Maurya et al., 2021</xref>). P<sub>4</sub> primarily functions through progesterone receptors (PR), including PR-A and PR-B. Mice lacking both PR-A and PR-B (Pgr<sup>&#x2212;/&#x2212;</sup>) exhibit ovarian and uterine defects (<xref ref-type="bibr" rid="B52">Lydon et al., 1995</xref>; <xref ref-type="bibr" rid="B53">Lydon et al., 1996</xref>).</p>
<p>In clinical practice, P<sub>4</sub> is widely used for the conservative management of luteal phase deficiency (LPD) and for treating threatened and recurrent abortion (<xref ref-type="bibr" rid="B72">Soules et al., 1977</xref>; <xref ref-type="bibr" rid="B13">Daya et al., 1988</xref>). LPD is a pregnancy disorder associated with infertility and spontaneous abortion, and the potential etiologies include inadequate P<sub>4</sub> duration, inadequate P<sub>4</sub> levels, or endometrial P<sub>4</sub> resistance (<xref ref-type="bibr" rid="B29">Jones, 1976</xref>). Nevertheless, little agreement exists on LPD diagnosis and treatment (<xref ref-type="bibr" rid="B32">Karamardian and Grimes, 1992</xref>). Although P<sub>4</sub> has a significant positive impact on reproductive outcomes in assisted reproduction, the scientific debate remains open regarding P<sub>4</sub> administration protocols, particularly concerning routes of administration, dosage, timing, and potential interactions with other drugs (<xref ref-type="bibr" rid="B20">Garg et al., 2024</xref>). A previous study showed that P<sub>4</sub> supplementation in natural frozen embryo transfer cycles does not increase the pregnancy rate (<xref ref-type="bibr" rid="B19">Eftekhar et al., 2013</xref>). A prospective study also demonstrates that P<sub>4</sub> has no any significant positive impact on pregnancy outcomes in cases of threatened miscarriage (<xref ref-type="bibr" rid="B6">Boza et al., 2016</xref>). Women experiencing recurrent miscarriage exhibit reduced endometrial P<sub>4</sub> levels. However, it remains unclear whether reduced P<sub>4</sub> levels can predict or contribute to adverse pregnancy outcomes (<xref ref-type="bibr" rid="B59">McLindon et al., 2023</xref>). Concerns exist about progestin use in pregnancy, particularly the potential risk of genital anomalies (e.g., hypospadias in males, female virilization) and non-genital malformations (<xref ref-type="bibr" rid="B8">Carmichael et al., 2005</xref>). For clinicians, supplementing P<sub>4</sub> for all possible LPD patients is an empirical practice. P<sub>4</sub> as luteal phase support may carry the risk of overconsumption and has adverse effects on pregnancy outcomes. Consequently, it is indispensable to further examine whether excessive P<sub>4</sub> has any influence on pregnancy outcomes.</p>
<p>Tryptophan (Trp), an essential amino acid, is necessary during pregnancy (<xref ref-type="bibr" rid="B2">Badawy, 2015</xref>; <xref ref-type="bibr" rid="B3">Badawy et al., 2016</xref>; <xref ref-type="bibr" rid="B26">Hoang et al., 2023</xref>; <xref ref-type="bibr" rid="B83">Xue et al., 2023</xref>). Trp is mainly metabolized through kynurenine (Kyn) pathway, which is closely associated with various diseases through its metabolites (<xref ref-type="bibr" rid="B73">Stone and Darlington, 2002</xref>). Indoleamine-2,3-dioxygenase (IDO) and tryptophan-2,3-dioxygenase (TDO), two key enzymes, regulate the first and rate-limiting step of the Kyn pathway (<xref ref-type="bibr" rid="B1">Austin et al., 2010</xref>). IDO and TDO are implicated in various diseases, including inflammation, cancer, diabetes, and mental disorders (<xref ref-type="bibr" rid="B86">Ye et al., 2019</xref>). The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor, is involved in the metabolism of polycyclic aromatic hydrocarbons and estrogens through regulating cytochrome P450 enzymes CYP1A1 and CYP1B1 upon activation by Kyn (<xref ref-type="bibr" rid="B88">Yin et al., 2016</xref>; <xref ref-type="bibr" rid="B64">Pacheco and Elizondo, 2023</xref>). Furthermore,CYP1A1 and CYP1B1 participate in the metabolism of estrogen and generate 2-hydroxyestradiol (2-OH-E<sub>2</sub>) and 4-hydroxyestradiol (4-OH-E<sub>2</sub>), respectively (<xref ref-type="bibr" rid="B41">Lee et al., 2003</xref>). P<sub>4</sub> regulates TDO2 expression in endometrium and breast tissue, contributing to both normal tissue function and tumor growth (<xref ref-type="bibr" rid="B42">Li et al., 2014</xref>; <xref ref-type="bibr" rid="B50">Liu et al., 2020</xref>; <xref ref-type="bibr" rid="B28">Hutchinson et al., 2022</xref>). Furthermore, activation of the IDO/TDO/Kyn/AhR pathway plays a crucial role in promoting tumor growth (<xref ref-type="bibr" rid="B64">Pacheco and Elizondo, 2023</xref>).</p>
<p>In this study, we examined whether excessive P<sub>4</sub> has any effects on Kyn-AhR pathway during early pregnancy. Our data showed that excessive P<sub>4</sub> activates Kyn-AhR pathway that suppresses mouse decidualization.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Animal treatments</title>
<p>All animal experiments were approved by the Institutional Animal Care and Use Committee of South China Agricultural University. Adult CD1 mice (6&#x2013;8 weeks old) were maintained in a temperature- and light-regulated environment with a 14 h light/10 h dark photoperiod. Pregnant and pseudopregnant female mice were obtained by mating with fertile or vasectomized male mice, respectively. The day when the vaginal plug was detected was defined as day 1 of pregnancy (D1) or pseudopregnancy.</p>
<p>The P<sub>4</sub> doses used in this experiment were based on our previous study (<xref ref-type="bibr" rid="B48">Liang et al., 2018</xref>). To investigate effects of excessive P<sub>4</sub> on early pregnancy, pregnant mice were subcutaneously injected with 2, 4, or 8 mg of P<sub>4</sub> (P0130, Sigma-Aldrich, St. Louis, MO) in 100 &#x3bc;L of sesame oil (S9057, Macklin, Shanghai, China) at 9:00 AM daily from days 3&#x2013;7. Control mice received 100 &#x3bc;L of sesame oil. On day 8, the mice were sacrificed to collect uteri for further analysis.</p>
<p>To further examine effects of P<sub>4</sub>, ovariectomized mice rested for 2 weeks were subcutaneously injected with 2, 4, or 8 mg of P<sub>4</sub> in 100 &#x3bc;L of sesame oil for 1, 3, or 7 consecutive days. Control mice received 100 &#x3bc;L of sesame oil. Mice were sacrificed 24 h after the last injection to collect uteri for further analysis.</p>
</sec>
<sec id="s2-2">
<title>2.2 Artificial decidualization</title>
<p>Artificial decidualization was induced as previously described (<xref ref-type="bibr" rid="B48">Liang et al., 2018</xref>). Briefly, on day 4 of pseudopregnancy, 10 &#x3bc;L of sesame oil was injected into one uterine horn to induce decidualization, and the contralateral horn served as a control. Female mice undergoing artificial decidualization were subcutaneously injected with 4 mg P<sub>4</sub> daily from days 5&#x2013;7, while controls received 100 &#x3bc;L of sesame oil. On day 8 of pseudopregnancy, mice were sacrificed to collect uteri for further analysis.</p>
</sec>
<sec id="s2-3">
<title>2.3 Cell isolation, culture and treatments</title>
<p>Mouse endometrial stromal cells were isolated and cultured as previously described (<xref ref-type="bibr" rid="B45">Li et al., 2023a</xref>). Briefly, the uteri of day 4 pseudopregnant mice were longitudinally incised and digested with HBSS (PB180321, Procell, Wuhan, China) containing 1% trypsin (0,458, VWR, Radnor, PA) and 6 mg/mL dispase (82,003,500, Sigma-Aldrich, St. Louis, MO). After the uteri were rinsed in HBSS to remove luminal epithelial cells, the remaining tissue was further digested with 0.15 mg/mL collagenase I (2,691,550, Gibco, Grand Island, NY). The collected stromal cells were cultured in DMEM/F12 medium (D2906, Sigma-Aldrich, St. Louis, MO) supplemented with 10% FBS (164,210, Procell, Wuhan, China).</p>
<p>Mouse stromal cells were induced for <italic>in vitro</italic> decidualization using 10 nM E<sub>2</sub> (HY-B0141, MedChemExpress, NJ, USA) and 1 &#x3bc;M P<sub>4</sub> as previously described (<xref ref-type="bibr" rid="B9">Chen et al., 2023</xref>). The P<sub>4</sub> doses for the <italic>in vitro</italic> experiments were based on previous studies (<xref ref-type="bibr" rid="B48">Liang et al., 2018</xref>; <xref ref-type="bibr" rid="B74">Suthaporn et al., 2021</xref>). To investigate the effects of excessive P<sub>4</sub> on decidualization, stromal cells under <italic>in vitro</italic> decidualization were treated with different doses of P<sub>4</sub> and analyzed the mRNA levels of <italic>Prl8a2</italic> and <italic>Prl3c1</italic>, markers of mouse <italic>in vitro</italic> decidualization. To examine effects of Kyn on decidualization, stromal cells under <italic>in vitro</italic> decidualization were treated with different concentrations of L-kynurenine (HY-104026; MedChemExpress, NJ, USA).</p>
</sec>
<sec id="s2-4">
<title>2.4 Kynurenine assay</title>
<p>Kynurenine amount was measured as previously described (<xref ref-type="bibr" rid="B10">Chen et al., 2024a</xref>). Briefly, the cultured medium was collected from cultured stromal cells and centrifuged at 5,000&#xd7;g for 10 min to remove cellular debris. Total 360 &#x3bc;L supernatant was mixed with 180 &#x3bc;L of 30% trichloroacetic acid (TCA; T6399, Sigma-Aldrich, St. Louis, MO) and incubated at 50 &#xb0;C for 30 min. After the mixture was centrifuged at 3,000 &#xd7; g for 10 min, the supernatant was thoroughly mixed with an equal volume of Ehrlich reagent (2% p-dimethylaminobenzaldehyde, D109644, Aladdin, Shanghai, China) and incubated for 12&#x2013;30 min. The absorbance was measured at 492 nm to calculate the concentration using a standard curve of L-kynurenine.</p>
</sec>
<sec id="s2-5">
<title>2.5 RNA extraction and real-time PCR</title>
<p>qPCR was performed as previously described (<xref ref-type="bibr" rid="B47">Li et al., 2024</xref>). Total RNAs were extracted from mouse uterine tissue or mouse stromal cells using TRIzol (AG21101, Accurate Biology, Changsha, China). cDNA was synthesized from RNA using the HiScript II Q RT SuperMix kit (R222-01-AB, Vazyme, Nanjing, China). qPCR was performed using the SYBR Premix (Q311-02-AA, Vazyme, Nanjing, China). The data were analyzed using the 2<sup>&#x2212;&#x394;&#x394;</sup>Ct method and normalized to mouse Rpl7. The primer sequences were listed in <xref ref-type="table" rid="T1">Table 1</xref>.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primer sequences used in this study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th colspan="2" align="center">Primer sequences</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Mouse -<italic>Cyp1a1</italic>- sense</td>
<td align="left">CAGAAGGTGATGGCAGAG</td>
</tr>
<tr>
<td align="left">Mouse -<italic>Cyp1a1</italic>- antisense</td>
<td align="left">ACGGAGGACAGGAATGAA</td>
</tr>
<tr>
<td align="left">Mouse -<italic>Cyp1b1</italic>- sense</td>
<td align="left">CTGGACTTGGAGGATGTG</td>
</tr>
<tr>
<td align="left">Mouse -<italic>Cyp1b1</italic>- antisense</td>
<td align="left">GCTGGAGAATCGCATTGA</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Prl8a2</italic>-sense</td>
<td align="left">AGCCAGAAATCACTGCCACT</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Prl8a2</italic>-antisense</td>
<td align="left">TGATCCATGCACCCATAAAA</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Prl3c1</italic>-sense</td>
<td align="left">GCCACACGATATGACCGGAA</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Prl3c1</italic>-antisense</td>
<td align="left">GGTTTGGCACATCTTGGTGTT</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Rpl7</italic>-sense</td>
<td align="left">GCAGATGTACCGCACTGAGATTC</td>
</tr>
<tr>
<td align="left">Mouse<italic>-Rpl7</italic>-antisense</td>
<td align="left">ACCTTTGGGCTTACTCCATTGATA</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-6">
<title>2.6 Western blot</title>
<p>Western blot was performed as previously described (<xref ref-type="bibr" rid="B11">Chen et al., 2024b</xref>). After tissues or cultured cells were lysed with RIPA (R0010, Solarbio, Beijing, China), the protein concentration was determined by the BCA method (23,225, Thermo Fisher Scientific, Waltham, MA). The samples were separated via SDS-polyacrylamide gel electrophoresis and transferred onto a PVDF membrane (Immobilon&#xae;-P, IPVH00010, Millipore, Billerica, MA). After blocked with 5% nonfat milk (A600669, Sangon Biotech, Shanghai, China), the PVDF membranes were incubated with each primary antibody and secondary antibody (1:5,000). The signal was detected using the ECL chemiluminescence kit (Millipore). The primary antibodies utilized in this study include IDO1 (51,851, Cell Signaling Technology, Danvers, MA), TDO (ab259359, Abcam, Cambridge, United Kingdom), BMP2 (A0231, ABclonal, Wuhan, China), SNAIL (3879T, Cell Signaling Technology, Danvers, MA), AhR (A00225-4, Boster, Wuhan, China), CYP1A1 (GTX55582, GeneTex), CYP1B1 (GTX104424, GeneTex), and &#x3b1;-TUBULIN (2144S, Cell Signaling Technology, Danvers, MA), GAPDH (SC-32233, Santa Cruz Biotechnology, Dallas, TX), Histone H3 (ab176842, Abcam, Cambridge, United Kingdom).</p>
</sec>
<sec id="s2-7">
<title>2.7 Immunofluorescence</title>
<p>Immunofluorescence was performed as previously described (<xref ref-type="bibr" rid="B46">Li et al., 2023b</xref>). Briefly, paraffin sections were dewaxed and rehydrated. Antigen retrieval was achieved with citrate buffer (pH 6.0) or Tris/EDTA buffer (pH 9.0). Cell membranes were permeabilized with 0.1% Triton X-100 (T0694, Sangon Biotech, Shanghai, China) in PBS. After non-specific binding was blocked with horse serum (ZLI-9024, ZSGB-BIO, Beijing, China) for 1 h, sections were incubated with each primary antibody overnight at 4 &#xb0;C and Alexa 488-conjugated secondary antibody (169,549, Jackson ImmunoResearch, West Grove, PA) at 37 &#xb0;C for 30 min. Nuclei were counterstained with propidium iodide (PI, P4170, Sigma-Aldrich, St. Louis, MO) or 4&#x2032;,6-diamidino-2-phenylindole (DAPI, D9542, Sigma-Aldrich, St. Louis, MO). Fluorescence signals were captured using a Nikon C2 confocal microscope. The primary antibodies used in this study include IDO1 (66,528-1, Proteintech, Wuhan, China), Phospho-AhR (PA5-36025, Invitrogen, Carlsbad, CA), AhR (A00225-4, Boster, Wuhan, China) and Nucleolin (14,574, Cell Signaling Technology, Danvers, MA).</p>
</sec>
<sec id="s2-8">
<title>2.8 Cytoplasmic and nuclear extracts</title>
<p>The nuclear and cytoplasmic extractions were conducted as previously described (<xref ref-type="bibr" rid="B14">Deng et al., 2014</xref>). Cultured cells were washed twice with pre-chilled PBS, incubated with Buffer B (5 mM EDTA in PBS) on ice for 5 min and scraped off from culture plates. After centrifuged at 1,000 g for 5 min at 4 &#xb0;C, the pellet was resuspended in Buffer A (10 mM HEPES, 10 mM KCl, 0.1 mM EDTA with fresh added dithiothreitol and phenylmethylsulfonyl fluoride) and shaked at 4 &#xb0;C for 20 min, mixed with 2.5% Nonidet P-40 and vortexed for 10 s. Following centrifugation at 15,000 g for 5 min at 4 &#xb0;C, the supernatant was collected as cytoplasmic protein. The remaining pellet was resuspended in Buffer C (20 mM HEPES, 0.4 M NaCl, 1 mM EDTA, freshly added DTT and PMSF), vortexed, and centrifuged at 18,000 g for 5 min at 4 &#xb0;C, and collected the supernatant as nuclear protein.</p>
</sec>
<sec id="s2-9">
<title>2.9 Statistical analysis</title>
<p>Data are presented as mean &#xb1; standard deviation. The two-tailed Student&#x2019;s t-test was used to compare two groups. For more than two groups, one-way ANOVA was conducted with <italic>post hoc</italic> tests: LSD (if equal variances were assumed based on Levene&#x2019;s test) or Games-Howell (if variances were unequal). Statistical significance was set at &#x2a;P &#x3c; 0.05, &#x2a;&#x2a;P &#x3c; 0.01, and &#x2a;&#x2a;&#x2a;P &#x3c; 0.001.</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<sec id="s3-1">
<title>3.1 Excessive P<sub>4</sub> impairs decidualization in mice</title>
<p>To examine effects of excessive P<sub>4</sub> on decidualization, pregnant mice were subcutaneously injected with 4 mg or 8 mg of P<sub>4</sub> in 100 &#x3bc;L sesame oil daily from days 3&#x2013;7 of pregnancy. Compared with controls, the decidual weight of implantation site on day 8 was significantly reduced by 4 mg or 8 mg P<sub>4</sub> treatments (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Alkaline phosphatase is a marker of mouse decidualization (<xref ref-type="bibr" rid="B87">Yee and Kennedy, 1988</xref>). The staining density of alkaline phosphatase activity in day 8 pregnant uterus was also significantly decreased by 4 mg or 8 mg P<sub>4</sub> (<xref ref-type="fig" rid="F1">Figure 1B</xref>). Under artificial decidualization, the decidual weight on day 8 pseudopregnant mice was significantly reduced by 4 mg P<sub>4</sub> treatments from days 5&#x2013;7 (<xref ref-type="fig" rid="F1">Figure 1C</xref>). <italic>Prl8a2</italic> and <italic>Prl3c1</italic> serve as markers for mouse <italic>in vitro</italic> decidualization (<xref ref-type="bibr" rid="B67">Rasmussen et al., 1997</xref>). Under <italic>in vitro</italic> decidualization, <italic>Prl8a2</italic> mRNA was significantly downregulated by 20 &#x3bc;M P<sub>4</sub>, while no significant changes were observed by 0.16, 0.8, or 4 &#x3bc;M P<sub>4</sub> treatment for 2 days (<xref ref-type="fig" rid="F1">Figure 1D</xref>). Meanwhile, <italic>Prl3c1</italic> mRNA levels were significantly reduced by 10 &#x3bc;M or 20 &#x3bc;M P<sub>4</sub> (<xref ref-type="fig" rid="F1">Figure 1D</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Excessive P<sub>4</sub> impairs mouse decidualization. <bold>(A)</bold> Representative images and the decidual weights of implantation site on day 8 of pregnancy after pregnant mice were daily treated with P<sub>4</sub> (4 mg or 8 mg) from days 3&#x2013;7. <bold>(B)</bold> Alkaline phosphatase staining of day 8 uteri after pregnant mice were treated daily with P<sub>4</sub> (4 mg or 8 mg) from days 3&#x2013;7. <bold>(C)</bold> Representative images and the decidual weights of day 8 pseudopregnant uteri after pseudopregnant mice under artificial decidualization were treated daily with 4 mg P<sub>4</sub> from days 5&#x2013;7. <bold>(D)</bold> Effects of P<sub>4</sub> treatment on <italic>Prl8a2</italic> and <italic>Prl3c1</italic> mRNA levels under <italic>in vitro</italic> decidualization for 2 days. The qPCR values were normalized to the <italic>Rpl7</italic> mRNA level. All images are the representative of at least three biologically independent experiments. &#x2a;, p &#x3c; 0.05; &#x2a;&#x2a;, p &#x3c; 0.01; &#x2a;&#x2a;&#x2a;, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g001.tif">
<alt-text content-type="machine-generated">(A) Three rows of red-stained tissue samples labeled Con, 4 mg P&#x2084;, and 8 mg P&#x2084; with a bar graph showing a significant increase in weight of DB (S) for 4 and 8 mg P&#x2084;.(B) Microscopic images of tissue cross-sections labeled Con, 4 mg P&#x2084;, and 8 mg P&#x2084;, with a bar graph indicating a decrease in relative ALP activity for 4 and 8 mg P&#x2084;.(C) Tissue samples labeled Con and 4 mg P&#x2084;, with a bar graph showing a significant decrease in decidua weight for 4 mg P&#x2084;.(D) Bar graphs showing relative expression levels of Prl8a2 and Prl3c1 with varying concentrations of P&#x2084; (0, 0.16, 0.8, 4, 20) with E+P, highlighting significant changes.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>3.2 P<sub>4</sub> activates the IDO1/TDO-Kyn pathway</title>
<p>Trp is crucial during pregnancy and mainly metabolized via Kyn pathway (<xref ref-type="bibr" rid="B2">Badawy, 2015</xref>; <xref ref-type="bibr" rid="B3">Badawy et al., 2016</xref>; <xref ref-type="bibr" rid="B26">Hoang et al., 2023</xref>; <xref ref-type="bibr" rid="B83">Xue et al., 2023</xref>). TDO, IDO1 and IDO2 are the key rate-limiting enzymes in Kyn pathway and essential for pregnancy (<xref ref-type="bibr" rid="B62">Munn et al., 1998</xref>). Because excess P<sub>4</sub> is detrimental for pregnancy, we wondered whether Kyn pathway was affected by excess P<sub>4</sub>. When ovariectomized mice were treated with 4 mg or 8 mg P<sub>4</sub> for 7 days, uterine Kyn levels were significantly increased (<xref ref-type="fig" rid="F2">Figure 2A</xref>). IDO1 immunofluorescence signals in the uterine luminal epithelium were clearly increased after ovariectomized mice were treated with 4 mg or 8 mg P<sub>4</sub> for 24 h, while 2 mg P<sub>4</sub> had no obvious effect (<xref ref-type="fig" rid="F2">Figure 2C</xref>). Uterine TDO protein levels were also upregulated by 2 mg or 4 mg P<sub>4</sub>, but not by 8 mg P<sub>4</sub> (<xref ref-type="fig" rid="F2">Figure 2D</xref>).</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>P<sub>4</sub> activates the IDO1/TDO-Kyn pathway. <bold>(A)</bold> Kyn levels in uterine tissues after ovariectomized mice were subcutaneously injected with 2 mg, 4 mg, or 8 mg P<sub>4</sub> per mouse for 7 consecutive days. <bold>(B)</bold> Kyn levels in culture medium after stromal cells were treated with P<sub>4</sub> with or without RU486 for 2 days. <bold>(C)</bold> Uterine IDO1 immunofluorescence after ovariectomized mice were treated with P<sub>4</sub> (2 mg, 4 mg, 8 mg) for 24 h. Nuclei were counter-stained with DAPI. Le, luminal epithelia; St, stroma. Scale bar, 50 &#x3bc;m. n &#x3d; 3 mice per group. <bold>(D)</bold> Uterine TDO protein levels after ovariectomized mice were treated with P<sub>4</sub> for 24 h. <bold>(E)</bold> Western blot analysis of IDO1 and TDO protein levels in stromal cells treated with P<sub>4</sub> for 3 days. <bold>(F)</bold> IDO1 and TDO protein levels in stromal cells treated with 4 &#x3bc;M P<sub>4</sub> with or without RU486 for 2 days. <bold>(G)</bold> IDO1 protein levels in stromal cells treated with 4 &#x3bc;M P<sub>4</sub> with or without Epacadostat for 2 days. <bold>(H)</bold> Kyn levels in the culture medium after stromal cells were treated with 4 &#x3bc;M P<sub>4</sub> with or without Epacadostat for 2 days. All images are the representative of at least three biologically independent experiments. &#x2a;, p &#x3c; 0.05; &#x2a;&#x2a;, p &#x3c; 0.01; &#x2a;&#x2a;&#x2a;, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g002.tif">
<alt-text content-type="machine-generated">Composite image of experimental data:(A) Bar chart showing kynurenine concentration at different P&#x2084; mg doses. Significant differences indicated by asterisks.(B) Bar chart of kynurenine concentration with P&#x2084; &#xB5;M and RU486 treatments. Multiple significant differences marked.(C) Microscopy images displaying IDO1 expression in tissue sections treated with varying P&#x2084; mg doses. Staining intensity varies with dose.(D) Western blot of TDO levels at different P&#x2084; mg doses, with a bar chart of relative TDO levels below. Significant changes noted.(E) Western blot of IDO1, TDO, and TUBULIN at various P&#x2084; &#xB5;M doses, with bar charts showing relative IDO1 and TDO levels. Significant differences indicated.(F) Western blot of IDO1 and TDO with P&#x2084; and RU486 treatments, accompanied by bar charts showing relative levels with significant differences.(G) Western blot of IDO1 and TUBULIN with P&#x2084; and Epacadostat treatments, with a bar chart on relative IDO1 level. Significant differences indicated.(H) Bar chart of kynurenine concentration with varying P&#x2084; and Epacadostat &#xB5;M. Significant differences noted.</alt-text>
</graphic>
</fig>
<p>After stromal cells were treated with 0.16, 0.8, 4, or 20 &#x3bc;M P<sub>4</sub> for 2 days, Kyn secretion was significantly increased, which was abrogated by RU486, an antagonist of progesterone receptor (<xref ref-type="fig" rid="F2">Figure 2B</xref>). IDO1 and TDO protein levels were also significantly increased after stromal cells were treated with 0.16, 0.8, or 4 &#x3bc;M P<sub>4</sub> for 3 days (<xref ref-type="fig" rid="F2">Figure 2E</xref>). P<sub>4</sub>-induced increases in IDO1 and TDO protein levels were blocked by RU486 treatments (<xref ref-type="fig" rid="F2">Figure 2F</xref>). Epacadostat, a selective inhibitor of IDO1, effectively suppressed P<sub>4</sub>-induced increases in IDO1 protein levels and Kyn secretion (<xref ref-type="fig" rid="F2">Figures 2G,H</xref>).</p>
</sec>
<sec id="s3-3">
<title>3.3 Kyn impairs decidualization of mouse stromal cells and activates AhR</title>
<p>Because high-dose P<sub>4</sub> increases Kyn levels, we explored whether Kyn had any effects on decidualization. Under <italic>in vitro</italic> decidualization, <italic>Prl8a2</italic> mRNA levels were significantly downregulated in a dose-dependent manner by 0.25, 0.5, or 1 mM Kyn (<xref ref-type="fig" rid="F3">Figure 3A</xref>). Meanwhile, <italic>Prl3c1</italic> mRNA levels were upregulated by 0.5 mM Kyn, but downregulated by 1 mM Kyn (<xref ref-type="fig" rid="F3">Figure 3A</xref>). BMP2 is essential for decidualization (<xref ref-type="bibr" rid="B79">Wang and Dey, 2006</xref>). BMP2 protein levels were downregulated after stromal cells were treated with 0.2, or 1 mM Kyn, whereas 0.04 mM Kyn had no detectable change on BMP2 protein levels for 2 days (<xref ref-type="fig" rid="F3">Figure 3B</xref>). SNAIL, a key player during the epithelial-mesenchymal transition, is decreased during decidualization (<xref ref-type="bibr" rid="B90">Zhang et al., 2013</xref>; <xref ref-type="bibr" rid="B70">Serrano-Gomez et al., 2016</xref>). SNAIL protein levels were significantly upregulated after stromal cells were treated with 0.2, or 1 mM Kyn rather than 0.04 mM Kyn for 2 days (<xref ref-type="fig" rid="F3">Figure 3B</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Kyn impairs decidualization of mouse stromal cells and activates AhR. <bold>(A)</bold> <italic>Prl8a2</italic> and <italic>Prl3c1</italic> mRNA levels after stromal cells were treated with Kyn for 2 days under <italic>in vitro</italic> decidualization. <bold>(B)</bold> Western blot analysis and quantification of BMP2 and SNAIL protein levels in stromal cells treated with Kyn for 2 days. <bold>(C)</bold> AhR fluorescence in stromal cells treated with 1 mM Kyn with or without 10 &#x3bc;M CH223191 for 24 h. Nuclei were counter-stained with DAPI. Scale bar, 50 &#x3bc;m. <bold>(D)</bold> The mRNA levels of <italic>Cyp1a1</italic> and <italic>Cyp1b1</italic> after stromal cells were treated with Kyn for 2 days under <italic>in vitro</italic> decidualization. All images are the representative of at least three biologically independent experiments. &#x2a;, p &#x3c; 0.05; &#x2a;&#x2a;, p &#x3c; 0.01; &#x2a;&#x2a;&#x2a;, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g003.tif">
<alt-text content-type="machine-generated">(A) Bar graphs show the relative expression levels of Ptgs2 and Ptgs1 after Kynurenine (Kyn) treatment at different concentrations, with statistical significance marked. (B) Western blots and corresponding bar graphs display BMP2 and SNAIL protein levels under various Kyn concentrations. (C) Immunofluorescence images depict AhR expression in control, Kyn, and Kyn+CH223191 conditions, with green indicating AhR and blue for nuclei. (D) Bar graphs illustrate relative Cyp1a1 and Cyp1b1 expression with varying Kyn concentrations and significance indicators.</alt-text>
</graphic>
</fig>
<p>Kyn is an effective AhR agonist (<xref ref-type="bibr" rid="B17">DiNatale et al., 2010</xref>). Treatment of stromal cells with 1 mM Kyn increased the fluorescence intensity of nuclear AhR, which was abrogated by CH-223191, a specific AhR antagonist (<xref ref-type="fig" rid="F3">Figure 3C</xref>). CYP1A1 and CYP1B1 are downstream targets of AhR (<xref ref-type="bibr" rid="B15">Denison and Whitlock, 1995</xref>; <xref ref-type="bibr" rid="B63">Nebert and Dalton, 2006</xref>; <xref ref-type="bibr" rid="B54">MacPherson et al., 2013</xref>). Under <italic>in vitro</italic> decidualization, <italic>Cyp1a1</italic> and <italic>Cyp1b1</italic> mRNA levels were significantly downregulated, but upregulated in a dose-dependent manner by 0.25, 0.5, or 1 mM Kyn (<xref ref-type="fig" rid="F3">Figure 3D</xref>).</p>
</sec>
<sec id="s3-4">
<title>3.4 P<sub>4</sub> activates the AhR-CYP1A1/CYP1B1 signaling pathway</title>
<p>We further explored whether excessive P<sub>4</sub> could directly activate the AhR pathway. When ovariectomized mice were treated with 2 or 4 mg P<sub>4</sub>, p-AhR immunofluorescence in stromal cells was enhanced (<xref ref-type="fig" rid="F4">Figure 4A</xref>). The mRNA levels of <italic>Cyp1a1</italic> and <italic>Cyp1b1</italic> were significantly increased after ovariectomized mice were treated with 2, 4, or 8 mg P<sub>4</sub> for 7 days (<xref ref-type="fig" rid="F4">Figure 4B</xref>). Furthermore, CYP1A1 and CYP1B1 protein levels in uterine tissues of ovariectomized mice significantly increased after 4 mg or 8 mg P<sub>4</sub> treatment (<xref ref-type="fig" rid="F4">Figure 4C</xref>). After stromal cells were treated with 2.5, 5, 10, or 20 &#x3bc;M P<sub>4</sub> for 2 days, nuclear AhR protein levels were clearly elevated (<xref ref-type="fig" rid="F4">Figure 4D</xref>). In addition, nuclear AhR fluorescence in stromal cells was enhanced after treatment with 0.8, 4, or 20 &#x3bc;M P<sub>4</sub> for 48 h (<xref ref-type="fig" rid="F4">Figure 4E</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>P<sub>4</sub> activates AhR pathway. <bold>(A)</bold> Uterine phosphorylated AhR immunofluorescence after ovariectomized mice were treated with 2 mg or 4 mg P<sub>4</sub> for 7 days. Nuclei were counter-stained with PI. Le, luminal epithelia; St, stroma. Scale bar, 20 &#x3bc;m. n &#x3d; 3 mice per group. <bold>(B)</bold> Uterine mRNA levels of <italic>Cyp1a1</italic> and <italic>Cyp1b1</italic> after ovariectomized mice were treated with 2, 4 or 8 mg P<sub>4</sub> for 7 days. <bold>(C)</bold> Western blot analysis and quantification of uterine CYP1A1 (3 days injection) and CYP1B1 (7 days injection) protein levels after ovariectomized mice were treated with 2, 4 or 8 mg P<sub>4</sub>. <bold>(D)</bold> Western blot analysis of AhR protein level in nuclear and cytoplasmic fractions, and quantification of AhR in nuclear fractions after stromal cells were treated with P<sub>4</sub> for 48 h <bold>(E)</bold> AhR immunofluorescence in stromal cells treated with 0.8, 4, or 20 &#x3bc;M P<sub>4</sub> for 48 h. Nuclei were counterstained with DAPI. Scale bar: 50 &#x3bc;m. All images are the representative of at least three biologically independent experiments. &#x2a;, p &#x3c; 0.05; &#x2a;&#x2a;, p &#x3c; 0.01; &#x2a;&#x2a;&#x2a;, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g004.tif">
<alt-text content-type="machine-generated">Panels A to E show experimental data on the effects of different concentrations of progesterone (P4) on protein levels. (A) Immunofluorescence images show p-AHR expression in different P4 treatments. (B) Bar graphs depict relative levels of Cyp1a1 and Cyp1b1. (C) Western blot analysis displays CYP1A1, CYP1B1, and Tubulin across P4 concentrations. (D) Western blot shows AhR, Tubulin, and Histone H3 in cytoplasm and nucleus with corresponding bar graph. (E) Immunofluorescence images illustrate AhR expression at various P4 concentrations, with merged images shown below. Asterisks indicate statistical significance.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-5">
<title>3.5 Kyn inhibits stromal decidualization through activating AhR</title>
<p>Under <italic>in vitro</italic> decidualization, Kyn significantly suppressed <italic>Prl8a2</italic> mRNA levels, but upregulated <italic>Cyp1a1</italic> and <italic>Cyp1b1</italic> mRNA levels, which were reversed by CH-223191, a specific AhR antagonist (<xref ref-type="fig" rid="F5">Figures 5A,B</xref>). CYP1A1 and CYP1B1 are cytochrome P450 enzymes that catalyze the formation of non-toxic 2-OH-E<sub>2</sub> and genotoxic 4-OH-E<sub>2</sub> from E<sub>2</sub> (<xref ref-type="bibr" rid="B55">Mao et al., 2023</xref>). Under <italic>in vitro</italic> decidualization, <italic>Prl8a2</italic> and <italic>Prl3c1</italic> mRNA levels were downregulated by 10 &#x3bc;M 2-OH-E<sub>2</sub> and 10 &#x3bc;M 4-OH-E<sub>2</sub>, respectively (<xref ref-type="fig" rid="F5">Figures 5C,D</xref>).</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Kyn inhibits mouse stromal cell decidualization through activating AhR. <bold>(A)</bold> The mRNA levels of <italic>Cyp1a1</italic> and <italic>Cyp1b1 after</italic> stromal cells under <italic>in vitro</italic> decidualization were treated with Kyn for 48 h with or without AhR inhibitor CH223191. <bold>(B)</bold> Prl8a2 mRNA level after stromal cells under <italic>in vitro</italic> decidualization were treated with Kyn for 24 h with or without CH223191. <bold>(C)</bold> The mRNA levels of <italic>Prl8a2</italic> and <italic>Prl3c1</italic> after stromal cells were treated with 2-OH-E<sub>2</sub> for 12 h under <italic>in vitro</italic> decidualization. <bold>(D)</bold> The mRNA levels of <italic>Prl8a2</italic> and <italic>Prl3c1</italic> after stromal cells were treated with 4-OH-E<sub>2</sub> for 24 h under <italic>in vitro</italic> decidualization. All images are the representative of at least three biologically independent experiments. &#x2a;, p &#x3c; 0.05; &#x2a;&#x2a;, p &#x3c; 0.01; &#x2a;&#x2a;&#x2a;, p &#x3c; 0.001.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g005.tif">
<alt-text content-type="machine-generated">Bar charts displaying the relative expression levels of various genes under different conditions. (A) Shows Cyp1a1 and Cyp1b1 levels with E+P, Kyn, and CH223191 treatments. (B) Displays Phd2 expression with E+P, Kyn, and CH223191. (C) Illustrates Phd2 and Ph3c1 expression with E+P and 2-OH-E2. (D) Shows Phd2 and Ph3c1 levels with E+P and 4-OH-E2. Asterisks indicate significance levels.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<title>3.6 Effects of excessive P<sub>4</sub> on nucleolus</title>
<p>The nucleolus plays a crucial role in ribosome biogenesis. The morphology, size, and activity of nucleolus are closely linked, exhibiting diverse reorganization patterns under stress (<xref ref-type="bibr" rid="B84">Yang et al., 2018</xref>). AhR modulates nucleolar activity and enhances protein synthesis (<xref ref-type="bibr" rid="B39">Lafita-Navarro et al., 2018</xref>). Given that excess P<sub>4</sub> was detrimental to pregnancy and could activate the AhR pathway, we investigated excess P<sub>4</sub> effects on nucleoleus. Nucleolin (NCL), constituting approximately 10% of total nucleolar protein, serves as a nucleolar marker (<xref ref-type="bibr" rid="B51">Lo et al., 2006</xref>). After ovariectomized mice were subcutaneously injected with 2 mg or 8 mg P<sub>4</sub> for 7 days, the size and NCL intensity of nucleolus in the uterine stromal cells were obviously increased, while there were no clear changes for NCL immunofluorescence in luminal and glandular epithelium (<xref ref-type="fig" rid="F6">Figure 6A</xref>). When stromal cells were treated with 0.5, 5, or 20 &#x3bc;M P<sub>4</sub> for 24 h, the size of nucleolar NCL immunofluorescence was also increased (<xref ref-type="fig" rid="F6">Figure 6B</xref>).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Effects of excessive P<sub>4</sub> on nucleolus. <bold>(A)</bold> Uterine NCL immunofluorescence after ovariectomized mice were subcutaneously injected with 2 or 8 mg P<sub>4</sub> for 7 days. Nuclei were counter-stained with DAPI. Le, luminal epithelia; St, stroma. Scale bar, 50 &#x3bc;m. n &#x3d; 3 mice per group. <bold>(B)</bold> NCL immunofluorescence after stromal cells were treated with 0.5,5 or 20 &#x3bc;M P<sub>4</sub> for 24 h. Nuclei were counter-stained with DAPI. Scale bar, 20 &#x3bc;m. All images are the representative of at least three biologically independent experiments.</p>
</caption>
<graphic xlink:href="fcell-13-1622998-g006.tif">
<alt-text content-type="machine-generated">Panel A and B show fluorescent microscopy images of cells stained for nucleolin (green) and nuclei (blue). Panel A displays tissue sections under control and progesterone (P4) treatments (2 mg and 8 mg) with enhanced green fluorescence intensity in treated samples. Panel B shows cultured cell images under control, 0.5 micromolar, 5 micromolar, and 20 micromolar P4 treatments, with increasing fluorescence intensity corresponding to higher concentrations. Both panels include merged images indicating nuclear localization of the stain.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>P<sub>4</sub> is essential for establishing and maintaining pregnancy (<xref ref-type="bibr" rid="B5">Bhurke et al., 2016</xref>). However, the potential adverse effects of excessive P<sub>4</sub> on pregnancy outcomes are frequently overlooked. In this study, we found that excessive P<sub>4</sub> impaired mouse decidualization both <italic>in vivo</italic> and <italic>in vitro</italic>, potentially through changing tryptophan metabolism and activating AhR pathway.</p>
<p>Numerous studies have reported that excessive P<sub>4</sub> adversely affects pregnancy outcomes. High P<sub>4</sub> exposure from the end of menstruation to oocyte maturation is associated with a decreased probability of pregnancy (<xref ref-type="bibr" rid="B36">Kyrou et al., 2011</xref>). P<sub>4</sub> levels &#x2265;1.7 ng/mL before oocyte retrieval significantly reduce endometrial receptivity (<xref ref-type="bibr" rid="B49">Liu et al., 2015</xref>). Endometrial gene expression profiles are altered when P<sub>4</sub> levels exceed 1.5 ng/mL at the end of the follicular phase (<xref ref-type="bibr" rid="B37">Labarta et al., 2011</xref>). Elevated P<sub>4</sub> levels on the day of hCG administration during initial fresh cycles correlate with poor pregnancy outcomes in fresh embryo transfers but not in subsequent frozen-thawed embryo transfers (<xref ref-type="bibr" rid="B78">Venetis et al., 2013</xref>). Our previous study also demonstrated that excessive P<sub>4</sub> impairs mouse embryo implantation and decidualization (<xref ref-type="bibr" rid="B48">Liang et al., 2018</xref>).</p>
<p>Trp, an essential amino acid for protein biosynthesis and a precursor of serotonin, has been detected in the ovary, uterus, fallopian tubes, placenta, and ovarian follicular fluid (<xref ref-type="bibr" rid="B18">Doherty et al., 2011</xref>; <xref ref-type="bibr" rid="B42">Li et al., 2014</xref>). During pregnancy, Trp enhances maternal and fetal protein synthesis, participates in 5-hydroxytryptamine synthesis, provides neuroprotection through kynurenic acid, and suppresses fetal rejection reactions (<xref ref-type="bibr" rid="B82">Xu et al., 2017</xref>). Excess Trp must be metabolized early in pregnancy to avoid adverse effects. In mammals, over 95% of free Trp is metabolized through the Kyn pathway, which is closely linked to pregnancy (<xref ref-type="bibr" rid="B73">Stone and Darlington, 2002</xref>). Plasma and uterine Trp levels decrease, while Kyn levels increase in human, mouse, and cattle pregnancy (<xref ref-type="bibr" rid="B61">Minatogawa et al., 2003</xref>; <xref ref-type="bibr" rid="B68">Schrocksnadel et al., 2006</xref>; <xref ref-type="bibr" rid="B22">Groebner et al., 2011</xref>). High levels of Trp in culture media inhibit embryo development to the blastocyst stage <italic>in vitro</italic> (<xref ref-type="bibr" rid="B58">McKiernan et al., 1995</xref>). Dynamic Trp metabolism serves as a regulatory mechanism to control oxidative stress during pregnancy (<xref ref-type="bibr" rid="B82">Xu et al., 2017</xref>). Our previous study demonstrated that Trp deficiency in feed impairs mouse decidualization via the Kyn pathway (<xref ref-type="bibr" rid="B10">Chen et al., 2024a</xref>).</p>
<p>IDO1/2 and TDO2 are key rate-limiting enzymes in the Kyn pathway of Trp metabolism (<xref ref-type="bibr" rid="B7">Campesato et al., 2020</xref>). IDO1 and TDO2 are intimately associated with the decidualization process (<xref ref-type="bibr" rid="B75">Suzuki et al., 2001</xref>; <xref ref-type="bibr" rid="B35">Kudo et al., 2004</xref>). IDO1 in mouse placenta is important for preventing the immune rejection of fetal allografts (<xref ref-type="bibr" rid="B69">Sedlmayr et al., 2014</xref>). TDO2 can facilitate decidualization in mice (<xref ref-type="bibr" rid="B76">Tatsumi et al., 2000</xref>; <xref ref-type="bibr" rid="B42">Li et al., 2014</xref>), whereas overexpression of both IDO1 and IDO2 inhibits mouse <italic>in vitro</italic> decidualization (<xref ref-type="bibr" rid="B43">Li et al., 2015a</xref>; <xref ref-type="bibr" rid="B44">Li et al., 2015b</xref>). IDO1 is possibly involved in endometriosis pathogenesis (<xref ref-type="bibr" rid="B60">Mei et al., 2012</xref>). In this study, treatment with excessive P<sub>4</sub> led to upregulation of IDO1 and TDO protein levels and increased Kyn levels in the mouse uterus and cultured stromal cells. Additionally, high Kyn concentrations inhibited mouse <italic>in vitro</italic> decidualization, suggesting that excessive P<sub>4</sub> may impair decidualization by activating IDO1 and TDO. P<sub>4</sub> is able to stimulate IDO1 and IDO2 expression in mouse uterine stromal cells (<xref ref-type="bibr" rid="B43">Li et al., 2015a</xref>; <xref ref-type="bibr" rid="B44">Li et al., 2015b</xref>). TDO expression is induced by decidualization (<xref ref-type="bibr" rid="B76">Tatsumi et al., 2000</xref>). Based on these evidences, it seems that overactivated IDO1 should be detrimental for decidualization.</p>
<p>Kyn, as an endogenous ligand of AhR, activates AhR in mouse stromal cells and induced the expression of downstream genes CYP1A1 and CYP1B1 in our study. AhR is essential for ovarian function, optimizing the fertilization environment, nurturing embryos, maintaining pregnancy, and regulating reproductive lifespan and fertility (<xref ref-type="bibr" rid="B25">Hernandez-Ochoa et al., 2009</xref>). AhR is expressed in the pre-implantation mouse uterus (<xref ref-type="bibr" rid="B33">Kitajima et al., 2004</xref>). AhR mediates the reproductive toxicity induced by polychlorinated biphenyl congener 126 in rats (<xref ref-type="bibr" rid="B34">Klenov et al., 2021</xref>). In early pregnancy, Kyn-AhR enhances NK cell cytotoxicity, contributing to recurrent spontaneous abortion (<xref ref-type="bibr" rid="B85">Yang et al., 2021</xref>). Additionally, activation of the Trp/Kyn/AhR pathway promotes the growth of uterine leiomyomas (<xref ref-type="bibr" rid="B91">Zuberi et al., 2023</xref>). In our study, AhR was also activated by excessive P<sub>4</sub>, suggesting that overactivated AhR suppresses decidualization.</p>
<p>CYP1A1 and CYP1B1, members of the cytochrome P450 enzyme family, catalyze the formation of 2-OH-E<sub>2</sub> and 4-OH-E<sub>2</sub> from E<sub>2</sub>, respectively (<xref ref-type="bibr" rid="B24">Hanna et al., 2000</xref>; <xref ref-type="bibr" rid="B41">Lee et al., 2003</xref>). CYP1B1 is highly expressed in E<sub>2</sub> target tissues such as breast, ovary, and uterus (<xref ref-type="bibr" rid="B23">Hakkola et al., 1997</xref>). 4-OH-E<sub>2</sub> generates free radicals through redox cycling with semiquinone and quinone forms, leading to cellular damage and contributing to breast and endometrial cancer development (<xref ref-type="bibr" rid="B77">Tsuchiya et al., 2005</xref>). During mouse delayed implantation, 2-OH-E<sub>2</sub> and 4-OH-E<sub>2</sub> show no difference in inducing implantation compared to E<sub>2</sub> (<xref ref-type="bibr" rid="B27">Hoversland et al., 1982</xref>). However, in rats, 4-OH-E<sub>2</sub> is less effective than E<sub>2</sub> but more effective than 2-OH-E<sub>2</sub> in initiating implantation (<xref ref-type="bibr" rid="B31">Kantor et al., 1985</xref>). Our results demonstrated that both 2-OH-E<sub>2</sub> and 4-OH-E<sub>2</sub> inhibit stromal cell decidualization.</p>
<p>Furthermore, based on our NCL immunofluorescence, the nucleolar size was obviously increased both in uterine endometrial stromal cells and cultured stromal cells following excessive P<sub>4</sub> treatment. These findings suggest that excessive P<sub>4</sub> may affect endometrial function by altering nucleolar structure and function. The nucleolus, a prominent membraneless structure within the nucleus, plays a crucial role in ribosome formation. This complex process encompasses the transcription of ribosomal DNA (rDNA), the processing of ribosomal RNA (rRNA), and the subsequent assembly of rRNA with ribosomal proteins to generate functional ribosomes (<xref ref-type="bibr" rid="B4">Bassler and Hurt, 2019</xref>; <xref ref-type="bibr" rid="B40">Lafontaine et al., 2021</xref>). Any disruptions during ribosome biogenesis can induce nucleolar stress, which is marked by changes in nucleolar structure and functionality (<xref ref-type="bibr" rid="B38">Lafita-Navarro and Conacci-Sorrell, 2023</xref>). Larger and more nucleoli are frequently observed in tumor cells compared to normal cells, making abnormal nucleolar size and number important indicators for cancer prognosis (<xref ref-type="bibr" rid="B16">Derenzini et al., 2000</xref>; <xref ref-type="bibr" rid="B51">Lo et al., 2006</xref>). AhR regulates nucleolar activity and protein synthesis (<xref ref-type="bibr" rid="B39">Lafita-Navarro et al., 2018</xref>). P<sub>4</sub> and MPA increase Nucleolin protein levels, which is associated with the proliferative potential of the cells (<xref ref-type="bibr" rid="B89">Yokoyama et al., 1998</xref>). Future research could further explore how P<sub>4</sub> affects embryo implantation and decidualization by influencing the expression of nucleolar-associated proteins.</p>
<p>During decidualization, P<sub>4</sub> classically affects the endometrium via two well-characterized receptors, PR-A and PR-B (<xref ref-type="bibr" rid="B53">Lydon et al., 1996</xref>). However, the effects of P<sub>4</sub> are also mediated by progesterone receptor membrane component 1 (PGRMC1) (<xref ref-type="bibr" rid="B30">Kaluka et al., 2015</xref>). PGRMC1 expression is also tightly regulated at the maternal-fetal interface in humans and rodents (<xref ref-type="bibr" rid="B66">Pru and Clark, 2013</xref>). Uterine ablation of PGRMC1 leads to reduced fertility in female mice and the development of endometrial cysts (<xref ref-type="bibr" rid="B57">McCallum et al., 2016</xref>). Additionally, P<sub>4</sub> weakly binds to the nuclear glucocorticoid receptor (GR), which may represent a key mechanism underlying its anti-inflammatory effects in reproductive tissues (<xref ref-type="bibr" rid="B71">Shah et al., 2019</xref>). Deficiency in uterine GR signaling results in an exaggerated inflammatory response during induced decidualization, including altered immune cell recruitment (<xref ref-type="bibr" rid="B81">Whirledge et al., 2015</xref>). Although this study shows that excessive P<sub>4</sub> disrupts the Kyn-AhR axis during decidualization, it is still possible that excessive P<sub>4</sub> may impair decidualization through GR signaling or PGRMC1.</p>
</sec>
<sec sec-type="conclusion" id="s5">
<title>5 Conclusion</title>
<p>In summary, our results demonstrate that excessive P<sub>4</sub> impairs mouse decidualization via activating Kyn-AhR pathway, highlighting the potential mechanisms underlying reproductive disorders and adverse pregnancy outcomes associated with abnormal P<sub>4</sub> levels.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="ethics-statement" id="s7">
<title>Ethics statement</title>
<p>The animal study was approved by Institutional Animal Care and Use Committee of South China Agricultural University. The study was conducted in accordance with the local legislation and institutional requirements.</p>
</sec>
<sec sec-type="author-contributions" id="s8">
<title>Author contributions</title>
<p>H-NL: Validation, Methodology, Data curation, Investigation, Writing &#x2013; original draft, Writing &#x2013; review and editing. H-YY: Investigation, Writing &#x2013; original draft, Data curation, Methodology. Z-MW: Methodology, Investigation, Data curation, Writing &#x2013; original draft. J-ML: Data curation, Methodology, Writing &#x2013; original draft, Investigation. T-TZ: Data curation, Investigation, Methodology, Writing &#x2013; original draft. Z-MY: Funding acquisition, Writing &#x2013; review and editing, Conceptualization, Supervision, Project administration.</p>
</sec>
<sec sec-type="funding-information" id="s9">
<title>Funding</title>
<p>The author(s) declare that financial support was received for the research and/or publication of this article. This work was supported by the National Natural Science Foundation of China (32171114 and 31871511).</p>
</sec>
<sec sec-type="COI-statement" id="s10">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s11">
<title>Generative AI statement</title>
<p>The author(s) declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s12">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s13">
<title>Abbreviations</title>
<p>AhR, Aryl hydrocarbon receptor; E<sub>2</sub>, Estrogen; IDO, Indoleamine 2,3-dioxygenase; Kyn, Kynurenine; LPD, Luteal phase deficiency; NCL, Nucleolin; Prl3c1, Prolactin family 3, subfamily C, member 1; Prl8a2, Prolactin family 8, subfamily A, member 2; Progesterone, P<sub>4</sub>; PR, Progesterone receptor; PI, Propidium iodide; Trp, Tryptophan; TDO, Tryptophan 2,3-dioxygenase; 2-OH-E<sub>2</sub>, 2-hydroxyestradiol; 4-OH-E<sub>2</sub>, 4-hydroxyestradiol; DAPI, 4&#x2032;,6-diamidino-2-phenylindole.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Austin</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Mailu</surname>
<given-names>B. M.</given-names>
</name>
<name>
<surname>Maghzal</surname>
<given-names>G. J.</given-names>
</name>
<name>
<surname>Sanchez-Perez</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Rahlfs</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zocher</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Biochemical characteristics and inhibitor selectivity of mouse indoleamine 2,3-dioxygenase-2</article-title>. <source>Amino Acids</source> <volume>39</volume>, <fpage>565</fpage>&#x2013;<lpage>578</lpage>. <pub-id pub-id-type="doi">10.1007/s00726-010-0475-9</pub-id>
<pub-id pub-id-type="pmid">20140689</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Badawy</surname>
<given-names>A. A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Tryptophan metabolism, disposition and utilization in pregnancy</article-title>. <source>Biosci. Rep.</source> <volume>35</volume>, <fpage>e00261</fpage>. <pub-id pub-id-type="doi">10.1042/BSR20150197</pub-id>
<pub-id pub-id-type="pmid">26381576</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Badawy</surname>
<given-names>A. A.</given-names>
</name>
<name>
<surname>Namboodiri</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Moffett</surname>
<given-names>J. R.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>The end of the road for the tryptophan depletion concept in pregnancy and infection</article-title>. <source>Clin. Sci. (Lond)</source> <volume>130</volume>, <fpage>1327</fpage>&#x2013;<lpage>1333</lpage>. <pub-id pub-id-type="doi">10.1042/CS20160153</pub-id>
<pub-id pub-id-type="pmid">27358028</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bassler</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hurt</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Eukaryotic ribosome assembly</article-title>. <source>Annu. Rev. Biochem.</source> <volume>88</volume>, <fpage>281</fpage>&#x2013;<lpage>306</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-biochem-013118-110817</pub-id>
<pub-id pub-id-type="pmid">30566372</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bhurke</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Bagchi</surname>
<given-names>I. C.</given-names>
</name>
<name>
<surname>Bagchi</surname>
<given-names>M. K.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Progesterone-regulated endometrial factors controlling implantation</article-title>. <source>Am. J. Reprod. Immunol.</source> <volume>75</volume>, <fpage>237</fpage>&#x2013;<lpage>245</lpage>. <pub-id pub-id-type="doi">10.1111/aji.12473</pub-id>
<pub-id pub-id-type="pmid">26804062</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Boza</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Api</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kayatas</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ceyhan</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Boza</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Is progestogen supplementation necessary to prevent abortion?</article-title> <source>J. Obstet. Gynaecol.</source> <volume>36</volume>, <fpage>1076</fpage>&#x2013;<lpage>1079</lpage>. <pub-id pub-id-type="doi">10.1080/01443615.2016.1205556</pub-id>
<pub-id pub-id-type="pmid">27760481</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Campesato</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Budhu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tchaicha</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Weng</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Gigoux</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Cohen</surname>
<given-names>I. J.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Blockade of the AHR restricts a Treg-macrophage suppressive axis induced by L-Kynurenine</article-title>. <source>Nat. Commun.</source> <volume>11</volume>, <fpage>4011</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-020-17750-z</pub-id>
<pub-id pub-id-type="pmid">32782249</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carmichael</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Shaw</surname>
<given-names>G. M.</given-names>
</name>
<name>
<surname>Laurent</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Croughan</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Olney</surname>
<given-names>R. S.</given-names>
</name>
<name>
<surname>Lammer</surname>
<given-names>E. J.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Maternal progestin intake and risk of hypospadias</article-title>. <source>Arch. Pediatr. Adolesc. Med.</source> <volume>159</volume>, <fpage>957</fpage>&#x2013;<lpage>962</lpage>. <pub-id pub-id-type="doi">10.1001/archpedi.159.10.957</pub-id>
<pub-id pub-id-type="pmid">16203941</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W. W.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>Y. Q.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. S.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Embryo-derive TNF promotes decidualization via fibroblast activation</article-title>. <source>Elife</source> <volume>12</volume>, <fpage>e82970</fpage>. <pub-id pub-id-type="doi">10.7554/eLife.82970</pub-id>
<pub-id pub-id-type="pmid">37458359</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Ran</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W. W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C. K.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>P. C.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>H. N.</given-names>
</name>
<etal/>
</person-group> (<year>2024a</year>). <article-title>Tryptophan in the mouse diet is essential for embryo implantation and decidualization</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>15</volume>, <fpage>1356914</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2024.1356914</pub-id>
<pub-id pub-id-type="pmid">38752181</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>W. W.</given-names>
</name>
<name>
<surname>Ran</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>C. K.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>H. N.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>L. J.</given-names>
</name>
<etal/>
</person-group> (<year>2024b</year>). <article-title>The activation of cGAS-STING pathway causes abnormal uterine receptivity in aged mice</article-title>. <source>Aging Cell</source> <volume>23</volume>, <fpage>e14303</fpage>. <pub-id pub-id-type="doi">10.1111/acel.14303</pub-id>
<pub-id pub-id-type="pmid">39113346</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cheng</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sha</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Progress on the role of estrogen and progesterone signaling in mouse embryo implantation and decidualization</article-title>. <source>Reprod. Sci.</source> <volume>30</volume>, <fpage>1746</fpage>&#x2013;<lpage>1757</lpage>. <pub-id pub-id-type="doi">10.1007/s43032-023-01169-0</pub-id>
<pub-id pub-id-type="pmid">36694081</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Daya</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ward</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Burrows</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>Progesterone profiles in luteal phase defect cycles and outcome of progesterone treatment in patients with recurrent spontaneous abortion</article-title>. <source>Am. J. Obstet. Gynecol.</source> <volume>158</volume>, <fpage>225</fpage>&#x2013;<lpage>232</lpage>. <pub-id pub-id-type="doi">10.1016/0002-9378(88)90127-5</pub-id>
<pub-id pub-id-type="pmid">3341399</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Deng</surname>
<given-names>W. B.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. M.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Regulation and function of deiodinases during decidualization in female mice</article-title>. <source>Endocrinology</source> <volume>155</volume>, <fpage>2704</fpage>&#x2013;<lpage>2717</lpage>. <pub-id pub-id-type="doi">10.1210/en.2014-1015</pub-id>
<pub-id pub-id-type="pmid">24797630</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Denison</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Whitlock</surname>
<given-names>J. P.</given-names>
<suffix>Jr.</suffix>
</name>
</person-group> (<year>1995</year>). <article-title>Xenobiotic-inducible transcription of cytochrome P450 genes</article-title>. <source>J. Biol. Chem.</source> <volume>270</volume>, <fpage>18175</fpage>&#x2013;<lpage>18178</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.270.31.18175</pub-id>
<pub-id pub-id-type="pmid">7629130</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Derenzini</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Trere</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Pession</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Govoni</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sirri</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Chieco</surname>
<given-names>P.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Nucleolar size indicates the rapidity of cell proliferation in cancer tissues</article-title>. <source>J. Pathol.</source> <volume>191</volume>, <fpage>181</fpage>&#x2013;<lpage>186</lpage>. <pub-id pub-id-type="doi">10.1002/(SICI)1096-9896(200006)191:2&#x3c;181::AID-PATH607&#x3e;3.0.CO;2-V</pub-id>
<pub-id pub-id-type="pmid">10861579</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>DiNatale</surname>
<given-names>B. C.</given-names>
</name>
<name>
<surname>Murray</surname>
<given-names>I. A.</given-names>
</name>
<name>
<surname>Schroeder</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Flaveny</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Lahoti</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Laurenzana</surname>
<given-names>E. M.</given-names>
</name>
<etal/>
</person-group> (<year>2010</year>). <article-title>Kynurenic acid is a potent endogenous aryl hydrocarbon receptor ligand that synergistically induces interleukin-6 in the presence of inflammatory signaling</article-title>. <source>Toxicol. Sci.</source> <volume>115</volume>, <fpage>89</fpage>&#x2013;<lpage>97</lpage>. <pub-id pub-id-type="doi">10.1093/toxsci/kfq024</pub-id>
<pub-id pub-id-type="pmid">20106948</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Doherty</surname>
<given-names>L. F.</given-names>
</name>
<name>
<surname>Kwon</surname>
<given-names>H. E.</given-names>
</name>
<name>
<surname>Taylor</surname>
<given-names>H. S.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Regulation of tryptophan 2,3-dioxygenase by HOXA10 enhances embryo viability through serotonin signaling</article-title>. <source>Am. J. Physiol. Endocrinol. Metab.</source> <volume>300</volume>, <fpage>E86</fpage>&#x2013;<lpage>E93</lpage>. <pub-id pub-id-type="doi">10.1152/ajpendo.00439.2010</pub-id>
<pub-id pub-id-type="pmid">20959529</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eftekhar</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rahsepar</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rahmani</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Effect of progesterone supplementation on natural frozen-thawed embryo transfer cycles: a randomized controlled trial</article-title>. <source>Int. J. Fertil. Steril.</source> <volume>7</volume>, <fpage>13</fpage>&#x2013;<lpage>20</lpage>.<pub-id pub-id-type="pmid">24520458</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Garg</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zielinska</surname>
<given-names>A. P.</given-names>
</name>
<name>
<surname>Yeung</surname>
<given-names>A. C.</given-names>
</name>
<name>
<surname>Abdelmalak</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Hossain</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Luteal phase support in assisted reproductive technology</article-title>. <source>Nat. Rev. Endocrinol.</source> <volume>2</volume>, <fpage>149</fpage>&#x2013;<lpage>167</lpage>. <pub-id pub-id-type="doi">10.1038/s41574-023-00921-5</pub-id>
<pub-id pub-id-type="pmid">38110672</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gellersen</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Brosens</surname>
<given-names>J. J.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Cyclic decidualization of the human endometrium in reproductive health and failure</article-title>. <source>Endocr. Rev.</source> <volume>35</volume>, <fpage>851</fpage>&#x2013;<lpage>905</lpage>. <pub-id pub-id-type="doi">10.1210/er.2014-1045</pub-id>
<pub-id pub-id-type="pmid">25141152</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Groebner</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Schulke</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Schefold</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Fusch</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Sinowatz</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Reichenbach</surname>
<given-names>H. D.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Immunological mechanisms to establish embryo tolerance in early bovine pregnancy</article-title>. <source>Reprod. Fertil. Dev.</source> <volume>23</volume>, <fpage>619</fpage>&#x2013;<lpage>632</lpage>. <pub-id pub-id-type="doi">10.1071/RD10230</pub-id>
<pub-id pub-id-type="pmid">21635810</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hakkola</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pasanen</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Pelkonen</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Hukkanen</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Evisalmi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Anttila</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>1997</year>). <article-title>Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells</article-title>. <source>Carcinogenesis</source> <volume>18</volume>, <fpage>391</fpage>&#x2013;<lpage>397</lpage>. <pub-id pub-id-type="doi">10.1093/carcin/18.2.391</pub-id>
<pub-id pub-id-type="pmid">9054634</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hanna</surname>
<given-names>I. H.</given-names>
</name>
<name>
<surname>Dawling</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Roodi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Guengerich</surname>
<given-names>F. P.</given-names>
</name>
<name>
<surname>Parl</surname>
<given-names>F. F.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Cytochrome P450 1B1 (CYP1B1) pharmacogenetics: association of polymorphisms with functional differences in estrogen hydroxylation activity</article-title>. <source>Cancer Res.</source> <volume>60</volume>, <fpage>3440</fpage>&#x2013;<lpage>3444</lpage>.<pub-id pub-id-type="pmid">10910054</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hernandez-Ochoa</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Karman</surname>
<given-names>B. N.</given-names>
</name>
<name>
<surname>Flaws</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>The role of the aryl hydrocarbon receptor in the female reproductive system</article-title>. <source>Biochem. Pharmacol.</source> <volume>77</volume>, <fpage>547</fpage>&#x2013;<lpage>559</lpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2008.09.037</pub-id>
<pub-id pub-id-type="pmid">18977336</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoang</surname>
<given-names>V. H.</given-names>
</name>
<name>
<surname>Trang</surname>
<given-names>N. T. K.</given-names>
</name>
<name>
<surname>Minh</surname>
<given-names>T. C.</given-names>
</name>
<name>
<surname>Long</surname>
<given-names>L. T. B.</given-names>
</name>
<name>
<surname>Lan</surname>
<given-names>T. H.</given-names>
</name>
<name>
<surname>Hue</surname>
<given-names>N. T.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Design, synthesis and evaluation the bioactivities of novel 1,3-dimethyl-6-amino-1H-indazole derivatives as anticancer agents</article-title>. <source>Bioorg Med. Chem.</source> <volume>90</volume>, <fpage>117377</fpage>. <pub-id pub-id-type="doi">10.1016/j.bmc.2023.117377</pub-id>
<pub-id pub-id-type="pmid">37352576</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hoversland</surname>
<given-names>R. C.</given-names>
</name>
<name>
<surname>Dey</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>D. C.</given-names>
</name>
</person-group> (<year>1982</year>). <article-title>Catechol estradiol induced implantation in the mouse</article-title>. <source>Life Sci.</source> <volume>30</volume>, <fpage>1801</fpage>&#x2013;<lpage>1804</lpage>. <pub-id pub-id-type="doi">10.1016/0024-3205(82)90316-2</pub-id>
<pub-id pub-id-type="pmid">6285111</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hutchinson</surname>
<given-names>A. P.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Neale</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Coon</surname>
<given-names>J. S. t.</given-names>
</name>
<name>
<surname>Kujawa</surname>
<given-names>S. A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Tryptophan 2,3-dioxygenase-2 in uterine leiomyoma: dysregulation by MED12 mutation status</article-title>. <source>Reprod. Sci.</source> <volume>29</volume>, <fpage>743</fpage>&#x2013;<lpage>749</lpage>. <pub-id pub-id-type="doi">10.1007/s43032-022-00852-y</pub-id>
<pub-id pub-id-type="pmid">35064560</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jones</surname>
<given-names>G. S.</given-names>
</name>
</person-group> (<year>1976</year>). <article-title>The luteal phase defect</article-title>. <source>Fertil. Steril.</source> <volume>27</volume>, <fpage>351</fpage>&#x2013;<lpage>356</lpage>. <pub-id pub-id-type="doi">10.1016/s0015-0282(16)41769-3</pub-id>
<pub-id pub-id-type="pmid">1269800</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaluka</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Batabyal</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Chiang</surname>
<given-names>B. Y.</given-names>
</name>
<name>
<surname>Poulos</surname>
<given-names>T. L.</given-names>
</name>
<name>
<surname>Yeh</surname>
<given-names>S. R.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Spectroscopic and mutagenesis studies of human PGRMC1</article-title>. <source>Biochemistry</source> <volume>54</volume>, <fpage>1638</fpage>&#x2013;<lpage>1647</lpage>. <pub-id pub-id-type="doi">10.1021/bi501177e</pub-id>
<pub-id pub-id-type="pmid">25675345</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kantor</surname>
<given-names>B. S.</given-names>
</name>
<name>
<surname>Dey</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>D. C.</given-names>
</name>
</person-group> (<year>1985</year>). <article-title>Catechol oestrogen induced initiation of implantation in the delayed implanting rat</article-title>. <source>Acta Endocrinol. (Copenh)</source> <volume>109</volume>, <fpage>418</fpage>&#x2013;<lpage>422</lpage>. <pub-id pub-id-type="doi">10.1530/acta.0.1090418</pub-id>
<pub-id pub-id-type="pmid">4024853</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karamardian</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Grimes</surname>
<given-names>D. A.</given-names>
</name>
</person-group> (<year>1992</year>). <article-title>Luteal phase deficiency: effect of treatment on pregnancy rates</article-title>. <source>Am. J. Obstet. Gynecol.</source> <volume>167</volume>, <fpage>1391</fpage>&#x2013;<lpage>1398</lpage>. <pub-id pub-id-type="doi">10.1016/s0002-9378(11)91724-4</pub-id>
<pub-id pub-id-type="pmid">1344880</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kitajima</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Khan</surname>
<given-names>K. N.</given-names>
</name>
<name>
<surname>Fujishita</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Masuzaki</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Koji</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Ishimaru</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Expression of the arylhydrocarbon receptor in the peri-implantation period of the mouse uterus and the impact of dioxin on mouse implantation</article-title>. <source>Arch. Histol. Cytol.</source> <volume>67</volume>, <fpage>465</fpage>&#x2013;<lpage>474</lpage>. <pub-id pub-id-type="doi">10.1679/aohc.67.465</pub-id>
<pub-id pub-id-type="pmid">15781987</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Klenov</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>Flor</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ganesan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Adur</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Eti</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Iqbal</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>The Aryl hydrocarbon receptor mediates reproductive toxicity of polychlorinated biphenyl congener 126 in rats</article-title>. <source>Toxicol. Appl. Pharmacol.</source> <volume>426</volume>, <fpage>115639</fpage>. <pub-id pub-id-type="doi">10.1016/j.taap.2021.115639</pub-id>
<pub-id pub-id-type="pmid">34256052</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kudo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hara</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Katsuki</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Toyofuku</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Katsura</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Takikawa</surname>
<given-names>O.</given-names>
</name>
<etal/>
</person-group> (<year>2004</year>). <article-title>Mechanisms regulating the expression of indoleamine 2,3-dioxygenase during decidualization of human endometrium</article-title>. <source>Hum. Reprod.</source> <volume>19</volume>, <fpage>1222</fpage>&#x2013;<lpage>1230</lpage>. <pub-id pub-id-type="doi">10.1093/humrep/deh218</pub-id>
<pub-id pub-id-type="pmid">15070879</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kyrou</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Kolibianakis</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Fatemi</surname>
<given-names>H. M.</given-names>
</name>
<name>
<surname>Camus</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tournaye</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Tarlatzis</surname>
<given-names>B. C.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>High exposure to progesterone between the end of menstruation and the day of triggering final oocyte maturation is associated with a decreased probability of pregnancy in patients treated by <italic>in vitro</italic> fertilization and intracytoplasmic sperm injection</article-title>. <source>Fertil. Steril.</source> <volume>96</volume>, <fpage>884</fpage>&#x2013;<lpage>888</lpage>. <pub-id pub-id-type="doi">10.1016/j.fertnstert.2011.07.1101</pub-id>
<pub-id pub-id-type="pmid">21843888</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Labarta</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Martinez-Conejero</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Alama</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Horcajadas</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Pellicer</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Simon</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Endometrial receptivity is affected in women with high circulating progesterone levels at the end of the follicular phase: a functional genomics analysis</article-title>. <source>Hum. Reprod.</source> <volume>26</volume>, <fpage>1813</fpage>&#x2013;<lpage>1825</lpage>. <pub-id pub-id-type="doi">10.1093/humrep/der126</pub-id>
<pub-id pub-id-type="pmid">21540246</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lafita-Navarro</surname>
<given-names>M. C.</given-names>
</name>
<name>
<surname>Conacci-Sorrell</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Nucleolar stress: from development to cancer</article-title>. <source>Semin. Cell Dev. Biol.</source> <volume>136</volume>, <fpage>64</fpage>&#x2013;<lpage>74</lpage>. <pub-id pub-id-type="doi">10.1016/j.semcdb.2022.04.001</pub-id>
<pub-id pub-id-type="pmid">35410715</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lafita-Navarro</surname>
<given-names>M. C.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Borenstein-Auerbach</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Venkateswaran</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hao</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Ray</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>The aryl hydrocarbon receptor regulates nucleolar activity and protein synthesis in MYC-expressing cells</article-title>. <source>Genes Dev.</source> <volume>32</volume>, <fpage>1303</fpage>&#x2013;<lpage>1308</lpage>. <pub-id pub-id-type="doi">10.1101/gad.313007.118</pub-id>
<pub-id pub-id-type="pmid">30254109</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lafontaine</surname>
<given-names>D. L. J.</given-names>
</name>
<name>
<surname>Riback</surname>
<given-names>J. A.</given-names>
</name>
<name>
<surname>Bascetin</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Brangwynne</surname>
<given-names>C. P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>The nucleolus as a multiphase liquid condensate</article-title>. <source>Nat. Rev. Mol. Cell Biol.</source> <volume>22</volume>, <fpage>165</fpage>&#x2013;<lpage>182</lpage>. <pub-id pub-id-type="doi">10.1038/s41580-020-0272-6</pub-id>
<pub-id pub-id-type="pmid">32873929</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>M. X.</given-names>
</name>
<name>
<surname>Thomas</surname>
<given-names>P. E.</given-names>
</name>
<name>
<surname>Conney</surname>
<given-names>A. H.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>B. T.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Characterization of the oxidative metabolites of 17beta-estradiol and estrone formed by 15 selectively expressed human cytochrome p450 isoforms</article-title>. <source>Endocrinology</source> <volume>144</volume>, <fpage>3382</fpage>&#x2013;<lpage>3398</lpage>. <pub-id pub-id-type="doi">10.1210/en.2003-0192</pub-id>
<pub-id pub-id-type="pmid">12865317</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Y. J.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>X. C.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. Q.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Q. L.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Differential expression and regulation of Tdo2 during mouse decidualization</article-title>. <source>J. Endocrinol.</source> <volume>220</volume>, <fpage>73</fpage>&#x2013;<lpage>83</lpage>. <pub-id pub-id-type="doi">10.1530/JOE-13-0429</pub-id>
<pub-id pub-id-type="pmid">24190896</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>X. Y.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Yue</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. Q.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2015a</year>). <article-title>Differential expression and regulation of Ido2 in the mouse uterus during peri-implantation period</article-title>. <source>Vitro Cell Dev. Biol. Anim.</source> <volume>51</volume>, <fpage>264</fpage>&#x2013;<lpage>272</lpage>. <pub-id pub-id-type="doi">10.1007/s11626-014-9833-3</pub-id>
<pub-id pub-id-type="pmid">25408380</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>J. Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. Q.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Q. L.</given-names>
</name>
<etal/>
</person-group> (<year>2015b</year>). <article-title>Effects of Ido1 on mouse decidualization</article-title>. <source>Mol. Biol. Mosk.</source> <volume>49</volume>, <fpage>649</fpage>&#x2013;<lpage>657</lpage>. <pub-id pub-id-type="doi">10.7868/S002689841503012X</pub-id>
<pub-id pub-id-type="pmid">26299865</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yan</surname>
<given-names>Y. P.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Y. Y.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M. Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023a</year>). <article-title>IHH, SHH, and primary cilia mediate epithelial-stromal cross-talk during decidualization in mice</article-title>. <source>Sci. Signal</source> <volume>16</volume>, <fpage>eadd0645</fpage>. <pub-id pub-id-type="doi">10.1126/scisignal.add0645</pub-id>
<pub-id pub-id-type="pmid">36853961</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>S. T.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Y. Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Z. S.</given-names>
</name>
<etal/>
</person-group> (<year>2023b</year>). <article-title>The regulation and function of acetylated high-mobility group box 1 during implantation and decidualization</article-title>. <source>Front. Immunol.</source> <volume>14</volume>, <fpage>1024706</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2023.1024706</pub-id>
<pub-id pub-id-type="pmid">36761729</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>M. Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tang</surname>
<given-names>H. L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>Y. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Embryo-derived cathepsin B promotes implantation and decidualization by activating pyroptosis</article-title>. <source>Adv. Sci. (Weinh)</source> <volume>11</volume>, <fpage>e2402299</fpage>. <pub-id pub-id-type="doi">10.1002/advs.202402299</pub-id>
<pub-id pub-id-type="pmid">39316370</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liang</surname>
<given-names>Y. X.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>Z. Y.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Y. S.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>X. W.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>The high concentration of progesterone is harmful for endometrial receptivity and decidualization</article-title>. <source>Sci. Rep.</source> <volume>8</volume>, <fpage>712</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-017-18643-w</pub-id>
<pub-id pub-id-type="pmid">29335465</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Sailan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Mariee</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Laird</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>The effect of a high progesterone concentration before oocyte retrieval on the peri-implantation endometrium</article-title>. <source>Reprod. Biomed. Online</source> <volume>31</volume>, <fpage>739</fpage>&#x2013;<lpage>746</lpage>. <pub-id pub-id-type="doi">10.1016/j.rbmo.2015.09.003</pub-id>
<pub-id pub-id-type="pmid">26515148</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Zhai</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Fang</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Comprehensive analysis of the expression and prognosis for TDO2 in breast cancer</article-title>. <source>Mol. Ther. Oncolytics</source> <volume>17</volume>, <fpage>153</fpage>&#x2013;<lpage>168</lpage>. <pub-id pub-id-type="doi">10.1016/j.omto.2020.03.013</pub-id>
<pub-id pub-id-type="pmid">32346606</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lo</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Lai</surname>
<given-names>H. J.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>The nucleolus: reviewing oldies to have new understandings</article-title>. <source>Cell Res.</source> <volume>16</volume>, <fpage>530</fpage>&#x2013;<lpage>538</lpage>. <pub-id pub-id-type="doi">10.1038/sj.cr.7310070</pub-id>
<pub-id pub-id-type="pmid">16775624</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lydon</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>DeMayo</surname>
<given-names>F. J.</given-names>
</name>
<name>
<surname>Funk</surname>
<given-names>C. R.</given-names>
</name>
<name>
<surname>Mani</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Hughes</surname>
<given-names>A. R.</given-names>
</name>
<name>
<surname>Montgomery</surname>
<given-names>C. A.</given-names>
<suffix>Jr.</suffix>
</name>
<etal/>
</person-group> (<year>1995</year>). <article-title>Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities</article-title>. <source>Genes Dev.</source> <volume>9</volume>, <fpage>2266</fpage>&#x2013;<lpage>2278</lpage>. <pub-id pub-id-type="doi">10.1101/gad.9.18.2266</pub-id>
<pub-id pub-id-type="pmid">7557380</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lydon</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>DeMayo</surname>
<given-names>F. J.</given-names>
</name>
<name>
<surname>Conneely</surname>
<given-names>O. M.</given-names>
</name>
<name>
<surname>O&#x27;Malley</surname>
<given-names>B. W.</given-names>
</name>
</person-group> (<year>1996</year>). <article-title>Reproductive phenotpes of the progesterone receptor null mutant mouse</article-title>. <source>J. Steroid Biochem. Mol. Biol.</source> <volume>56</volume>, <fpage>67</fpage>&#x2013;<lpage>77</lpage>. <pub-id pub-id-type="doi">10.1016/0960-0760(95)00254-5</pub-id>
<pub-id pub-id-type="pmid">8603049</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>MacPherson</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Tamblyn</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Rajendra</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Bralha</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>McPherson</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Matthews</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>2,3,7,8-Tetrachlorodibenzo-p-dioxin poly(ADP-ribose) polymerase (TiPARP, ARTD14) is a mono-ADP-ribosyltransferase and repressor of aryl hydrocarbon receptor transactivation</article-title>. <source>Nucleic Acids Res.</source> <volume>41</volume>, <fpage>1604</fpage>&#x2013;<lpage>1621</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gks1337</pub-id>
<pub-id pub-id-type="pmid">23275542</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Effects of xenobiotics on CYP1 enzyme-mediated biotransformation and bioactivation of estradiol</article-title>. <source>Drug Metab. Rev.</source> <volume>55</volume>, <fpage>1</fpage>&#x2013;<lpage>49</lpage>. <pub-id pub-id-type="doi">10.1080/03602532.2023.2177671</pub-id>
<pub-id pub-id-type="pmid">36823774</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maurya</surname>
<given-names>V. K.</given-names>
</name>
<name>
<surname>DeMayo</surname>
<given-names>F. J.</given-names>
</name>
<name>
<surname>Lydon</surname>
<given-names>J. P.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Illuminating the &#x201c;black box&#x201d; of progesterone-dependent embryo implantation using engineered mice</article-title>. <source>Front. Cell Dev. Biol.</source> <volume>9</volume>, <fpage>640907</fpage>. <pub-id pub-id-type="doi">10.3389/fcell.2021.640907</pub-id>
<pub-id pub-id-type="pmid">33898429</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McCallum</surname>
<given-names>M. L.</given-names>
</name>
<name>
<surname>Pru</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Niikura</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yee</surname>
<given-names>S. P.</given-names>
</name>
<name>
<surname>Lydon</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>Peluso</surname>
<given-names>J. J.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Conditional ablation of progesterone receptor membrane component 1 results in subfertility in the female and development of endometrial cysts</article-title>. <source>Endocrinology</source> <volume>157</volume>, <fpage>3309</fpage>&#x2013;<lpage>3319</lpage>. <pub-id pub-id-type="doi">10.1210/en.2016-1081</pub-id>
<pub-id pub-id-type="pmid">27309940</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McKiernan</surname>
<given-names>S. H.</given-names>
</name>
<name>
<surname>Clayton</surname>
<given-names>M. K.</given-names>
</name>
<name>
<surname>Bavister</surname>
<given-names>B. D.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Analysis of stimulatory and inhibitory amino acids for development of hamster one-cell embryos <italic>in vitro</italic>
</article-title>. <source>Mol. Reprod. Dev.</source> <volume>42</volume>, <fpage>188</fpage>&#x2013;<lpage>199</lpage>. <pub-id pub-id-type="doi">10.1002/mrd.1080420208</pub-id>
<pub-id pub-id-type="pmid">8562064</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>McLindon</surname>
<given-names>L. A.</given-names>
</name>
<name>
<surname>James</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Beckmann</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>Bertolone</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Mahomed</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Vane</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Progesterone for women with threatened miscarriage (STOP trial): a placebo-controlled randomized clinical trial</article-title>. <source>Hum. Reprod.</source> <volume>38</volume>, <fpage>560</fpage>&#x2013;<lpage>568</lpage>. <pub-id pub-id-type="doi">10.1093/humrep/dead029</pub-id>
<pub-id pub-id-type="pmid">36806843</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mei</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Jin</surname>
<given-names>L. P.</given-names>
</name>
<name>
<surname>Ding</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M. Q.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>X. Y.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Inhibition of Ido1 suppresses cyclooxygenase-2 and matrix metalloproteinase-9 expression and decreases proliferation, adhesion and invasion of endometrial stromal cells</article-title>. <source>Mol. Hum. Reprod.</source> <volume>18</volume>, <fpage>467</fpage>&#x2013;<lpage>476</lpage>. <pub-id pub-id-type="doi">10.1093/molehr/gas021</pub-id>
<pub-id pub-id-type="pmid">22638210</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Minatogawa</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Suzuki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ando</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Tone</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Takikawa</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Tryptophan pyrrole ring cleavage enzymes in placenta</article-title>. <source>Adv. Exp. Med. Biol.</source> <volume>527</volume>, <fpage>425</fpage>&#x2013;<lpage>434</lpage>. <pub-id pub-id-type="doi">10.1007/978-1-4615-0135-0_50</pub-id>
<pub-id pub-id-type="pmid">15206760</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Munn</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Attwood</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Bondarev</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Conway</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Marshall</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>1998</year>). <article-title>Prevention of allogeneic fetal rejection by tryptophan catabolism</article-title>. <source>Science</source> <volume>281</volume>, <fpage>1191</fpage>&#x2013;<lpage>1193</lpage>. <pub-id pub-id-type="doi">10.1126/science.281.5380.1191</pub-id>
<pub-id pub-id-type="pmid">9712583</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nebert</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Dalton</surname>
<given-names>T. P.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis</article-title>. <source>Nat. Rev. Cancer</source> <volume>6</volume>, <fpage>947</fpage>&#x2013;<lpage>960</lpage>. <pub-id pub-id-type="doi">10.1038/nrc2015</pub-id>
<pub-id pub-id-type="pmid">17128211</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pacheco</surname>
<given-names>J. H. L.</given-names>
</name>
<name>
<surname>Elizondo</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Interplay between Estrogen, Kynurenine, and AHR Pathways: an immunosuppressive axis with therapeutic potential for breast cancer treatment</article-title>. <source>Biochem. Pharmacol.</source> <volume>217</volume>, <fpage>115804</fpage>. <pub-id pub-id-type="doi">10.1016/j.bcp.2023.115804</pub-id>
<pub-id pub-id-type="pmid">37716620</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paria</surname>
<given-names>B. C.</given-names>
</name>
<name>
<surname>Lim</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Das</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Reese</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Dey</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Molecular signaling in uterine receptivity for implantation</article-title>. <source>Semin. Cell Dev. Biol.</source> <volume>11</volume>, <fpage>67</fpage>&#x2013;<lpage>76</lpage>. <pub-id pub-id-type="doi">10.1006/scdb.2000.0153</pub-id>
<pub-id pub-id-type="pmid">10873704</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pru</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Clark</surname>
<given-names>N. C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>PGRMC1 and PGRMC2 in uterine physiology and disease</article-title>. <source>Front. Neurosci.</source> <volume>7</volume>, <fpage>168</fpage>. <pub-id pub-id-type="doi">10.3389/fnins.2013.00168</pub-id>
<pub-id pub-id-type="pmid">24065879</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rasmussen</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Orwig</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Vellucci</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Soares</surname>
<given-names>M. J.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Dual expression of prolactin-related protein in decidua and trophoblast tissues during pregnancy in rats</article-title>. <source>Biol. Reprod.</source> <volume>56</volume>, <fpage>647</fpage>&#x2013;<lpage>654</lpage>. <pub-id pub-id-type="doi">10.1095/biolreprod56.3.647</pub-id>
<pub-id pub-id-type="pmid">9047009</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schrocksnadel</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Wirleitner</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Winkler</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Fuchs</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Monitoring tryptophan metabolism in chronic immune activation</article-title>. <source>Clin. Chim. Acta</source> <volume>364</volume>, <fpage>82</fpage>&#x2013;<lpage>90</lpage>. <pub-id pub-id-type="doi">10.1016/j.cca.2005.06.013</pub-id>
<pub-id pub-id-type="pmid">16139256</pub-id>
</citation>
</ref>
<ref id="B69">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sedlmayr</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Blaschitz</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Stocker</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>The role of placental tryptophan catabolism</article-title>. <source>Front. Immunol.</source> <volume>5</volume>, <fpage>230</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2014.00230</pub-id>
<pub-id pub-id-type="pmid">24904580</pub-id>
</citation>
</ref>
<ref id="B70">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Serrano-Gomez</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Maziveyi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Alahari</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Regulation of epithelial-mesenchymal transition through epigenetic and post-translational modifications</article-title>. <source>Mol. Cancer</source> <volume>15</volume>, <fpage>18</fpage>. <pub-id pub-id-type="doi">10.1186/s12943-016-0502-x</pub-id>
<pub-id pub-id-type="pmid">26905733</pub-id>
</citation>
</ref>
<ref id="B71">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shah</surname>
<given-names>N. M.</given-names>
</name>
<name>
<surname>Lai</surname>
<given-names>P. F.</given-names>
</name>
<name>
<surname>Imami</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Johnson</surname>
<given-names>M. R.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Progesterone-Related immune modulation of pregnancy and labor</article-title>. <source>Front. Endocrinol. (Lausanne)</source> <volume>10</volume>, <fpage>198</fpage>. <pub-id pub-id-type="doi">10.3389/fendo.2019.00198</pub-id>
<pub-id pub-id-type="pmid">30984115</pub-id>
</citation>
</ref>
<ref id="B72">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Soules</surname>
<given-names>M. R.</given-names>
</name>
<name>
<surname>Wiebe</surname>
<given-names>R. H.</given-names>
</name>
<name>
<surname>Aksel</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hammond</surname>
<given-names>C. B.</given-names>
</name>
</person-group> (<year>1977</year>). <article-title>The diagnosis and therapy of luteal phase deficiency</article-title>. <source>Fertil. Steril.</source> <volume>28</volume>, <fpage>1033</fpage>&#x2013;<lpage>1037</lpage>. <pub-id pub-id-type="doi">10.1016/s0015-0282(16)42850-5</pub-id>
<pub-id pub-id-type="pmid">908443</pub-id>
</citation>
</ref>
<ref id="B73">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Stone</surname>
<given-names>T. W.</given-names>
</name>
<name>
<surname>Darlington</surname>
<given-names>L. G.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Endogenous kynurenines as targets for drug discovery and development</article-title>. <source>Nat. Rev. Drug Discov.</source> <volume>1</volume>, <fpage>609</fpage>&#x2013;<lpage>620</lpage>. <pub-id pub-id-type="doi">10.1038/nrd870</pub-id>
<pub-id pub-id-type="pmid">12402501</pub-id>
</citation>
</ref>
<ref id="B74">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suthaporn</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jayaprakasan</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Thornton</surname>
<given-names>J. G.</given-names>
</name>
<name>
<surname>Walker</surname>
<given-names>K. F.</given-names>
</name>
<name>
<surname>Castellanos</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>May</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Evaluating the influence of progesterone concentration and time of exposure on <italic>in vitro</italic> endometrial decidualisation</article-title>. <source>Mol. Cell Endocrinol.</source> <volume>528</volume>, <fpage>111242</fpage>. <pub-id pub-id-type="doi">10.1016/j.mce.2021.111242</pub-id>
<pub-id pub-id-type="pmid">33713746</pub-id>
</citation>
</ref>
<ref id="B75">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Suzuki</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Tone</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Takikawa</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Kubo</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kohno</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Minatogawa</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Expression of indoleamine 2,3-dioxygenase and tryptophan 2,3-dioxygenase in early concepti</article-title>. <source>Biochem. J.</source> <volume>355</volume>, <fpage>425</fpage>&#x2013;<lpage>429</lpage>. <pub-id pub-id-type="doi">10.1042/0264-6021:3550425</pub-id>
<pub-id pub-id-type="pmid">11284730</pub-id>
</citation>
</ref>
<ref id="B76">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tatsumi</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Higuchi</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Fujiwara</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nakayama</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Egawa</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Itoh</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2000</year>). <article-title>Induction of tryptophan 2,3-dioxygenase in the mouse endometrium during implantation</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>274</volume>, <fpage>166</fpage>&#x2013;<lpage>170</lpage>. <pub-id pub-id-type="doi">10.1006/bbrc.2000.3115</pub-id>
<pub-id pub-id-type="pmid">10903913</pub-id>
</citation>
</ref>
<ref id="B77">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsuchiya</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Nakajima</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Yokoi</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Cytochrome P450-mediated metabolism of estrogens and its regulation in human</article-title>. <source>Cancer Lett.</source> <volume>227</volume>, <fpage>115</fpage>&#x2013;<lpage>124</lpage>. <pub-id pub-id-type="doi">10.1016/j.canlet.2004.10.007</pub-id>
<pub-id pub-id-type="pmid">16112414</pub-id>
</citation>
</ref>
<ref id="B78">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Venetis</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Kolibianakis</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Bosdou</surname>
<given-names>J. K.</given-names>
</name>
<name>
<surname>Tarlatzis</surname>
<given-names>B. C.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Progesterone elevation and probability of pregnancy after IVF: a systematic review and meta-analysis of over 60 000 cycles</article-title>. <source>Hum. Reprod. Update</source> <volume>19</volume>, <fpage>433</fpage>&#x2013;<lpage>457</lpage>. <pub-id pub-id-type="doi">10.1093/humupd/dmt014</pub-id>
<pub-id pub-id-type="pmid">23827986</pub-id>
</citation>
</ref>
<ref id="B79">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Dey</surname>
<given-names>S. K.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Roadmap to embryo implantation: clues from mouse models</article-title>. <source>Nat. Rev. Genet.</source> <volume>7</volume>, <fpage>185</fpage>&#x2013;<lpage>199</lpage>. <pub-id pub-id-type="doi">10.1038/nrg1808</pub-id>
<pub-id pub-id-type="pmid">16485018</pub-id>
</citation>
</ref>
<ref id="B80">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wetendorf</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>DeMayo</surname>
<given-names>F. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The progesterone receptor regulates implantation, decidualization, and glandular development via a complex paracrine signaling network</article-title>. <source>Mol. Cell Endocrinol.</source> <volume>357</volume>, <fpage>108</fpage>&#x2013;<lpage>118</lpage>. <pub-id pub-id-type="doi">10.1016/j.mce.2011.10.028</pub-id>
<pub-id pub-id-type="pmid">22115959</pub-id>
</citation>
</ref>
<ref id="B81">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Whirledge</surname>
<given-names>S. D.</given-names>
</name>
<name>
<surname>Oakley</surname>
<given-names>R. H.</given-names>
</name>
<name>
<surname>Myers</surname>
<given-names>P. H.</given-names>
</name>
<name>
<surname>Lydon</surname>
<given-names>J. P.</given-names>
</name>
<name>
<surname>DeMayo</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Cidlowski</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Uterine glucocorticoid receptors are critical for fertility in mice through control of embryo implantation and decidualization</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>112</volume>, <fpage>15166</fpage>&#x2013;<lpage>15171</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.1508056112</pub-id>
<pub-id pub-id-type="pmid">26598666</pub-id>
</citation>
</ref>
<ref id="B82">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Bai</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Redox properties of tryptophan metabolism and the concept of tryptophan use in pregnancy</article-title>. <source>Int. J. Mol. Sci.</source> <volume>18</volume>, <fpage>1595</fpage>. <pub-id pub-id-type="doi">10.3390/ijms18071595</pub-id>
<pub-id pub-id-type="pmid">28737706</pub-id>
</citation>
</ref>
<ref id="B83">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xue</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Tryptophan metabolism in health and disease</article-title>. <source>Cell Metab.</source> <volume>35</volume>, <fpage>1304</fpage>&#x2013;<lpage>1326</lpage>. <pub-id pub-id-type="doi">10.1016/j.cmet.2023.06.004</pub-id>
<pub-id pub-id-type="pmid">37352864</pub-id>
</citation>
</ref>
<ref id="B84">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yi</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Nucleolar Stress: hallmarks, sensing mechanism and diseases</article-title>. <source>Cell Stress</source> <volume>2</volume>, <fpage>125</fpage>&#x2013;<lpage>140</lpage>. <pub-id pub-id-type="doi">10.15698/cst2018.06.139</pub-id>
<pub-id pub-id-type="pmid">31225478</pub-id>
</citation>
</ref>
<ref id="B85">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Tan</surname>
<given-names>H. X.</given-names>
</name>
<name>
<surname>Niu</surname>
<given-names>T. T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H. Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M. Q.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Kynurenine promotes the cytotoxicity of NK cells through aryl hydrocarbon receptor in early pregnancy</article-title>. <source>J. Reprod. Immunol.</source> <volume>143</volume>, <fpage>103270</fpage>. <pub-id pub-id-type="doi">10.1016/j.jri.2020.103270</pub-id>
<pub-id pub-id-type="pmid">33421663</pub-id>
</citation>
</ref>
<ref id="B86">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ye</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Yue</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Shao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Role of Ido and TDO in cancers and related diseases and the therapeutic implications</article-title>. <source>J. Cancer</source> <volume>10</volume>, <fpage>2771</fpage>&#x2013;<lpage>2782</lpage>. <pub-id pub-id-type="doi">10.7150/jca.31727</pub-id>
<pub-id pub-id-type="pmid">31258785</pub-id>
</citation>
</ref>
<ref id="B87">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yee</surname>
<given-names>G. M.</given-names>
</name>
<name>
<surname>Kennedy</surname>
<given-names>T. G.</given-names>
</name>
</person-group> (<year>1988</year>). <article-title>Stimulatory effects of prostaglandins upon endometrial alkaline phosphatase activity during the decidual cell reaction in the rat</article-title>. <source>Biol. Reprod.</source> <volume>38</volume>, <fpage>1129</fpage>&#x2013;<lpage>1136</lpage>. <pub-id pub-id-type="doi">10.1095/biolreprod38.5.1129</pub-id>
<pub-id pub-id-type="pmid">3408781</pub-id>
</citation>
</ref>
<ref id="B88">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yin</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Sheng</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Xiao</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Role of AhR in positive regulation of cell proliferation and survival</article-title>. <source>Cell Prolif.</source> <volume>49</volume>, <fpage>554</fpage>&#x2013;<lpage>560</lpage>. <pub-id pub-id-type="doi">10.1111/cpr.12282</pub-id>
<pub-id pub-id-type="pmid">27523394</pub-id>
</citation>
</ref>
<ref id="B89">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yokoyama</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Takahashi</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hashimoto</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shinohara</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Lian</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Tamaya</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Effects of sex steroids on silver stained proteins of nucleolar organizer regions (Ag-NOR) in the rabbit uterus</article-title>. <source>Biotech. Histochem</source> <volume>73</volume>, <fpage>202</fpage>&#x2013;<lpage>210</lpage>. <pub-id pub-id-type="doi">10.3109/10520299809141111</pub-id>
<pub-id pub-id-type="pmid">9735879</pub-id>
</citation>
</ref>
<ref id="B90">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Liang</surname>
<given-names>X. H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Qi</surname>
<given-names>Q. R.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>W. B.</given-names>
</name>
<etal/>
</person-group> (<year>2013</year>). <article-title>The mesenchymal-epithelial transition during <italic>in vitro</italic> decidualization</article-title>. <source>Reprod. Sci.</source> <volume>20</volume>, <fpage>354</fpage>&#x2013;<lpage>360</lpage>. <pub-id pub-id-type="doi">10.1177/1933719112472738</pub-id>
<pub-id pub-id-type="pmid">23302397</pub-id>
</citation>
</ref>
<ref id="B91">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zuberi</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Dotts</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Coon</surname>
<given-names>J. S. t.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>MED12 mutation activates the tryptophan/kynurenine/AHR pathway to promote growth of uterine leiomyomas</article-title>. <source>JCI Insight</source> <volume>8</volume>, <fpage>e171305</fpage>. <pub-id pub-id-type="doi">10.1172/jci.insight.171305</pub-id>
<pub-id pub-id-type="pmid">37607000</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>