<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3-mathml3.dtd">
<article article-type="research-article" dtd-version="1.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Cell Dev. Biol.</journal-id>
<journal-title-group>
<journal-title>Frontiers in Cell and Developmental Biology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Cell Dev. Biol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="epub">2296-634X</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1504834</article-id>
<article-id pub-id-type="doi">10.3389/fcell.2025.1504834</article-id>
<article-version article-version-type="Version of Record" vocab="NISO-RP-8-2008"/>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Research</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>The impact of methylprednisolone and rituximab on podocyte injury caused by puromycin aminonucleoside</article-title>
<alt-title alt-title-type="left-running-head">Wang et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fcell.2025.1504834">10.3389/fcell.2025.1504834</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Li</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1598157"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhao</surname>
<given-names>Manman</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhu</surname>
<given-names>Jialiang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/conceptualization/">Conceptualization</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation/">Data curation</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Hua</surname>
<given-names>Ran</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration/">Project administration</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Zhu</surname>
<given-names>Ying</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1075874"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft/">Writing - original draft</role>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Deng</surname>
<given-names>Fang</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1429588"/>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition/">Funding acquisition</role>
<role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing &#x2013; review &#x26; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/">Writing - review and editing</role>
</contrib>
</contrib-group>
<aff id="aff1">
<label>1</label>
<institution>Department of Pediatrics, The First Affiliated Hospital of Anhui Medical University</institution>, <city>Hefei</city>, <state>Anhui</state>, <country country="CN">China</country>
</aff>
<aff id="aff2">
<label>2</label>
<institution>Department of Nephrology, Children&#x2019;s Hospital of Anhui Medical University (Anhui Provincial Children&#x2019;s Hospital)</institution>, <city>Hefei</city>, <state>Anhui</state>, <country country="CN">China</country>
</aff>
<author-notes>
<corresp id="c001">
<label>&#x2a;</label>Correspondence: Fang Deng, <email xlink:href="mailto:dengfang@ahmu.edu.cn">dengfang@ahmu.edu.cn</email>
</corresp>
</author-notes>
<pub-date publication-format="electronic" date-type="pub" iso-8601-date="2025-12-10">
<day>10</day>
<month>12</month>
<year>2025</year>
</pub-date>
<pub-date publication-format="electronic" date-type="collection">
<year>2025</year>
</pub-date>
<volume>13</volume>
<elocation-id>1504834</elocation-id>
<history>
<date date-type="received">
<day>23</day>
<month>01</month>
<year>2025</year>
</date>
<date date-type="rev-recd">
<day>25</day>
<month>11</month>
<year>2025</year>
</date>
<date date-type="accepted">
<day>27</day>
<month>11</month>
<year>2025</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2025 Wang, Zhao, Zhu, Hua, Zhu and Deng.</copyright-statement>
<copyright-year>2025</copyright-year>
<copyright-holder>Wang, Zhao, Zhu, Hua, Zhu and Deng</copyright-holder>
<license>
<ali:license_ref start_date="2025-12-10">https://creativecommons.org/licenses/by/4.0/</ali:license_ref>
<license-p>This is an open-access article distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License (CC BY)</ext-link>. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</license-p>
</license>
</permissions>
<abstract>
<sec>
<title>Introduction</title>
<p>To explore how MP and RTX impact TRPC6's expression and localization, and assess MP's and RTX's effects on podocyte injury and recovery.</p>
</sec>
<sec>
<title>Methods</title>
<p>MPC5 cells were simultaneously grown alongside a control group and under various conditions: exposure to puromycin aminonucleoside (PAN) stimulation, treatment with methylprednisolone (MP), and treatment with rituximab (RTX), and a combined treatment with both MP and RTX.</p>
</sec>
<sec>
<title>Results</title>
<p>At 8, 24, and 48 h, CCK-8 assay showed that PAN (50 &#x3bc;g/mL) had a decrease in cell viability and an increase in cell death, and it could be used as the optimum concentration to induce podocyte injury; MP (100 ng/mL) and RTX (100 &#x3bc;g/mL) maintained cell viability and had minimal impact on cell morphology, and they were the best concentrations. Following 24 and 48-h exposure to MP or RTX, there was a decrease of 30%&#x2013;50% in apoptosis rates by flow cytometry in comparison to the group stimulated with PAN, accompanied by a substantial reduction in nearly 10%&#x2013;60% of TRPC6 mRNA and 5%&#x2013;20% of protein levels which were measured using qRT-PCR and western blot analyses, akin to the observed decrease in levels of IL-1&#x3b2; and IL-18. Additionally, calcium entry showed considerable reductions after 8, 24, and 48 h of MP treatment relative to the PAN-stimulation group, paralleling the effect seen with 24-h RTX treatment.</p>
</sec>
<sec>
<title>Discussion</title>
<p>Therefore, MP and RTX safeguarded podocytes, and averted proteinuria by decreasing podocyte apoptosis, diminishing TRPC6 mRNA and protein levels, and suppressing inflammatory markers and calcium entry.</p>
</sec>
</abstract>
<kwd-group>
<kwd>rituximab</kwd>
<kwd>methylprednisolone</kwd>
<kwd>TRPC6</kwd>
<kwd>calcium influx</kwd>
<kwd>podocyte</kwd>
</kwd-group>
<funding-group>
<funding-statement>The authors declare that financial support was received for the research and/or publication of this article. This work was supported by the Clinical Research Transformation Project of the Anhui Province (202304295107020063).</funding-statement>
</funding-group>
<counts>
<fig-count count="6"/>
<table-count count="1"/>
<equation-count count="0"/>
<ref-count count="46"/>
<page-count count="12"/>
</counts>
<custom-meta-group>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Cellular Biochemistry</meta-value>
</custom-meta>
</custom-meta-group>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>Introduction</title>
<p>Nephrotic syndrome (NS) is a common clinical glomerular disease, and massive proteinuria is its main clinical indication. Central to NS is immune system dysfunction, particularly the dysregulation of podocytes and inflammation factors that damage the glomerular filtration barrier (GFB), mainly composed of three layers, namely, glomerular endothelial cells, basement membrane, and podocytes, respectively, from inside to outside (<xref ref-type="bibr" rid="B41">Vivarelli et al., 2023</xref>). Release of proteinuria or NS are symptoms of podocytopathies, glomerular disease caused by direct or indirect podocyte injury, which link to immune system (<xref ref-type="bibr" rid="B28">Myette et al., 2025</xref>). Nephrin, the major podocyte antigen, contributes to renal injury through the production of autoantibodies, and prevents macromolecular proteins carrying the same charge properties from leaking out of the filtration barrier (<xref ref-type="bibr" rid="B2">Al-Aubodah et al., 2025</xref>; <xref ref-type="bibr" rid="B10">Duan et al., 2025</xref>; <xref ref-type="bibr" rid="B34">Qu and Jiao, 2023</xref>; <xref ref-type="bibr" rid="B8">Colucci et al., 2022</xref>; <xref ref-type="bibr" rid="B26">Meng et al., 2025</xref>).</p>
<p>As the last barrier to proteinuria, podocytes are the key target cells in the whole process of occurrence and development of NS (<xref ref-type="bibr" rid="B41">Vivarelli et al., 2023</xref>; <xref ref-type="bibr" rid="B25">Meliambro et al., 2024</xref>). Structural podocyte abnormalities, such as abnormalities in actin cytoskeleton or slit diagram (SD), can cause foot processes (FPs) fusion, and affect the integrity of the GFB, indicating that podocyte injury and proteinuria, which account for up to 90% of cases of worsening kidney function worldwide (<xref ref-type="bibr" rid="B25">Meliambro et al., 2024</xref>; <xref ref-type="bibr" rid="B22">Loreth et al., 2025</xref>). Nevertheless, podocyte foot process morphology has diagnostic value in differentiating diabetic nephropathy (DN) and minimal change disease (MCD) (<xref ref-type="bibr" rid="B19">Li et al., 2025</xref>).</p>
<p>Moreover, podocytes are postmitotic cells and have a very limited capacity for self-renewal (<xref ref-type="bibr" rid="B22">Loreth et al., 2025</xref>; <xref ref-type="bibr" rid="B14">Haydak and Azeloglu, 2024</xref>). Podocyte loss, whether due to detachment or cell death, results in irreversible damage and scarring of the renal filtration units (<xref ref-type="bibr" rid="B25">Meliambro et al., 2024</xref>; <xref ref-type="bibr" rid="B14">Haydak and Azeloglu, 2024</xref>). Podocyte injury has been reported to be associated with intracellular calcium (Ca<sup>2&#x2b;</sup>) overload (<xref ref-type="bibr" rid="B16">Ilatovskaya et al., 2025</xref>). Transient receptor potential ion channel 6 (TRPC6) has been recognized as a novel SD protein involved in maintaining the structural stability of the podocyte skeleton and regulating Ca<sup>2&#x2b;</sup> homeostasis (<xref ref-type="bibr" rid="B23">Lu et al., 2019</xref>). It has been confirmed by TRPC6-specific inhibitor through attenuating the degradation of podocyte structural proteins, inhibiting fluorescence intensity of intracellular Ca<sup>2&#x2b;</sup>, and podocyte apoptosis, resulted in podocyte injury and recovery <italic>in vitro</italic> (<xref ref-type="bibr" rid="B11">Feng et al., 2022</xref>). It was also shown that TRPC6 gene variation in glomerular human glomerular diseases, including MCD, FSGS, and immune complex associated glomerulonephritis (<xref ref-type="bibr" rid="B39">Sun et al., 2021</xref>), and TRPC6 overexpression in podocytes correlate with decreased calpastatin expression, autophagy blockade, and podocyte injury in DN (<xref ref-type="bibr" rid="B36">Salemkour et al., 2023</xref>). Therefore, TRPC6-directed therapy is therefore currently being targeted for treatment for podocytopathies.</p>
<p>Corticosteroids are the cornerstone of the treatment of NS. However, 5%&#x2013;15% children who do not respond to a cycle of oral steroids, and 55%&#x2013;60% have frequent relapses and require repeated or ongoing use of glucocorticoids, therefore, most of them require steroid-sparing immunosuppressive agents, including calcineurin inhibitors, rituximab (RTX) (<xref ref-type="bibr" rid="B41">Vivarelli et al., 2023</xref>). Aside from depleting CD20 B cells, RTX binds to podocyte SMPDL3b and has non-immunological effect on podocytes by reducing podocyte injury and apoptosis, increasing cell adhesion, and stabilizing actin cytoskeleton, contributing to its effectiveness in reducing proteinuria (<xref ref-type="bibr" rid="B17">Jeruschke et al., 2022</xref>; <xref ref-type="bibr" rid="B3">Aslam and Koirala, 2023</xref>). Furthermore, the depletion of antigen-presenting B cells by RTX may target B-cell survival signaling through the BAFF/APRIL pathway, restore the balance between autoreactive T cells and regulatory T cells, and suppress interleukin (IL)-13 secretion by Th2 cells in autoimmune diseases (<xref ref-type="bibr" rid="B20">Lin et al., 2024</xref>).</p>
<p>Clinical studies have demonstrated that combining RTX treatment with methylprednisolone (MP) pulse therapy might be more effective in reducing proteinuria and relapse rates in patients suffering from NS than RTX alone, however, the precise pharmacological mechanism of RTX and MP are not well understood yet (<xref ref-type="bibr" rid="B5">Chan and Tullus, 2021</xref>; <xref ref-type="bibr" rid="B6">Chan et al., 2023</xref>; <xref ref-type="bibr" rid="B45">Yokota et al., 2024</xref>; <xref ref-type="bibr" rid="B30">Nozu et al., 2024</xref>). <italic>In vivo</italic> and vitro, TRPC6-targeted dexamethasone (Dex) nanobubles could alleviate podocyte apoptosis and inflammation, suggesting that TRPC6 might be an ideal guiding target for glucocorticoids-based renal therapy (<xref ref-type="bibr" rid="B43">Wu et al., 2025</xref>). Puromycin aminonucleoside (PAN) is used mainly <italic>in vitro</italic> and vivo, not in clinic, and there is no standard for the safe doses at human level for its potential toxicity. Furthermore, PAN treatment could significantly disrupt the cytoskeletal architecture of cultured mouse podocytes, and reduce the formation of focal adhesions and stress fibers. Interdigiting intercellular junctions were replaced by dot-like structures with accumulated filamentous actin (<xref ref-type="bibr" rid="B15">Huang et al., 2025</xref>). In this study, we utilized a podocyte injury model with PAN treatment to explore how MP and RTX impact TRPC6&#x2019;s expression and localization, and assess MP&#x2019;s and RTX&#x2019;s effects on podocyte injury and recovery.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>Materials and methods</title>
<sec id="s2-1">
<title>Cell culture</title>
<p>Cell line mouse podocyte clone 5 (MPC5) was procured from the Chinese Academy of Sciences Cell Bank (Shanghai). The podocytes underwent cultivation in 1% penicillin-streptomycin (Beyotime, Biological Industries, China, Israel) with an added 10% fetal bovine serum (FBS) (Viva Cell, Shanghai, China), and were carried out at a steady temperature of 37 &#xb0;C inside an incubator enriched with 5% carbon dioxide. The trials were segmented into five groups: the control group, and PAN (Bioss, China) stimulation group. Both RTX (Roche, Switzerland) and PAN incorporated to engage with the podocytes. Both MP (Manufacturing Belgium NV, Pfizer) and PAN were solubilized for podocytes engagement. Correspondingly, PAN along with RTX and MP were introduced and homogenized to facilitate interaction with the podocytes.</p>
</sec>
<sec id="s2-2">
<title>CCK-8 assay</title>
<p>Various amounts of podocytes per well were dispensed into 96-well plates, each containing a 100 &#xb5;L sample, and allowed to settle for 12 h at 37 &#xb0;C. Firstly, 10 &#xb5;L of the CCK-8 solution (BA00208, Beyotime, China) was introduced to each well and the plates were incubated at 37 &#xb0;C for 1 h. The absorbance at 450 nm of the plates was then measured every hour for a total of six times using a spectrophotometer. After determining the optimal cell density, podocytes were plated again in 96-well dishes at this concentration, using 100 &#xb5;L volume for each well for a duration of 12 h. Secondly, varying levels of PAN, RTX, and MP were applied for a duration of 1 h, succeeded by the addition of a 10 &#xb5;L CCK-8 mixture, which was then cultivated at 37 &#xb0;C for an additional 2 h before the optical density was measured. Once an appropriate dosage was established, administration occurred over various time spans (8, 24, or 48 h). Subsequently, podocytes received PAN at the determined optimal concentration and duration, with MP and RTX being administered either in conjunction or not.</p>
</sec>
<sec id="s2-3">
<title>Quantitative real-time polymerase chain reaction (qRT-PCR)</title>
<p>Following the guidelines provided by the RNAgents Total RNA Isolation System&#x2019;s manual (AG11701, ACCURATE BIOLOGY, China), cellular RNA was isolated. The RNA was harvested from the cells employing the prescribed protocol of the RNA extraction kit (AG21102). Subsequently, reverse transcription was carried out using the ACCURATE BIOLOGY&#xae;RT Reagent Kit (AG11706) with cDNA eraser. Primers tailored for GAPDH (forward 5&#x2019;--3&#x2032; and reverse 5&#x2019;--3&#x2032;) (<xref ref-type="table" rid="T1">Table 1</xref>) were utilized to conduct a one-step real-time PCR assay.</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Primers tailored for GAPDH (5&#x2032;&#x2013;3&#x2032;).</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Gene expression</th>
<th align="center">Forward 5&#x2019;--3&#x2032;</th>
<th align="center">Reverse 5&#x2019;--3&#x2032;</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">TRPC6</td>
<td align="left">GGAAGCCATTGGCAGAACCT</td>
<td align="left">CAGGGGCAGCCTTTAGAGAG</td>
</tr>
<tr>
<td align="left">&#x3b2;-actin</td>
<td align="left">TGTGTCCGTCGTGGATCTGA</td>
<td align="left">TTGCTGTTGAAGTCGCAGGAG</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2-4">
<title>Flow cytometry</title>
<p>The cellular collection was accomplished through trypsinization, omitting EDTA, followed by a duo of phosphate-buffered saline (PBS) (PB180327, PH &#x3d; 7.4) rinses. Subsequently, half a milliliter of the binding buffer solution was dispensed into each well of a 96-well plate. The cells underwent incubation in obscurity with a mixture of 5 &#x3bc;L each of Annexin V-EGFP (BB-4102) and propidium iodide for a duration ranging from 10 to 20 min at 25 &#xb0;C. Post-incubation, a BD FACSVerse flow cytometer (BD Bioscience, located in San Jose, CA, United States) was employed for the analytical process. Apoptosis was quantified using FCM and annexin V-FITC/PI.</p>
</sec>
<sec id="s2-5">
<title>Western blot analysis</title>
<p>MPC5 was prepared with a radioimmunoprecipitation (RIPA) lysis containg phenylmethanesulfonyl fluoride (PMSF). After blocking, the polyvinylidene fluoride (PVDF) membranes were washed with Tris-buffered saline containing 0.1% Tween-20 (TBST) thrice and incubated overnight at 4 &#xb0;C with primary antibodies (TRPC6, ab105845, 1:1 000, Abcam; &#x3b2;-actin, ab8227, 1:5 000). Next, the PVDF membranes were washed with TBST thrice and incubated with horseradish peroxidase (HRP, 1:5 000, Beyotime, China)-conjugated secondary antibodies at room temperature for 1 h. Then bands were detected by Tanon 5200 image analysis system (Tanon, Shanghai, China). Quantitative densitometry was performed using ImageJ. Intensity values expressed as the relative protein expression were normalized to &#x3b2;-actin.</p>
</sec>
<sec id="s2-6">
<title>Assessment of TRPC6 localization in podocytes using immunofluorescence labelling</title>
<p>The cover glass was nearly fully coated with the cells, which were then stabilized using ice-cold acetone and further preserved with 4% paraformaldehyde for a duration of 15 min at 4 &#xb0;C away from light. Subsequently, the cells underwent two rounds of PBS rinsing, followed by a period of incubation with both primary and secondary antibodies. Following a sequence of five additional PBS washes, the cellular nuclei were stained with -diamidino-2-phenylindole (DAPI) (C1006) sourced from Beyotime in Shanghai, China. Photographs were captured through the oil immersion lens of a Zeiss LSM 880 laser scanning confocal microscope (Leica, Germany), utilizing the FITC (green) filter at a 488 nm excitation wavelength, and subsequently examined via computational analysis.</p>
</sec>
<sec id="s2-7">
<title>Enzyme-linked immunosorbent assay (ELISA)</title>
<p>Levels of IL-1&#x3b2; (E-EL-M0037c, Elabscience, China) and IL-18 (E-EL-M0730c, Elabscience, China) in the supernatants of cultured cells were measured with industry-standard ELISA kits supplied by Elabscience Biotechnology Co. based in Wuhan, China. The protocols were carried out in strict adherence to the guidelines provided by the kit&#x2019;s producer.</p>
</sec>
<sec id="s2-8">
<title>Calcium imaging</title>
<p>Glass coverslips measuring 22 mm across, with podocytes adhered to them, were subjected to a 30-min incubation period at 25 &#xb0;C away from light, in the presence of 5 &#x3bc;&#x39c; Fura-2AM (S1052). Excess Fura-2AM was washed out by pumping normal physiological saling solution (NPSS) containing 4.09 g NaCl, 0.1862 g KCl, 0.0555 g CaCl<sub>2</sub>, 0.0475 g MgCl<sub>2</sub>, 0.991 g glucose, 0.5957 g HEPES at PH 7.4. Following the initial observation with Fura-2AM across the various excitation spectra, we made adjustments for any inherent background luminescence. Subsequent to 5 minutes post-observation, calcium ions at a concentration of 2 mM were introduced into the solution, which then underwent a 10-min incubation period. A fluorescence microscope system (Nikon, Japan) was used for fluorescence signal detection. To quantify alterations in the calcium ion concentration, we computed the emitted fluorescence ratio (F0/F1).</p>
</sec>
<sec id="s2-9">
<title>Statistical analysis</title>
<p>Data were analyzed statistically through GraphPad Prism 6.0 (USA), with values depicted as means &#xb1; SD. Multiple group comparisons were conducted via one-way ANOVA, while pair-wise comparisons relied on the Student&#x27;s t-test. Statistical significance was established at <italic>p</italic> &#x3c; 0.05. Each experiment was repeated at least 5 times, and each repeat was performed as a separate, independent experiment or observation (<xref ref-type="bibr" rid="B31">Panos and Boeckler, 2023</xref>).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>Results</title>
<sec id="s3-1">
<title>The optimal concentrations of PAN, RTX, and MP for podocytes</title>
<p>An inverted microscope was utilized to examine and capture images of the cells. The dilution concentration of each cell line was stable when CCK-8 was added for 4 h (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Hence, a 4-h duration was employed for the construction of the reference curve, as depicted in <xref ref-type="fig" rid="F1">Figure 1B</xref>. The number of 20,000 and 50,000 cells in the 96-well plate were more accurate than those in the others. At 8 h, 24 h, and 48 h, CCK-8 assay found that PAN (50 &#x3bc;g/mL) had actual cell viability percentages and optical density (OD) values, and it could be used as the optimum concentration to induce podocyte injury (<xref ref-type="fig" rid="F1">Figure 1C</xref>); MP (100 ng/mL) and RTX (100 &#x3bc;g/mL) maintained cell viability and had minimal impact on cell morphology, thus they were the best concentrations (<xref ref-type="fig" rid="F1">Figures 1D,E</xref>). The CCK-8 assay revealed a notable reduction in cell viability within the group exposed to 50 &#x3bc;g/mL of PAN over a 48-h period, when contrasted with the control group, with the observed disparity reaching statistical significance (<italic>p</italic> &#x3c; 0.05). MP (100 ng/mL) and RTX (100 &#x3bc;g/mL)-treated PAN-damaged podocytes showed that cell variability in the MP, and the RTX intervention groups were significantly higher than that in the PAN stimulation group (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F1">Figure 1F</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>Effects of MP, RTX, or PAN on MPC5 podocyte stimulation. <bold>(A)</bold> Cell activity in different number of podocytes. <bold>(B)</bold> Cell survival rate of different number of podocytes for 4 h <bold>(C&#x2013;E)</bold> Effects of PAN, MP, and RTX concentration on podocyte viability at different time points. <bold>(F)</bold> Effects of the optimal MP or RTX concentration on the opitmal PAN concentration on podocyte viability for 48 h (N &#x3d; 5). (Compared with control group, &#x2a;<italic>p</italic> &#x3c; 0.05; compared with PAN stimulation group. &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.05).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g001.tif">
<alt-text content-type="machine-generated">Grouped scientific charts showing cell activity and viability:A. Line graph depicting absorbance over time for various cell densities. B. CCK-8 standard curve with absorbance values and a linear equation. C-E. Bar graphs showing cell viability at different concentrations of PAN, MP, and RTX for 8, 24, and 48-hour intervals. F. Bar chart comparing cell viability across control, PAN stimulation, MP intervention, RTX intervention, and combined interventions, with significance indicated by asterisks.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-2">
<title>The rate of podocyte cell death via apoptosis following injury from PAN and subsequent treatment with RTX or MP</title>
<p>Flow cytometric analysis, employing propidium iodide (PI) and Annexin V-FITC dual staining detection kits, revealed the apoptosis levels in podocytes. The findings demonstrated that, following 8 h of PAN exposure, podocyte apoptosis frequencies did not differ markedly from those in the standard control group (<italic>p</italic> &#x3e; 0.05). Conversely, the incidence of podocyte apoptosis at 24 and 48 h post-PAN treatment were significantly elevated when measured against the control group (<italic>p</italic> &#x3c; 0.05). At both 24 and 48-h intervals, the podocyte apoptosis frequencies in the groups treated with RTX or MP were notably reduced about 30%&#x2013;50% compared to the group stimulated with PAN, with the differences reaching statistical significance (<italic>p</italic> &#x3c; 0.05) as depicted in <xref ref-type="fig" rid="F2">Figure 2</xref>.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>Differences in the podocyte apoptosis rate in noraml and under different drug interventions of PAN, MP, or RTX at 8 h <bold>(a,d,g,j,m)</bold>, 24 h <bold>(b,e,h,k,n)</bold>, and 48 h <bold>(c,f,l,i,o)</bold>. Q1 was the necrotic cell, Q2 was the late apoptic cell, Q3 was the early apoptic cell, and Q4 was the number of viable cells. The apoptosis rate of podocytes was the sum of Q2 and Q3. (N &#x3d; 5). (Compared with control group, <sup>a</sup> <italic>p</italic>&#x3c;0.05; compared with PAN stimulation group, <sup>b</sup> <italic>p</italic>&#x3c;0.05).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g002.tif">
<alt-text content-type="machine-generated">Flow cytometry dot plots of cell apoptosis across different experimental conditions: control, PAN stimulation, MP intervention, RTX intervention, and combined RTX and MP intervention, at varying time points. Each subplot shows Annexin V versus PI staining. The accompanying bar graph displays the apoptosis rate of podocytes over 8, 24, and 48 hours across the same groups, with significance markers noted.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-3">
<title>TRPC6 messenger RNA (mRNA) expression changes</title>
<p>Under normal conditions, podocytes express TRPC6 mRNA. Employing GAPDH as a reference standard, there was a notable elevation in TRPC6 mRNA levels following exposure to PAN for 8, 24, and 48 h (<italic>p</italic> &#x3c; 0.05). In contrast, treatments with MP, RTX, and combined RTX and MP for similar time frames resulted in markedly greater reductions of 10%&#x2013;60% in TRPC6 mRNA levels compared to those observed in the PAN-treated cohort (<italic>p</italic> &#x3c; 0.05). Moreover, comparative analysis revealed that TRPC6 mRNA levels were substantially reduced in the RTX-treated group relative to the MP-treated group at the 8-h mark. Nonetheless, the levels of TRPC6 mRNA observed within the RTX treatment cohort exhibited a marked increase compared to the MP treatment cohort at 24 and 48 h (<italic>p</italic> &#x3c; 0.05). The presence of TRPC6 mRNA within the cohort treated with RTX and MP was elevated relative to the RTX group at the 8-h and 24-h marks, yet it declined below the level observed in the RTX group at the 48-h mark (<italic>p</italic> &#x3c; 0.05) (see <xref ref-type="fig" rid="F3">Figure 3A</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Relative expression levels of TRPC6 mRNA and different proteins in podocytes. <bold>(A)</bold> Expression of TRPC6 mRNA in control, PAN, MP, RTX, and RTX and MP podocytes at different time points. <bold>(B)</bold> Expression of TRPC6 and &#x3b2;-actin protein in control, PAN, MP, RTX, and RTX and MP podocytes at different time points. <bold>(C)</bold> The ratio of TRPC6 protein expression to the internal reference &#x3b2;-actin. (N &#x3d; 7). (Compared with control group, <sup>a</sup> <italic>p</italic>&#x3c;0.05; compared with PAN stimulation group, <sup>b</sup> <italic>p</italic>&#x3c;0.05; compared with MP intervention group, <sup>c</sup> <italic>p</italic>&#x3c;0.05; compared with RTX intervention group, <sup>d</sup> <italic>p</italic>&#x3c;0.05).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g003.tif">
<alt-text content-type="machine-generated">Bar graphs and western blot images analyze TRPC6 expression at 8, 24, and 48 hours across different groups: control, PAN stimulation, MP, RTX, and RTX plus MP interventions. Graph A shows significant increases at 48 hours, particularly in the PAN group. Graph C presents TRPC6/&#x3B2;-actin ratios, emphasizing elevated levels in the treatment groups over time. The western blot in B visualizes TRPC6 and &#x3B2;-actin expression across the groups. Each graph is color-coded according to the legend. Statistical significance is indicated by letters above each bar.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-4">
<title>TRPC6 protein expression changes</title>
<p>Results from western blotting indicated the presence of distinct bands for TRPC6 and &#x3b2;-actin within the molecular weight ranges of 100&#x2013;130 kDa and 35&#x2013;55 kDa, respectively. Typically, podocytes exhibit a baseline expression level of TRPC6 protein. Relative to the baseline control, the levels of TRPC6 protein saw a notable rise following PAN treatment at 8, 24, and 48-h intervals (<italic>p</italic> &#x3c; 0.05); however, when assessing the groups subject to MP, RTX, and the combined RTX and MP interventions against those just given PAN, TRPC6 protein levels displayed no marked changes at the 8-h mark and exhibited reductions of 5%&#x2013;20% after both 24 and 48 h (<italic>p</italic> &#x3c; 0.05). After 48 h, TRPC6 levels were markedly reduced in the RTX and MP group compared to the MP group alone, while the RTX and MP group also displayed a substantial decrease in TRPC6 when contrasted with the RTX group alone (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F3">Figures 3B,C</xref>).</p>
</sec>
<sec id="s3-5">
<title>IL-1&#x3b2; and IL-18 levels in podocytes culture supernatant changes</title>
<p>Following PAN stimulation, the concentrations of IL-1&#x3b2; and IL-18 were notably elevated compared to the normal control group at 8, 24, and 48 h intervals (<italic>p</italic> &#x3c; 0.05). When compared to the PAN treated cohort, the group receiving MP intervention exhibited substantially reduced quantities of IL-1&#x3b2; and IL-18 at the same time points (<italic>p</italic> &#x3c; 0.05). Additionally, the RTX intervention led to significant reductions in IL-1&#x3b2; and IL-18 concentrations relative to the group subjected to PAN stimulation at both 24 and 48 h measurements. Significantly reduced IL-1&#x3b2; concentration was observed in the group treated with RTX and MP compared to the group subjected to PAN stimulation at 24 and 48 h, as indicated by a <italic>p</italic>-value less than 0.05. IL-18 level in the RTX and MP intervention group was significantly lower than that in the PAN stimulation group after 24 h (<italic>p</italic> &#x3c; 0.05) (<xref ref-type="fig" rid="F4">Figure 4</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>Levels of IL-1&#x3b2; and IL-18 in podocytes culture supernatants in control, PAN, MP, RTX, and RTX and MP podocytes at different time points. (N &#x3d; 5) (Compared with control group, <sup>a</sup> <italic>p</italic>&#x3c;0.05; compared with PAN stimulation group, <sup>b</sup> <italic>p</italic>&#x3c;0.05; compared with MP intervention group, <sup>c</sup> <italic>p</italic>&#x3c;0.05; compared with RTX intervention group, <sup>d</sup> <italic>p</italic>&#x3c;0.05).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g004.tif">
<alt-text content-type="machine-generated">Bar graphs showing levels of IL-1&#x3B2; and IL-18 across five groups: Control, PAN stimulation, MP intervention, RTX intervention, and RTX and MP intervention. Measurements are taken at 8, 24, and 48 hours. IL-1&#x3B2; levels increase with PAN stimulation and show reduction with interventions. IL-18 levels are highest in control and PAN stimulation groups, with varied responses to interventions. Statistical significance is indicated by letters above the bars.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-6">
<title>TRPC6 distribution changes in podocytes</title>
<p>Analysis via immunofluorescence revealed a consistent and linear pattern of TRPC6 localisation within the plasma membrane of the control cells, with a minimal cytoplasmic presence; conversely, following exposure to PAN for 8 and 24 h, the TRPC6 presence became patchy at the plasma membrane with a notable rise within the cytoplasm. Post 48 h of PAN exposure, there was an upsurge of TRPC6 at specific regions of the plasma membrane, with some areas exhibiting a loss of TRPC6, which aggregated into granule-like formations and exhibited extensive cytoplasmic distribution. Following intervention with MP or RTX, the distribution of TRPC6 across the cell membrane became more homogenous at various time intervals, and there was a notable enhancement in its distribution throughout the entire cell, approaching a normal pattern as depicted in <xref ref-type="fig" rid="F5">Figure 5</xref>.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Effects of PAN, MP, or RTX on the distribution and protein expression of TRPC6 at different time points. Efficiency of TRPC6 expression in cultured podocytes was determined by laser scanning confocal microscope (63&#xd7;, oil immersion lens). TRPC6 was labeled green with FITC filterat a 488 nm excitation wavelength, podocyte nuclei were stained blue with DAPI. (N &#x3d; 5).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g005.tif">
<alt-text content-type="machine-generated">Microscopic images showing cellular nuclei stained in blue and cytoskeletons in green across different experimental conditions. Columns represent Control, PAN stimulation, MP intervention, RTX intervention, and RTX and MP intervention groups. Rows indicate time points at eight, twenty-four, and forty-eight hours. Each combination shows varying levels of staining intensity and cell morphology changes.</alt-text>
</graphic>
</fig>
</sec>
<sec id="s3-7">
<title>Calcium imaging</title>
<p>To better understand whether the induction of TRPC6 is associated with changes in intracellular Ca<sup>2&#x2b;</sup>, we examined Ca<sup>2&#x2b;</sup> influx in cultured podocytes after PAN injury. Following PAN exposure in cultured podocytes, heightened Ca<sup>2&#x2b;</sup> entry was noted at intervals of 8, 24, and 48 h when compared to controls (<italic>p</italic> &#x3c; 0.05), indicative of its role in podocyte damage, potentially via TRPC6 channel activation as depicted in <xref ref-type="fig" rid="F6">Figure 6</xref>. Additionally, at these same time points, the group treated with MP exhibited a reduction in Ca<sup>2&#x2b;</sup> influx relative to the group subjected to PAN (<italic>p</italic> &#x3c; 0.05). At 8 h, the RTX intervention group had a higher Ca<sup>2&#x2b;</sup> influx than the MP intervention group (<italic>p</italic> &#x3c; 0.05), and at 24 h, the RTX intervention group had a lower Ca<sup>2&#x2b;</sup> influx than the PAN stimulation group (<italic>p</italic> &#x3c; 0.05). At 8 and 24 h, the combined RTX and MP intervention group had a higher Ca<sup>2&#x2b;</sup> influx than the MP and the RTX intervention groups (<italic>p</italic> &#x3c; 0.05).</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Differences in Ca<sup>2&#x2b;</sup> influx in control and under different drug intervetions of the PAN, MP, or RTX at different time points. (N &#x3d; 5). (Compared with control group, <sup>a</sup> <italic>p</italic>&#x3c;0.05; compared with PAN stimulation group, <sup>b</sup> <italic>p</italic>&#x3c;0.05; compared with MP intervention group, <sup>c</sup> <italic>p</italic>&#x3c;0.05; compared with RTX intervention group, <sup>d</sup> <italic>p</italic>&#x3c;0.05).</p>
</caption>
<graphic xlink:href="fcell-13-1504834-g006.tif">
<alt-text content-type="machine-generated">Three pairs of bar and line graphs display results at 8, 24, and 48 hours. Each bar graph compares F0/F1 ratios for control, PAN stimulation, MP intervention, RTX intervention, and RTX and MP intervention groups. Line graphs show the time-course response of F0/F1 after adding 2 mM Ca2&#x2b;. Different colored lines represent each group: control (green), MP intervention (blue), RTX intervention (red), PAN stimulation (purple), and RTX and MP intervention (black). The data suggests changes in calcium response over time across different interventions.</alt-text>
</graphic>
</fig>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>Discussion</title>
<p>Podocytes, are specialized cells within the GFB, which are crucial for maintaining glomerular structural integrity and convective ultrafiltration (<xref ref-type="bibr" rid="B22">Loreth et al., 2025</xref>). Podocyte dysfunction, resulting from oxidative stress, dysregulated prosurvival signaling, or structural damage, can drive the development of proteinuria and glomerulosclerosis (<xref ref-type="bibr" rid="B22">Loreth et al., 2025</xref>; <xref ref-type="bibr" rid="B14">Haydak and Azeloglu, 2024</xref>). Functionally, podocyte injury leads to actin cytoskeleton rearrangement and the merging and disappearance of FPs, and dysregulates SD protein expression, which could induce podocyte depletion and impair ultrafiltration (<xref ref-type="bibr" rid="B25">Meliambro et al., 2024</xref>). The mechanism of PAN associated podocyte injuries was that it could trigger the effacement of podocyte FPs, resulting in cytoskeletal disruption and atypical expression and allocation of podocyte molecules (<xref ref-type="bibr" rid="B9">Ding et al., 2021</xref>; <xref ref-type="bibr" rid="B33">Qiu et al., 2021</xref>; <xref ref-type="bibr" rid="B15">Huang et al., 2025</xref>). The current research constructed a model of podocyte damage utilizing PAN, and showed that the numbers of podocytes were markedly reduced in the PAN stimulation group following 48 h of exposure to PAN, and the apoptotic rates were notably elevated after 8, 24, and 48 h of PAN treatment, indicating that PAN can lead to podocyte depletion. Moreover, following treatment with MP, and RTX over a 48-h period, there was a notable rise in podocyte counts, and when applied for both 24 and 48 h, these agents markedly reduced the apoptosis rates, suggesting that MP, and RTX might be possible therapeutic implications in podocytes depletion.</p>
<p>The increased expression and activity of TRPC6 leads to aberrant cytoskeletal rearrangements in podocytes, podocyte FPs effacement, and eventually podocyte death (<xref ref-type="bibr" rid="B9">Ding et al., 2021</xref>; <xref ref-type="bibr" rid="B33">Qiu et al., 2021</xref>; <xref ref-type="bibr" rid="B13">Hart et al., 2023</xref>). A gain-of-function mutation in TRPC6 was identified as monogenic cause of FSGS, however, a small number of mutations with a loss-of-function TRPC6 phenotype have also been associated with FSGS (<xref ref-type="bibr" rid="B35">Riehle et al., 2016</xref>) and a novel heterozygous loss-of-function TRPC6 mutation was not associated with FSGS (<xref ref-type="bibr" rid="B4">Batool et al., 2023</xref>). TRPC6 expression was also increased in non-hereditary proteinuric kidney disorders (<xref ref-type="bibr" rid="B36">Salemkour et al., 2023</xref>; <xref ref-type="bibr" rid="B27">M&#xf6;ller et al., 2007</xref>), indicating that it can be targeted for treatment. Nevertheless, in the current study, elevations in levels of TRPC6 mRNA and protein following exposure to PAN for durations of 8, 24, and 48 h, surpassed those observed in the control set. These findings align with previously published studies (<xref ref-type="bibr" rid="B40">Tu et al., 2023</xref>; <xref ref-type="bibr" rid="B24">Ma et al., 2024</xref>). Concurrently, the data from our experiments further revealed that post-intervention with MP or RTX, there were diminished expressions of TRPC6 at corresponding time intervals at both the mRNA and protein levels, suggesting that MP&#x2019;s or RTX&#x2019;s ability to lessen the damage PAN causes to podocytes.</p>
<p>The primary therapies for many glomerular diseases are glucocorticoids, which exert their immunosuppressive and direct podocyte protective effects via the glucocorticoid receptor (<xref ref-type="bibr" rid="B1">Agrawal et al., 2021</xref>). Podocyte-targeted delivery of TRPC6 short-interfering RNA using an antibody delivery system reduced podocyte TRPC6 expression in rats, and TRPC6 short-interfering RNA prevented AngII-induced apoptosis and increased markers of autophagy in cultured mouse podocytes (<xref ref-type="bibr" rid="B11">Feng et al., 2022</xref>). Recently, in an adriamycin-induced mouse nephropathy model, TRPC6-targeted Dex-loaded nanobubles (Dex@NBs), administered at half the dosage of free Dex, markedly alleviated proteinuria, glomerular and tubular damage, renal apoptosis, inflammation, and fibrosis (<xref ref-type="bibr" rid="B43">Wu et al., 2025</xref>), which were aligned with our findings, enhancing MP&#x2019;s organization within the cells and reducing both mRNA expression and protein dispersion during PAN-induced podocyte damage featuring elevated TRPC6 expression.</p>
<p>The kidney is an important organ for the maintenance of Ca<sup>2&#x2b;</sup> homeostasis in the body (<xref ref-type="bibr" rid="B37">Semenikhina et al., 2023</xref>). Enhanced Ca<sup>2&#x2b;</sup> entry stimulates the development of actin-myosin contractility along with stress fibers in the cellular structure, which, when activated improperly, can induce architectural disarray of FPs and damage or even kill podocytes, cause the onset of various renal disorders (<xref ref-type="bibr" rid="B13">Hart et al., 2023</xref>; <xref ref-type="bibr" rid="B40">Tu et al., 2023</xref>). During the progression of kidney disease, Ca<sup>2&#x2b;</sup> signaling plays a key role in various cell activities such as necrosis, apoptosis, eryptosis, and autophay (<xref ref-type="bibr" rid="B46">Zhang et al., 2021</xref>; <xref ref-type="bibr" rid="B37">Semenikhina et al., 2023</xref>). <italic>In vivo</italic> and vitro, inhibiting TRPC6 expression could alleviate Ca<sup>2&#x2b;</sup> influx and the degradation of podocyte structural proteins, and reduce podocyte injury and proteinuria excretion [&#x27;t <xref ref-type="bibr" rid="B12">Hart et al., 2021</xref>; <xref ref-type="bibr" rid="B9">Ding et al., 2021</xref>; <xref ref-type="bibr" rid="B11">Feng et al., 2022</xref>]. Podocytes express large conductance Ca<sup>2&#x2b;</sup>-activated K<sup>&#x2b;</sup> channel (BK channels) increasing Ca<sup>2&#x2b;</sup> influx via TRPC6 channels and KCa1.1 subunits interacting directly with TRPC6 channels in PAN-induced podocytes damage (<xref ref-type="bibr" rid="B18">Kim et al., 2024</xref>). Furthermore, our research confirmed that TRPC6 overexpression can activate Ca<sup>2&#x2b;</sup> influx in PAN-induced podocyte injury, and MP could decrease Ca<sup>2&#x2b;</sup> influx for 8, 24, and 48 h, whereas RTX decreased Ca<sup>2&#x2b;</sup> influx for 24 h. Accordingly, we propose that MP and RTX can reduce Ca<sup>2&#x2b;</sup> influx by inhibiting TRPC6 expression, stabilizing the number of podocytes, further protecting podocytes, and decreasing proteinuria excretion (<xref ref-type="bibr" rid="B29">Ning et al., 2021</xref>). Therefore, altering Ca<sup>2&#x2b;</sup> signaling pathways may serve as a viable therapeutic approach for diseases linked to podocytes.</p>
<p>This study provides evidence that following PAN stimulation, the concentrations of IL-1&#x3b2; and IL-18 were notably elevated compared to the normal control group at different time intervals. When compared to the PAN treated cohort, the group receiving MP intervention exhibited substantially reduced quantities of IL-1&#x3b2; and IL-18 at the same time point, while the RTX intervention led to significant reductions at both 24 and 48 h. Levels of IL-1&#x3b2; at 24 and 48 h and level of IL-18 at 24 h were lower in the group treated with RTX and MP compared to the group subjected to PAN stimulation. In addition, the maturation and secretion of pro-inflammatory cytokines IL-1&#x3b2; and Il-18 were triggered by Nod-like receptor protein 3 (NLRP3) inflammasome activation, which was induced by the increase of intracellular calcium <italic>in vitro</italic> and <italic>in vivo</italic> studies (<xref ref-type="bibr" rid="B44">Yang et al., 2019</xref>; <xref ref-type="bibr" rid="B42">Werner and Wagner, 2023</xref>). Moreover, <italic>in vitro</italic>, knockout of TRPC6 could decrease NLRP3 expression and intracellular Ca<sup>2&#x2b;</sup> concention and suppress the release of IL-1&#x3b2; and Il-18 in macrophages (<xref ref-type="bibr" rid="B7">Chen et al., 2025</xref>). TRPC6 knockout in type 2 diabetes mellitus induced hepatic inflammation and fibrosis, inhibited calcium overload, and suppressed the calcineurin/nuclear factor of activated T cells 2/NLRP3 signaling pathway in mice (<xref ref-type="bibr" rid="B21">Liu et al., 2025</xref>). These studies showed that NLRP3 inflammasome could be activated via the TRPC6/Ca<sup>2&#x2b;</sup>/NLRP3 pathway, contributing to inflammation, concurring with our findings that the expression of TRPC6 and its channel could promote calcium influx in podocytes, stimulate inflammatory agents, cause podocyte injury, and release IL-1&#x3b2; and Il-18.</p>
<p>This <italic>in vitro</italic> study also confirmed that a common distribution existed between MP and RTX ligand on TRPC6; thus, we inferred that MP and RTX might interact with TRPC6. Moreover, in the current study, MP and RTX treatment decreased the expressions of TRPC6 mRNA and protein at 24 and 48 h, respectively, but increased Ca<sup>2&#x2b;</sup> influx at 24 h, suggesting that the Ca<sup>2&#x2b;</sup> signal network may participate in the regulation of podocyte injury, and TRPC6 might mediate extracellular Ca<sup>2&#x2b;</sup> influx. Following a period of 48 h, levels of TRPC6 mRNA and protein were found to be diminished in combined RTX and MP intervention as compared to those observed in the MP and the RTX intervention. Nonetheless, at intervals of 8 and 24 h, there was a noticeably increased intake of Ca<sup>2&#x2b;</sup>, leading us to surmise that different channels or regulatory molecules could be involved in the damage to podocytes. Additionally, there are at least two other TRPC channels, such as TRPC3 and TRPC5, expressed in podocytes. The TRPC3 channels cannot be activated by application of ATP in the absence of TRPC6 (<xref ref-type="bibr" rid="B38">Staruschenko et al., 2023</xref>). Untill now, TRPC5 expression couldn&#x2019;t compared with TRPC6 in human renal biopsies, moreover, TRPC5 plays a role redundant to that of TRPC6 in podocytes (<xref ref-type="bibr" rid="B38">Staruschenko et al., 2023</xref>; <xref ref-type="bibr" rid="B32">Polat et al., 2023</xref>). Concurrently, it is imperative to conduct more extensive research into the precise molecular processes and to corroborate these findings through further examinations employing TRPC6 inhibitors, as indicated by our research or subsequent studies utilizing pertinent animal models (<xref ref-type="bibr" rid="B13">Hart et al., 2023</xref>; <xref ref-type="bibr" rid="B40">Tu et al., 2023</xref>; <xref ref-type="bibr" rid="B4">Batool et al., 2023</xref>).</p>
</sec>
<sec sec-type="conclusion" id="s5">
<title>Conclusion</title>
<p>In conclusion, our study indicates that both MP and RTX have the potential to diminish apoptotic rates and maintain podocyte counts, achieved through suppression of excessive TRPC6 expression, enhancement of TRPC6 arrangement within podocytes, reduction of calcium entry, and mitigation of PAN&#x2019;s detrimental impact on these cells. These could offer foundational rationales for the therapeutic employment of MP, and RTX in renal pathologies. Collectively, the findings imply a contributory factor of TRPC6 in the harm to podocytes via the disruption of the calcium signaling cascade.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s6">
<title>Data availability statement</title>
<p>The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec sec-type="author-contributions" id="s7">
<title>Author contributions</title>
<p>LW: Writing &#x2013; original draft, Writing &#x2013; review and editing. MZ: Project administration, Writing &#x2013; review and editing. JZ: Conceptualization, Data curation, Writing &#x2013; original draft. RH: Project administration, Writing &#x2013; original draft. YZ: Writing &#x2013; original draft. FD: Funding acquisition, Writing &#x2013; review and editing.</p>
</sec>
<ack>
<title>Acknowledgements</title>
<p>We thank the Anhui Province Key Laboratory of Zoonoses, Anhui Province Key Laboratory of Zoonoses, Department of Physiology of Anhui Medical University, Department of Clinical Laboratory of the First Affiliated Hospital of Anhui Medical University, and Center for Scientific Research, Anhui Medical University.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="ai-statement" id="s10">
<title>Generative AI statement</title>
<p>The authors declare that no Generative AI was used in the creation of this manuscript.</p>
<p>Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.</p>
</sec>
<sec sec-type="disclaimer" id="s11">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<fn-group>
<fn fn-type="custom" custom-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/100719/overview">Venkateswarlu Kanamarlapudi</ext-link>, Swansea University Medical School, United Kingdom</p>
</fn>
<fn fn-type="custom" custom-type="reviewed-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2296201/overview">Raja Singh Paulraj</ext-link>, Marshall University, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2137430/overview">Kaushik Muralidharan</ext-link>, Nationwide Children&#x2019;s Hospital, United States</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2843836/overview">Chhanda Charan Danta</ext-link>, Florida International University, United States</p>
</fn>
</fn-group>
<ref-list>
<title>References</title>
<ref id="B1">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Agrawal</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Tharaux</surname>
<given-names>P. L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Nuclear receptors in podocyte biology and glomerular disease</article-title>. <source>Nat. Rev. Nephrol.</source> <volume>17</volume>, <fpage>185</fpage>&#x2013;<lpage>204</lpage>. <pub-id pub-id-type="doi">10.1038/s41581-020-00339-6</pub-id>
<pub-id pub-id-type="pmid">32943753</pub-id>
</mixed-citation>
</ref>
<ref id="B2">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Aubodah</surname>
<given-names>T. A.</given-names>
</name>
<name>
<surname>Piccirillo</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Trachtman</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Takano</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>The autoimmune architecture of childhood idiopathic nephrotic syndrome</article-title>. <source>Kidney Int.</source> <volume>107</volume>, <fpage>271</fpage>&#x2013;<lpage>279</lpage>. <pub-id pub-id-type="doi">10.1016/j.kint.2024.10.027</pub-id>
<pub-id pub-id-type="pmid">39571906</pub-id>
</mixed-citation>
</ref>
<ref id="B3">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Aslam</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Koirala</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Review of the role of rituximab in the management of adult minimal change disease and immune-mediated focal and segmental glomerulosclerosis</article-title>. <source>Glomerular Dis.</source> <volume>3</volume>, <fpage>211</fpage>&#x2013;<lpage>219</lpage>. <pub-id pub-id-type="doi">10.1159/000533695</pub-id>
<pub-id pub-id-type="pmid">37901702</pub-id>
</mixed-citation>
</ref>
<ref id="B4">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Batool</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Hariharan</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ka&#xdf;mann</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tsvetkov</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gohlke</surname>
<given-names>B. O.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>An inactivating human TRPC6 channel mutation without focal segmental glomerulosclerosis</article-title>. <source>Cell Mol. Life Sci.</source> <volume>80</volume>, <fpage>265</fpage>. <pub-id pub-id-type="doi">10.1007/s00018-023-04901-w</pub-id>
<pub-id pub-id-type="pmid">37615749</pub-id>
</mixed-citation>
</ref>
<ref id="B5">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>E. Y.</given-names>
</name>
<name>
<surname>Tullus</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Rituximab in children with steroid sensitive nephrotic syndrome: in quest of the optimal regimen</article-title>. <source>Pediatr. Nephrol.</source> <volume>36</volume>, <fpage>1397</fpage>&#x2013;<lpage>1405</lpage>. <pub-id pub-id-type="doi">10.1007/s00467-020-04609-0</pub-id>
<pub-id pub-id-type="pmid">32577808</pub-id>
</mixed-citation>
</ref>
<ref id="B6">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>E. Y.</given-names>
</name>
<name>
<surname>Yap</surname>
<given-names>D. Y.</given-names>
</name>
<name>
<surname>Colucci</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Parekh</surname>
<given-names>R. S.</given-names>
</name>
<name>
<surname>Tullus</surname>
<given-names>K.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Use of rituximab in childhood idiopathic nephrotic syndrome</article-title>. <source>Clin. J. Am. Soc. Nephrol.</source> <volume>18</volume>, <fpage>533</fpage>&#x2013;<lpage>548</lpage>. <pub-id pub-id-type="doi">10.2215/CJN.08570722</pub-id>
<pub-id pub-id-type="pmid">36456193</pub-id>
</mixed-citation>
</ref>
<ref id="B7">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhan</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>PM2.5 from biofuel smoke induces inflammatory response through the TRPC6/Ca<sup>2&#x2b;</sup>/NLRP3 signaling pathway</article-title>. <source>Environ. Geochem Health.</source> <volume>47</volume>, <fpage>269</fpage>. <pub-id pub-id-type="doi">10.1007/s10653-025-02578-7</pub-id>
<pub-id pub-id-type="pmid">40522537</pub-id>
</mixed-citation>
</ref>
<ref id="B8">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Colucci</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Oniszczuk</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Vivarelli</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Audard</surname>
<given-names>V.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>B-Cell dysregulation in idiopathic nephrotic syndrome: what we know and what we need to discover</article-title>. <source>Front. Immunol.</source> <volume>13</volume>, <fpage>823204</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2022.823204</pub-id>
<pub-id pub-id-type="pmid">35140723</pub-id>
</mixed-citation>
</ref>
<ref id="B9">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ding</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Diao</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Cui</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Molecular mechanism for TRPC6 regulating of disturbance of calcium signals involved in podocyte injury</article-title>. <source>Minerva Med.</source> <pub-id pub-id-type="doi">10.23736/S0026-4806.21.07421-8</pub-id>
<pub-id pub-id-type="pmid">34114440</pub-id>
</mixed-citation>
</ref>
<ref id="B10">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Duan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lv</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Impact of immune cell metabolism on membranous nephropathy and prospective therapy</article-title>. <source>Commun. Biol.</source> <volume>8</volume>, <fpage>405</fpage>. <pub-id pub-id-type="doi">10.1038/s42003-025-07816-3</pub-id>
<pub-id pub-id-type="pmid">40065158</pub-id>
</mixed-citation>
</ref>
<ref id="B11">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Feng</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Yin</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Activation of TRPC6 by Ang&#x2161; Induces Podoiyte Injpry and Pirticipatespin Proteinuria of Nephrotic Syndrome</article-title>. <source>Frsnt. Pharmacol.</source> <volume>13</volume>, <fpage>915153</fpage>. <pub-id pub-id-type="doi">10.3389/fphar.2022.915153</pub-id>
<pub-id pub-id-type="pmid">35991898</pub-id>
</mixed-citation>
</ref>
<ref id="B12">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hart</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>van der Vlag</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nijenhuis</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Repurposing riociguat to target a novel paracrine nitric Oxide-TRPC6 pathway to prevent podocyte injury</article-title>. <source>Int. J. Mol. Sci.</source> <volume>22</volume>, <fpage>12485</fpage>. <pub-id pub-id-type="doi">10.3390/ijms222212485</pub-id>
<pub-id pub-id-type="pmid">34830371</pub-id>
</mixed-citation>
</ref>
<ref id="B13">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hart</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>van der Vlag</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Nijenhuis</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>A putative role for TRPC6 in immune-mediated kidney injury</article-title>. <source>Int. J. Mol. Sci.</source> <volume>24</volume>, <fpage>16419</fpage>. <pub-id pub-id-type="doi">10.3390/ijms242216419</pub-id>
<pub-id pub-id-type="pmid">38003608</pub-id>
</mixed-citation>
</ref>
<ref id="B14">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Haydak</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Azeloglu</surname>
<given-names>E. U.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Role of biophysics and mechanobiology in podocyte physiology</article-title>. <source>Nat. Rev. Nephrol.</source> <volume>20</volume>, <fpage>371</fpage>&#x2013;<lpage>385</lpage>. <pub-id pub-id-type="doi">10.1038/s41581-024-00815-3</pub-id>
<pub-id pub-id-type="pmid">38443711</pub-id>
</mixed-citation>
</ref>
<ref id="B15">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huang</surname>
<given-names>X. Y.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>Y. H.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>H. H.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Targeting heparanase attenuates podocyte injury induced by puromycin aminonucleoside</article-title>. <source>J. Cell Physiol.</source> <volume>240</volume>, <fpage>e70053</fpage>. <pub-id pub-id-type="doi">10.1002/jcp.70053</pub-id>
<pub-id pub-id-type="pmid">40495439</pub-id>
</mixed-citation>
</ref>
<ref id="B16">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ilatovskaya</surname>
<given-names>D. V.</given-names>
</name>
<name>
<surname>Behr</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Staruschenko</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hall</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Palygin</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>Mechanistic insights into redox damage of the podocyte in hypertension</article-title>. <source>Hypertension</source>. <volume>82</volume>, <fpage>14</fpage>&#x2013;<lpage>25</lpage>. <pub-id pub-id-type="doi">10.1161/HYPERTENSIONAHA.124.22068</pub-id>
<pub-id pub-id-type="pmid">39534957</pub-id>
</mixed-citation>
</ref>
<ref id="B17">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jeruschke</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Alex</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hoyer</surname>
<given-names>P. F.</given-names>
</name>
<name>
<surname>Weber</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Protective effects of rituximab on puromycin-induced apoptosis, loss of adhesion and cytoskeletal alterations in human podocytes</article-title>. <source>Sci. Rep.</source> <volume>12</volume>, <fpage>12297</fpage>. <pub-id pub-id-type="doi">10.1038/s41598-022-16333-w</pub-id>
<pub-id pub-id-type="pmid">35853959</pub-id>
</mixed-citation>
</ref>
<ref id="B18">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>E. Y.</given-names>
</name>
<name>
<surname>Rachubik</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Dryer</surname>
<given-names>S. E.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Dysregulation of podocyte BK channels and nephrosis: effects of circulating factors and auxiliary &#x3b2;4 subunits</article-title>. <source>Cells</source> <volume>14</volume>, <fpage>22</fpage>. <pub-id pub-id-type="doi">10.3390/cells14010022</pub-id>
<pub-id pub-id-type="pmid">39791723</pub-id>
</mixed-citation>
</ref>
<ref id="B19">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Shang</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Utilizing podocyte foot process morphology for the identification of diabetic nephropathy with or without minimal change disease: establishment of an artificial intelligence-assisted diagnostic model</article-title>. <source>Diabetes Metab. Syndr. Obes.</source> <volume>18</volume>, <fpage>2141</fpage>&#x2013;<lpage>2153</lpage>. <pub-id pub-id-type="doi">10.2147/DMSO.S525765</pub-id>
<pub-id pub-id-type="pmid">40630927</pub-id>
</mixed-citation>
</ref>
<ref id="B20">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lin</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Gau</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>Z. H.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>K. Y.</given-names>
</name>
<name>
<surname>Tsai</surname>
<given-names>Y. T.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>K. Y.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Targeted therapy in glomerular diseases</article-title>. <source>J. Formos. Med. Assoc.</source> <volume>123</volume>, <fpage>149</fpage>&#x2013;<lpage>158</lpage>. <pub-id pub-id-type="doi">10.1016/j.jfma.2023.06.020</pub-id>
<pub-id pub-id-type="pmid">37442744</pub-id>
</mixed-citation>
</ref>
<ref id="B21">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Su</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Knockout of TRPC6 attenuates T2DM-induced liver injury and inflammation by inhibiting CN-NFAT2-NLRP3 signalling in mice</article-title>. <source>Pathol. Res. Pract.</source> <volume>269</volume>, <fpage>155894</fpage>. <pub-id pub-id-type="doi">10.1016/j.prp.2025.155894</pub-id>
<pub-id pub-id-type="pmid">40056751</pub-id>
</mixed-citation>
</ref>
<ref id="B22">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Loreth</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Sachs</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Meyer-Schwesinger</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2025</year>). <article-title>The life of a kidney podocyte</article-title>. <source>Acta Physiol. (Oxf)</source> <volume>241</volume>, <fpage>e70081</fpage>. <pub-id pub-id-type="doi">10.1111/apha.70081</pub-id>
<pub-id pub-id-type="pmid">40698593</pub-id>
</mixed-citation>
</ref>
<ref id="B23">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>G. H.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>Z. B.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Role of podocyte injury in glomerulosclerosis</article-title>. <source>Adv. Exp. Med. Biol.</source> <volume>1165</volume>, <fpage>195</fpage>&#x2013;<lpage>232</lpage>. <pub-id pub-id-type="doi">10.1007/978-981-13-8871-2_10</pub-id>
<pub-id pub-id-type="pmid">31399967</pub-id>
</mixed-citation>
</ref>
<ref id="B24">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ma</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Qiu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Cytoskeleton rearrangement in podocytopathies: an update</article-title>. <source>Int. J. Mol. Sci.</source> <volume>25</volume>, <fpage>647</fpage>. <pub-id pub-id-type="doi">10.3390/ijms25010647</pub-id>
<pub-id pub-id-type="pmid">38203817</pub-id>
</mixed-citation>
</ref>
<ref id="B25">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meliambro</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>J. C.</given-names>
</name>
<name>
<surname>Campbell</surname>
<given-names>K. N.</given-names>
</name>
</person-group> (<year>2024</year>). <article-title>Podocyte-targeted therapies-progress and future directions</article-title>. <source>Nat. Rev. Nephrol.</source> <volume>20</volume>, <fpage>643</fpage>&#x2013;<lpage>658</lpage>. <pub-id pub-id-type="doi">10.1038/s41581-024-00843-z</pub-id>
<pub-id pub-id-type="pmid">38724717</pub-id>
</mixed-citation>
</ref>
<ref id="B26">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Zheng</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Zhou</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Mao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Gu</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Autoantibodies targeting vinculin reveal novel insight into the mechanisms of autoimmune podocytopathies</article-title>. <source>Research</source>. <volume>8</volume>, <fpage>0722</fpage>. <pub-id pub-id-type="doi">10.34133/research.0722</pub-id>
<pub-id pub-id-type="pmid">40463498</pub-id>
</mixed-citation>
</ref>
<ref id="B27">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>M&#xf6;ller</surname>
<given-names>C. C.</given-names>
</name>
<name>
<surname>Wei</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Altintas</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Greka</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ohse</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Induction of TRPC6 channel in acquired forms of proteinuric kidney disease</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>18</volume>, <fpage>29</fpage>&#x2013;<lpage>36</lpage>. <pub-id pub-id-type="doi">10.1681/ASN.2006091010</pub-id>
<pub-id pub-id-type="pmid">17167110</pub-id>
</mixed-citation>
</ref>
<ref id="B28">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Myette</surname>
<given-names>R. L.</given-names>
</name>
<name>
<surname>Trentin-Sonoda</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Landry</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Holterman</surname>
<given-names>C. E.</given-names>
</name>
<name>
<surname>Lin</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Burger</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>Damage-associated molecular patterns and pattern recognition receptors in the podocyte</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>36</volume>, <fpage>136</fpage>&#x2013;<lpage>143</lpage>. <pub-id pub-id-type="doi">10.1681/ASN.0000000531</pub-id>
<pub-id pub-id-type="pmid">39331471</pub-id>
</mixed-citation>
</ref>
<ref id="B29">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ning</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Kong</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Xie</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>H.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Calcium signaling mediates cell death and crosstalk with autophagy in kidney disease</article-title>. <source>Cells</source>. <volume>10</volume>, <fpage>3204</fpage>. <pub-id pub-id-type="doi">10.3390/cells10113204</pub-id>
<pub-id pub-id-type="pmid">34831428</pub-id>
</mixed-citation>
</ref>
<ref id="B30">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Nozu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sako</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kano</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Ohwada</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Morohashi</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Rituximab in combination with cyclosporine and steroid pulse therapy for childhood-onset multidrug-resistant nephrotic syndrome: a multicenter single-arm clinical trial (JSKDC11 trial)</article-title>. <source>Clin. Exp. Nephrol.</source> <volume>28</volume>, <fpage>337</fpage>&#x2013;<lpage>348</lpage>. <pub-id pub-id-type="doi">10.1007/s10157-023-02431-0</pub-id>
<pub-id pub-id-type="pmid">38010466</pub-id>
</mixed-citation>
</ref>
<ref id="B31">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Panos</surname>
<given-names>G. D.</given-names>
</name>
<name>
<surname>Boeckler</surname>
<given-names>F. M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Statistical analysis in clinical and experimental medical research: simplified guidance for authors and reviewers</article-title>. <source>Drug Des. Devel Ther.</source> <volume>17</volume>, <fpage>1959</fpage>&#x2013;<lpage>1961</lpage>. <pub-id pub-id-type="doi">10.2147/DDDT.S427470</pub-id>
<pub-id pub-id-type="pmid">37426626</pub-id>
</mixed-citation>
</ref>
<ref id="B32">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Polat</surname>
<given-names>O. K.</given-names>
</name>
<name>
<surname>Isaeva</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Sudhini</surname>
<given-names>Y. R.</given-names>
</name>
<name>
<surname>Knott</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Noben</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>The small GTPase regulatory protein Rac1 drives podocyte injury independent of cationic channel protein TRPC5</article-title>. <source>Kidney Int.</source> <volume>103</volume>, <fpage>1056</fpage>&#x2013;<lpage>1062</lpage>. <pub-id pub-id-type="doi">10.1016/j.kint.2023.01.016</pub-id>
<pub-id pub-id-type="pmid">36750145</pub-id>
</mixed-citation>
</ref>
<ref id="B33">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qiu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Huo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zhao</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Luo</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xia</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Dysfunction of the Klotho-miR-30s/TRPC6 axis confers podocyte injury</article-title>. <source>Biochem. Biophys. Res. Commun.</source> <volume>557</volume>, <fpage>90</fpage>&#x2013;<lpage>96</lpage>. <pub-id pub-id-type="doi">10.1016/j.bbrc.2021.04.003</pub-id>
<pub-id pub-id-type="pmid">33862465</pub-id>
</mixed-citation>
</ref>
<ref id="B34">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Qu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Jiao</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>The interplay between immune and metabolic pathways in kidney disease</article-title>. <source>Cells</source> <volume>12</volume>, <fpage>1584</fpage>. <pub-id pub-id-type="doi">10.3390/cells12121584</pub-id>
<pub-id pub-id-type="pmid">37371054</pub-id>
</mixed-citation>
</ref>
<ref id="B35">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Riehle</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>B&#xfc;scher</surname>
<given-names>A. K.</given-names>
</name>
<name>
<surname>Gohlke</surname>
<given-names>B. O.</given-names>
</name>
<name>
<surname>Ka&#xdf;mann</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Kolatsi-Joannou</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Br&#xe4;sen</surname>
<given-names>J. H.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>TRPC6 G757D loss-of-function mutation associates with FSGS</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>27</volume>, <fpage>2771</fpage>&#x2013;<lpage>2783</lpage>. <pub-id pub-id-type="doi">10.1681/ASN.2015030318</pub-id>
<pub-id pub-id-type="pmid">26892346</pub-id>
</mixed-citation>
</ref>
<ref id="B36">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salemkour</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Yildiz</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Dionet</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>t Hart</surname>
<given-names>D. C.</given-names>
</name>
<name>
<surname>Verheijden</surname>
<given-names>K. A. T.</given-names>
</name>
<name>
<surname>Saito</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Podocyte injury in diabetic kidney disease in mouse models involves TRPC6-mediated calpain activation impairing autophagy</article-title>. <source>J. Am. Soc. Nephrol.</source> <volume>34</volume>, <fpage>1823</fpage>&#x2013;<lpage>1842</lpage>. <pub-id pub-id-type="doi">10.1681/ASN.0000000000000212</pub-id>
<pub-id pub-id-type="pmid">37678257</pub-id>
</mixed-citation>
</ref>
<ref id="B37">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Semenikhina</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Fedoriuk</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Stefanenko</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Klemens</surname>
<given-names>C. A.</given-names>
</name>
<name>
<surname>Cherezova</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Marshall</surname>
<given-names>B.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>&#x3b2;-Arrestin pathway activation by selective ATR1 agonism promotes calcium influx in podocytes, leading to glomerular damage</article-title>. <source>Clin. Sci. (Lond).</source> <volume>137</volume>, <fpage>1789</fpage>&#x2013;<lpage>1804</lpage>. <pub-id pub-id-type="doi">10.1042/CS20230313</pub-id>
<pub-id pub-id-type="pmid">38051199</pub-id>
</mixed-citation>
</ref>
<ref id="B38">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Staruschenko</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Palygin</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Dryer</surname>
<given-names>S. E.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Ion channels and channelopathies in glomeruli</article-title>. <source>Physiol. Rev.</source> <volume>103</volume>, <fpage>787</fpage>&#x2013;<lpage>854</lpage>. <pub-id pub-id-type="doi">10.1152/physrev.00013.2022</pub-id>
<pub-id pub-id-type="pmid">36007181</pub-id>
</mixed-citation>
</ref>
<ref id="B39">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>L. W.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Kang</surname>
<given-names>Y. L.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>G. H.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Four cases of nephrotic syndrome with TRPC6 gene variations and literature review</article-title>. <source>Chin. J. Pediatr.</source> <volume>59</volume>, <fpage>223</fpage>&#x2013;<lpage>227</lpage>. <pub-id pub-id-type="doi">10.3760/cma.j.cn112140-20200824-00822</pub-id>
<pub-id pub-id-type="pmid">33657698</pub-id>
</mixed-citation>
</ref>
<ref id="B40">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tu</surname>
<given-names>Y. C.</given-names>
</name>
<name>
<surname>Shu</surname>
<given-names>H. P.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>L. L.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>Q. Q.</given-names>
</name>
<name>
<surname>Feng</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>The physiopathologic roles of calcium signaling in podocytes</article-title>. <source>Front. Biosci. Landmark Ed.</source> <volume>28</volume>, <fpage>240</fpage>. <pub-id pub-id-type="doi">10.31083/j.fbl2810240</pub-id>
<pub-id pub-id-type="pmid">37919067</pub-id>
</mixed-citation>
</ref>
<ref id="B41">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vivarelli</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Gibson</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sinha</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Boyer</surname>
<given-names>O.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Childhood nephrotic syndrome</article-title>. <source>Lancet</source>. <volume>402</volume>, <fpage>809</fpage>&#x2013;<lpage>824</lpage>. <pub-id pub-id-type="doi">10.1016/S0140-6736(23)01051-6</pub-id>
<pub-id pub-id-type="pmid">37659779</pub-id>
</mixed-citation>
</ref>
<ref id="B42">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Werner</surname>
<given-names>L. E.</given-names>
</name>
<name>
<surname>Wagner</surname>
<given-names>U.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>Calcium-sensing receptor-mediated NLRP3 inflammasome activation in rheumatoid arthritis and autoinflammation</article-title>. <source>Front. Physiol.</source> <volume>13</volume>, <fpage>1078569</fpage>. <pub-id pub-id-type="doi">10.3389/fphys.2022.1078569</pub-id>
<pub-id pub-id-type="pmid">36685206</pub-id>
</mixed-citation>
</ref>
<ref id="B43">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wu</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Fu</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Guo</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Ren</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2025</year>). <article-title>TRPC6-targeted dexamethasone nanobubbles with ultrasound-guided theranostics for adriamycin-induced nephropathy</article-title>. <source>J. Nanobiotechnology</source>. <volume>23</volume>, <fpage>398</fpage>. <pub-id pub-id-type="doi">10.1186/s12951-025-03487-8</pub-id>
<pub-id pub-id-type="pmid">40448086</pub-id>
</mixed-citation>
</ref>
<ref id="B44">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kouadir</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Recent advances in the mechanisms of NLRP3 inflammasome activation and its inhibitors</article-title>. <source>Cell Death Dis.</source> <volume>10</volume>, <fpage>128</fpage>. <pub-id pub-id-type="doi">10.1038/s41419-019-1413-8</pub-id>
<pub-id pub-id-type="pmid">30755589</pub-id>
</mixed-citation>
</ref>
<ref id="B45">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yokota</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kamei</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Fujinaga</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hamada</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Inaba</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Nishi</surname>
<given-names>K.</given-names>
</name>
<etal/>
</person-group> (<year>2024</year>). <article-title>Efficacy of rituximab and risk factors for poor prognosis in patients with childhood-onset steroid-resistant nephrotic syndrome: a multicenter study</article-title>. <source>Pediatr. Nephrol.</source> <volume>39</volume>, <fpage>2979</fpage>&#x2013;<lpage>2988</lpage>. <pub-id pub-id-type="doi">10.1007/s00467-024-06422-5</pub-id>
<pub-id pub-id-type="pmid">38834892</pub-id>
</mixed-citation>
</ref>
<ref id="B46">
<mixed-citation publication-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Shan</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Deng</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Z.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Astragaloside IV inhibits palmitic acid-induced apoptosis through regulation of calcium homeostasis in mice podocytes</article-title>. <source>Mol. Biol. Rep.</source> <volume>48</volume>, <fpage>1453</fpage>&#x2013;<lpage>1464</lpage>. <pub-id pub-id-type="doi">10.1007/s11033-021-06204-4</pub-id>
<pub-id pub-id-type="pmid">33606151</pub-id>
</mixed-citation>
</ref>
</ref-list>
</back>
</article>