This study received approval from the Institutional Review Board of the Center for Reproductive Medicine at Guangdong Provincial Hospital (Approval Number: KY2024-473-01) and adhered to the principles outlined in the Declaration of Helsinki. Written informed consent was obtained from all participants. The study included a total of 27 patients diagnosed with polycystic ovary syndrome in the PCOS group, while 22 women who underwent in vitro fertilization due to male factor infertility or tubal factor infertility were included in the control group. All participants were under the age of 40. Both groups underwent IVF cycles between 2019 and 2021. The PCOS group met the inclusion criteria based on the modified Rotterdam criteria, whereas the control group was selected based on specific inclusion criteria, which included regular menstrual cycles, the absence of endocrine abnormalities, and confirmation of normal ovarian and uterine morphology through ultrasound or histological examination. Exclusion criteria for all participants included recurrent pregnancy loss, chromosomal abnormalities, diabetes mellitus, adenomyosis, endometriosis, and a history of malignancy. All women with basal hormone levels were included in this study, with their levels assessed on the third day of the menstrual cycle using chemiluminescence immunoassays. Blood samples were collected to measure Anti-Mullerian Hormone (AMH) levels, also utilizing chemiluminescence immunoassays. Body Mass Index (BMI) was calculated using the formula weight (kg)/height (m²). The waist-to-hip ratio, an index of body fat distribution, was determined by dividing waist circumference (cm) by hip circumference (cm). The antral follicle count for all subjects in the cohort study was measured on the assessment day via transvaginal ultrasound. Participants in each cohort underwent ovarian stimulation following standardized long-agonist protocols. In this protocol, pituitary function was suppressed using a gonadotropin-releasing hormone agonist (GnRHa) on day 21 of the preceding menstrual cycle, followed by the administration of recombinant Follicle-Stimulating Hormone (FSH) at doses ranging from 75 to 225 IU. In all protocols, urinary human chorionic gonadotropin (hCG) was administered once at least two dominant follicles reached a minimum diameter of 18–20 mm. Oocyte retrieval was performed 34–36 h after hCG injection through vaginal ultrasound-guided follicle puncture. During a single treatment cycle, the maturation process was assessed by determining the absolute number of mature oocytes and the percentage of mature oocytes collected. Additionally, follicular fluid was collected to isolate ovarian granulosa cells during the oocyte retrieval procedure.

Granulosa cells were isolated from follicular fluid on the day of oocyte retrieval. The cells underwent incubation with hyaluronidase and Hanks’ balanced salt solution, followed by the addition of a human peripheral blood lymphocyte isolate and subsequent centrifugation. The interphase solution was collected, and cell aggregates were removed via filtration. The cells were then transferred to a new microcentrifuge tube using phosphate-buffered saline. After discarding the supernatant, the granulosa cells were prepared for further experimental procedures.

Granulosa cells were subjected to lysis using TRIzol Reagent (Invitrogen) to facilitate total RNA extraction, followed by purification with the RNeasy Mini Kit (Qiagen). The concentration and purity of the isolated total RNA were assessed via ultraviolet spectrophotometry. The extracted RNA was then reverse-transcribed into complementary DNA (cDNA) utilizing the SuperScript II Kit (Invitrogen) and subsequently analyzed through real-time quantitative polymerase chain reaction (qPCR). The mRNA expression levels were normalized to β-ACTIN mRNA, which functioned as an internal control, and quantified using the 2^−ΔΔCT method. Data are expressed as the mean ± standard error of the mean (SEM) and are based on three independent experiments. The sequences of the PCR primers used were as follows: human CNOT6L forward primer AGAAATCTCGGGTAGAGTGCG and reverse primer AGCTTGGCAATATCAGGTGGA; mouse Cnot6l forward primer CAGCTGTAGTGGAAAGAATGGAAG and reverse primer CAAGCACGTTCATAT GAGTCTTGG; human β-ACTIN forward primer CATGTACGTTGCTATCCAGGC and reverse primer CTCCTTAATGTCACGCACGAT; mouse β-Actin forward primer GTGACGTTGACATCCGTAAAGA and reverse primer GCCGGACTCATCGTACT CC.

Prenatally androgenized mouse model (PNA) were generated as previously described (Liu et al., 2025). In this study, all mice were maintained on a C57BL/6J genetic background and procured from Gempharmatech Co., Ltd. (Nanjing, China). The mice were randomly assigned to experimental groups and provided with ad libitum access to a commercially available pelleted diet (Beijing Keao Xieli Feed Co.) and water. The animals were housed under controlled environmental conditions at a temperature of 21°C ± 1°C and a humidity level of 50% ± 5%, with a 12-h light/dark cycle. To establish PNA mouse model using dihydrotestosterone (DHT), pregnant female mice aged 8 weeks were subcutaneously administered DHT at a dose of 250 µg per animal once daily for three consecutive days during embryonic days 16.5–18.5. All female offspring were utilized as PCOS-like model mice and control mice. Ethical approval for all animal studies was obtained from the Animal Care and Use Committee of Guangdong Academy of Medical Sciences (S2022-258-01), and the experiments were conducted in accordance with the guidelines established by the National Institutes of Health for the care and use of animals.

At 3 weeks of age, the mice received intraperitoneal injections of pregnant mare serum gonadotropin PMSG at a dose of 5 IU per mouse. Ovarian tissues were collected 24 h post-injection, and follicles were punctured with insulin needles to release granulosa cells into a pre-warmed DMEM/F12 medium. The follicular fluid, enriched with granulosa cells, underwent centrifugation at room temperature, and the resulting cell pellet was resuspended in phosphate-buffered saline (PBS). An equal volume of Ficoll was added for gradient centrifugation, and the intermediate white flocculent layer was carefully aspirated. The cell suspension was then subjected to digestion with hyaluronidase and erythrocyte lysis. Subsequently, the ovarian granulosa cells were seeded onto cell culture dishes or well plates coated with mouse-derived substrate, and adherence was assessed after 24 h. The culture medium was gently replaced, and the subsequent cultured in DMEM/F12 medium with 10% fetal bovine serum, 100 U/ml penicillin and 100ug/ml streptomycin. To investigate the long-term effects of hyperandrogenism on primary cells, these cells were cultured in vitro using DMEM-F12 medium supplemented with 10 µM testosterone. We exogenously added 10uM Forskolin to simulate the state of activation of the cAMP signaling pathway.

Recombinant adenoviruses overexpressing Cnot6l and Cnot6 were generated utilizing the recombinant adenovirus system provided by Shanghai Jikai Gene Technology Co., Ltd. Within this system, adenoviral shuttle plasmids containing exogenous genes are co-transfected with packaging plasmids that harbor the adenoviral genome into HEK293 cells. Recombination is facilitated by the Cre/loxP recombinase system, resulting in the production of recombinant adenoviruses. We utilized adenovirus vectors overexpressing Cnot6l or Cnot6 to infect primary mouse ovarian granulosa cells. Upon reaching approximately 70% confluence, the transfection system was quantified based on the cell count and the number of infected replicates. Following a 48-h period post-adenoviral transfection, we conducted cell function assays and various molecular experiments.

Cellular concentrations of pyruvate and lactate were quantified utilizing a pyruvate colorimetric assay kit and a lactate colorimetric assay kit (Nanjing Jiancheng Bioengineering Institute, China). In summary, cells were harvested and subjected to washing with ice-cold phosphate-buffered saline, followed by lysis and extraction using the buffers provided in the respective kits, adhering strictly to the manufacturer’s protocols. The levels of the metabolites, pyruvate and lactate, were subsequently determined in accordance with the manufacturer’s guidelines.

Cells were seeded into 24-well plates and subjected to various experimental treatments. Following lysis, the cells were centrifuged at 12,000 g for 5 min at 4°C, and the supernatant was collected. Cellular ATP production was quantified using an Enhanced ATP Assay Kit (Beyotime, China). Before ATP measurement, the detection solution was added to a 96-well plate and incubated at room temperature for 5 min. Subsequently, the supernatant was introduced to the plate, rapidly mixed, and analyzed within 30 min. Total ATP levels were derived from luminescence signals and normalized to protein concentrations. The activity of Na⁺-K⁺-ATPase was evaluated by quantifying the release of inorganic phosphate (Pi) from ATP, following the protocol provided by the Nanjing Jiancheng Bioengineering Institute, China. Na⁺-K⁺-ATPase activity was determined using the malachite green dye method to measure the amount of inorganic phosphate, which was expressed as micromoles per milligram of protein.

The glycolytic and mitochondrial activity were quantified using a Seahorse XF96 analyzer (Seahorse Bioscience). The Micro BCA assay (Sigma‐Aldrich) determined the cellular protein concentration. The data are presented as ECAR or OCR values normalized to protein concentration.

In the glycolytic activity assay, cells overexpressing Cnot6l, along with control cells, were seeded overnight in Seahorse XF96 microplates and incubated in a non-buffered assay medium within a non-CO2 incubator for 30 min prior to the assay. The extracellular acidification rate (ECAR) was recorded over intervals of 4 min, with a mixing duration of 2 min per cycle across four cycles. Following each cycle, activators and inhibitors sourced from Sigma were administered at the following concentrations: glucose, oligomycin, and 2-deoxy-D-glucose.

In the mitochondrial activity assay, cells were seeded into Seahorse miniplates (96 wells) overnight. After which cells were washed and exchanged in Seahorse assay buffer in a 37°C non-CO2 incubator for 30 min before assay, pharmaceutical compounds including oligomycin, FCCP, antimycin, and rotenone were prepared to stressor mix at optimized concentration.

The glycolytic rate is defined as the ECAR achieved by the cell population upon the addition of saturating concentrations of glucose. Glycolytic capacity refers to the maximum ECAR attained by the cell population following the addition of oligomycin, which inhibits oxidative phosphorylation and compels the cells to rely on glycolysis to its fullest extent. The basal OCR is defined as the OCR before the injection of oligomycin. Maximum OCR refers to OCR following the injection of FCCP. Reserve respiration refers to maximum respiration minus basal OCR. Non-mitochondrial OCR refers to the OCR following the injection of rotenone and antimycin A.

We conducted third-generation RNA sequencing using the PacBio RS II system on Iso-Seq libraries of polyadenylated and full-length transcripts derived from granulosa cells of both PCOS and control groups. The Agilent 2100 Bioanalyzer is employed to assess the concentration, RNA Integrity Number value, 28S/18S ratio, and fragment size of total RNA. The library construction workflow involves several key steps: initially, total RNA samples obtained from granulosa cells of patients with PCOS and control subjects are purified using oligo(dT)-attached magnetic beads. Prior to reverse transcription, the total RNA is linked to a GI anchor to facilitate the reverse transcription of the complete polyadenylated sequence. The RNA, once cleaned and end-extended, is reverse transcribed into full-length cDNA through reverse transcription (Picelli et al., 2014; Jing et al., 2019). The full-length cDNA is amplified using KAPA HiFi HotStart ReadyMix with specific PCR primers. The amplified cDNA products are size-selected using Pure PB beads and subsequently converted into SMRTbell Template libraries using the SMRTbell Template Prep Kit (Liu et al., 2023).

Sequencing data are processed through Reads Of Insert (ROI), full-length transcript classification, cluster and polish to consensus reads. Consensus reads are then mapped to reference genome for funsion gene detectionisoform classification, functional annotation, and coding capacity prediction. Obtained new transcripts with protein coding capacity are added to reference genes for complete reference sequences, followed by gene and isoform expression calculation. Finally, DEGs are detected for multiple samples, and further analysis, such as cluster and functional enrichment analysis are supplied. All sequencing data is available at GEO database (https://www.ncbi.nlm.nih.gov/geo/).

Statistical analyses and graphical representations were performed using SPSS version 29.0 and GraphPad Prism version 9.5. Prior to analysis, normality tests were conducted. Data from the mouse study are presented as mean ± standard error of the mean (SEM) for the specified observations. Comparisons between the two groups were evaluated using either an unpaired two-tailed Student’s t-test or the Mann-Whitney test. For comparisons involving multiple groups, one-way or two-way ANOVA, or a mixed-effects analysis model with multiple comparisons test, was utilized. Detailed statistical information, including sample sizes, is provided in the respective figure legends for each experiment. Statistical significance was determined at a P-value of less than 0.05. Although sample sizes were not predetermined by statistical methods, they align with those reported in previous studies. All experiments requiring statistical analysis were conducted in triplicate, consistently yielding reliable results.

By re-analyzing previously reported sequencing data of ovarian granulosa cells in polycystic ovary syndrome, which were GSE138518, GSE155489, and GSE173160, we identified a significant increase in CNOT6L mRNA expression levels in the ovarian granulosa cells of individuals with PCOS (Figure 1A). Subsequently, we collected granulosa cell samples from PCOS patients undergoing IVF-ET at the reproductive medicine center, as well as from a control group, to validate these findings. The results confirmed elevated CNOT6L mRNA expression levels in the granulosa cells of PCOS patients compared to those in the control group (Figure 1B). Furthermore, the mRNA expression level of CNOT6L in the ovarian granulosa cells of PCOS patients exhibited correlations with the patients’ body mass index, the number of follicles on hCG day, and the number of mature oocytes. Although these correlations were relatively weak, they were statistically significant. Specifically, the mRNA expression of CNOT6L demonstrated a weak positive correlation with BMI and weak negative correlations with the number of follicles on hCG day and the number of mature oocytes, with −0.308 and −0.351 correlation coefficients, respectively (Figures 1C,D).

Subsequently, we established a mouse model of PCOS through the administration of dihydrotestosterone during the late gestational period. We analyzed the mRNA expression levels in the ovaries of mice, comparing those with PCOS to control subjects. The findings indicated a significant upregulation of the transcriptional levels of key genes involved in mRNA deadenylation in the ovarian tissues of PCOS model mice compared to the control group (Figure 1E). Following this, we cultured ovarian granulosa cells from wild-type mice in vitro and administered exogenous testosterone stimulation. The results indicate that the mRNA expression level of Cnot6l in ovarian granulosa cells increased following testosterone treatment. The expression level of Cnot6 exhibited only a mild elevation, but the difference did not reach statistical significance (Figure 1F). These results suggest that the expression of the key gene CNOT6L, which is implicated in the regulation of mRNA deadenylation, is altered in the ovarian granulosa cells of both PCOS patients and animal models.

We engineered adenoviruses to overexpress Cnot6 and Cnot6l and subsequently transfected primary granulosa cells derived from wild-type mice with these constructs. Following transfection, we quantitatively analyzed the mRNA and protein expression levels of CNOT6L in the granulosa cells exhibiting overexpression. Our findings indicated a significant upregulation of both mRNA and protein levels of CNOT6L in the overexpression group compared to cells transfected with an empty vector adenovirus (Figures 2A,B). Furthermore, we evaluated the proliferative capacity of the cells, observing a marked reduction in the proliferative ability of Cnot6l overexpressing cells at 24 h post-transfection, with the most pronounced difference occurring at 48 h (Figure 2C). We assessed hormone concentrations in the cell culture medium, revealing that the aberrant overexpression of CNOT6L in granulosa cells resulted in a statistically significant reduction in estrogen levels (Figure 2D). In contrast, progesterone levels exhibited a minor decrease that did not reach statistical significance (Figure 2E). Additionally, we investigated the expression of genes associated with steroid hormone synthesis within the cells. Our analysis demonstrated a significant downregulation of mRNA levels for critical enzymes involved in steroid hormone synthesis in granulosa cells overexpressing CNOT6L (Figure 2F).

Previous studies have indicated that the glycolytic processes and mitochondrial function in ovarian granulosa cells of patients with polycystic ovary syndrome are compromised. This impairment leads to damage in the granulosa cells, which subsequently diminishes oocyte quality and adversely affects embryonic developmental potential (Zhang et al., 2022; Cao et al., 2022). Oocytes predominantly depend on the direct utilization of pyruvate to fulfill their energy requirements during maturation. Given the critical role of energy metabolism homeostasis in granulosa cells for follicular development, we further assessed the energy metabolism status in Cnot6l overexpressing cells. The results demonstrated that overexpression of CNOT6L significantly reduced ATP levels in granulosa cells under both basal and cAMP-activated conditions (Figure 3A). However, overexpression of CNOT6L did not significantly alter the activity of Na-K-ATPase (Figure 3B). Moreover, the levels of lactate and pyruvate, which serve as energy substrates for oocytes, were significantly decreased (Figures 3C,D). Subsequently, a cellular energy metabolism analyzer was employed to evaluate the glycolytic process within the cytoplasm of granulosa cells. The findings indicated a significant inhibition of glycolytic capacity in cells overexpressing CNOT6L (Figure 3E), accompanied by a reduction in maximum glycolytic capacity (Figure 3F). Analysis of primary mitochondrial energy substrates demonstrated a marked preference for glucose-pyruvate-derived sources (Figure 3G). Consequently, mitochondrial oxidative respiration was further assessed in Cnot6l-overexpressing cells. The results revealed that CNOT6L overexpression not only diminished glycolytic activity in granulosa cells but also significantly enhanced mitochondrial oxidative respiration (Figure 3H), as evidenced by a substantial increase in the maximum oxygen consumption rate (Figure 3I). Collectively, these findings confirm that modulating the levels of the deadenylase CNOT6L in ovarian granulosa cells can shift intracellular energy utilization from glycolysis to mitochondrial oxidative phosphorylation. This alteration subsequently hinders the transport of energy substrates from granulosa cells to oocytes, resulting in energy depletion within the oocytes.

The stability and degradation of mRNAs are correlated with the lengths of their poly(A) tails. Drawing upon previous research findings, we propose the hypothesis that variations in the levels of the deadenylase enzyme CNOT6L in ovarian granulosa cells may influence follicular developmental dysfunction in polycystic ovary syndrome by modulating energy metabolism pathways. To explore the pathways involved in greater depth, we collected granulosa cells from patients diagnosed with PCOS as well as from control subjects. Samples were utilized to construct Iso-Seq libraries, which were subsequently employed for full-length transcript sequencing using the PacBio RS II system. This approach was implemented to evaluate RNA poly(A) tail lengths.

In all cells, 13,473 genes (61,093 transcripts) and 13,966 genes (62,072 transcripts) were captured from the Control and PCOS groups, respectively. The transcripts in the duplicates exhibited a comparable distribution of poly(A) tail lengths. Notably, for mRNAs encoded by the nuclear genome, the median poly(A) tail lengths in PCOS cells (139 nucleotides) were similar to those in control cells (134 nucleotides) (Figure 4A). However, a pairwise comparison of the genes (n = 6,930) that were concurrently expressed in both PCOS and control cells revealed an increase in the fraction of transcripts with poly(A) tails ranging from 30 to 126 nucleotides in PCOS cells compared to the Control group. Conversely, the proportion of transcripts with poly(A) tails measuring 126 to 250 nucleotides was reduced in PCOS cells relative to the Control group (Figure 4B). To elucidate the functional implications of genes with altered polyadenylation tails, we performed a Gene Ontology (GO) enrichment analysis on genes displaying either elongated or truncated poly(A) tails in the PCOS group relative to the control group. The GO analysis indicated that genes associated with immune regulation, response to stimuli, and cell adhesion predominantly exhibited elongated poly(A) tails (Figure 4C). In contrast, genes involved in cell differentiation, development, and vesicle transport processes were characterized by truncated poly(A) tails in the PCOS group (Figure 4D). Subsequent analysis of the differentially expressed genes within the same samples was conducted. Differentially expressed genes were defined based on a P-value threshold of <0.05 and an absolute fold change of >1.5. The results indicated a total of 191 downregulated genes and 181 upregulated genes in the PCOS group in comparedison to the control group (Figure 4E). GO enrichment analysis of differentially expressed genes demonstrated a significant enrichment in pathways associated with anion binding, small molecule binding, and carbohydrate derivative binding. Importantly, pathways pertinent to energy production and utilization, including ATP-dependent activity and ATP binding, were also significantly enriched in the polycystic ovary syndrome group (Figure 4F). By correlating differentially expressed genes with their respective transcripts, we identified 93 genes that not only demonstrated differential expression but also exhibited variations in polyadenylation tail length. Among these, 44 genes were upregulated, whereas 49 genes were downregulated in the PCOS group. The genes in question include several that play pivotal roles in metabolic processes, notably the HK2 gene, which exhibits reduced expression levels and a shortened polyadenylation tail in individuals with polycystic ovary syndrome (Figure 4G). Furthermore, the analysis identifies critical genes involved in gamete development, such as the PTPN1 gene, which shows increased expression and an elongated polyadenylation tail in the PCOS group compared to the control group (Figure 4G).