All animal protocols were reviewed and approved the intramural Ethics Committee on Humane Treatment of Laboratory Animals of Nanjing Medical University. The mice were maintained in an SPF environment with 12 h light/dark cycles and libitum access to food and water. Hepatocyte conditional Brg1 knockout (Brg1^LKO) mice have been described previously (Kong et al., 2021a). Liver injury was induced by intraperitoneal injection of acetaminophen (APAP) or ischemia-reperfusion as previously described (Li et al., 2019). Briefly, APAP was dissolved in 1XPBS and the mice received a single injection at a dose of 300 mg/kg. Alternatively, the mice were anesthetized with ketamine/xylazine and laparotomy was performed down the midline to expose the liver. An atraumatic clip was placed across the portal vein, hepatic artery, and bile duct to block blood flow. After 90min of ischemia, the clip was removed and the abdomen was closed with suture. The mice were euthanized by pentobarbital sodium (100–120 mg/kg) at indicated time points following APAP injection or reperfusion.

Primary murine hepatocytes were isolated as previously described (Kong et al., 2021b). Mouse recombinant HGF was purchased from R&D. The cells were treated with HGF (20 ng/ml) for 12–48 h as indicated. BRG1 expression construct has been previously described (Li et al., 2020). MYCN promoter-luciferase construct was generated by amplifying genomic DNA spanning the proximal promoter and the first exon of MYCN gene (−225/ + 18) and ligating into a pGL3-basic vector (Promega). Mutagenesis was performed a QuikChange kit (Thermo Fisher Scientific, Waltham, MA, United States). All DNA constructs were verified by direct sequencing. Small interfering RNAs were purchased from GenePharma: siFoxp2, CGAAUUUUAUAAAAACGCA; siFoxp1, GCAGGCGGTACTCAGACAAAT; siTwist2, AC AGUAAGAAGUCGAGCGAAGAUGG; siE2f5, GUUCGUGU CGCUGCUGCAGTT; siTfdp1, GGAGACTTGAAAGAATAAA. Cells were harvested 24–48 h after the transfection. Transient transfections were performed with Lipofectamine 2000. Luciferase activities were assayed using a luciferase reporter assay system (Promega) as previously described (Zhang et al., 2021).

Whole cell lysates were obtained by re-suspending cell pellets in RIPA buffer (50 mM Tris pH7.4, 150 mM NaCl, 1% Triton X-100) with freshly added protease inhibitor (Roche) as previously described (Yang et al., 2021). Western blot analyses were performed with anti-MYCN (Proteintech, 10159-2), anti-BRG1 (Abcam, Ab110641), anti-E2F5 (Thermo Fisher, PA5-81166), anti-TFDP1 (Thermo Fisher, PA5-86135), anti-FOXP1 (Abcam, ab227649), anti-FOXP2 (Abcam, ab16046), anti-TWIST2 (Abcam, ab66031), and anti-β-actin (Sigma, A1978). For densitometrical quantification, densities of target proteins were normalized to those of β-actin as previously described (Liu et al., 2021b). Data are expressed as relative protein levels compared to the control group which is arbitrarily set as 1.

RNA was extracted with the RNeasy RNA isolation kit (Qiagen) as previously described (Liu et al., 2021a). Reverse transcriptase reactions were performed using a SuperScript First-strand Synthesis System (Invitrogen) as previously described (Chen et al., 2021). Real-time PCR reactions were performed on an ABI Prism 7500 system with the following primers: Mycn, 5′-ACCATGCCGGGGATGATCT-3′ and 5′-AGCATCTCCGTAGCCCAATTC-3′; Ccna2, 5′-TGGATGGCAGTTTTGAATCACC-3′ and 5′-CCCTAAGGTA CGTGTGAATGTC-3′; Ccne1, 5′-CTCCGACCTTTCAGTCC GC-3′ and 5′-CACAGTCTTGTCAATCTTGGCA-3′; Ccnb1, 5′-CAATTATCGGAAGTGTCGGATCA-3′ and 5′-CTGGTGAACGACTGAACTCCC-3′; Pcna, 5′-TTT GAGGCACGCCTGATCC-3′ and 5′-GGAGACGTGAGA CGAGTCCAT-3′. Ct values of target genes were normalized to the Ct values of housekeekping control gene (18s, 5′-CGCGGTTCTATTTTGTTGGT-3′ and 5′-TCGTCTTCGAAACTCCGACT-3′ for both human and mouse genes) using the ΔΔCt method and expressed as relative mRNA expression levels compared to the control group which is arbitrarily set as 1 as previously described (Zhang et al., 2020).

Chromatin Immunoprecipitation (ChIP) assays were performed essentially as described before (Wu et al., 2020). In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and phenylmethylsulfonyl fluoride (PMSF). DNA was fragmented into ∼200 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-BRG1 (Abcam, ab110641), anti-E2F5 (Thermo Fisher, PA5-81166), anti-TFDP1 (Thermo Fisher, PA5-86135), anti-acetyl H3 (Millipore, 06–599), anti-trimethyl H3K4 (Millipore, 17–614), anti-RNA polymerase II (Abcam, ab264350), anti-p300 (Abcam, ab275378), anti-KMT2A (Bethyl laboratories, A300-087A), or pre-immune IgG. Precipitated DNA was amplified with the following primers: 5′-AGGCTTTTCCCCGCCCTC-3′ and 5′-AGAGAGAGAGAGTCGGAAAAAAG-3′.

Histological analyses were performed essentially as described before (Li et al., 2021). Paraffin sections were stained with were blocked with 10% normal goat serum for 1 h at room temperature and then incubated with anti-MYCN (Proteinch, 1:200) or anti-PCNA (Abcam, 1:200) antibodies. Staining was visualized by incubation with anti-rabbit secondary antibody and developed with a streptavidin-horseradish peroxidase kit (Pierce) for 20 min. Pictures were taken using an Olympus IX-70 microscope. Quantifications were performed with Image J.

Ingenuity pathway analysis (IPA) was performed using “MYCN” as keyword with the proprietary software developed by Qiagen (Hilden, Germany) per vendor instructions.

Liver biopsies were collected from patients with ALF referring to Nanjing Drum Tower Hospital. Written informed consent was obtained from subjects or families of liver donors. All procedures that involved human samples were approved by the Ethics Committee of the Nanjing Drum Tower Hospital and adhered to the principles outlined in the Declaration of Helsinki. Paraffin sections were stained with indicated antibodies.

5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed in triplicate wells with a commercially available kit (Thermo Fisher) as previously described (Wu et al., 2021). Briefly, the EdU solution was diluted with the culture media and incubated with the cells for 2 h at 37°C. After several washes with 1XPBS, the cells were then fixed with 4% formaldehyde and stained with Alexa Fluor^TM 488. The nucleus was counter-stained with DAPI. The images were visualized by fluorescence microscopy and analyzed with Image-Pro Plus (Media Cybernetics). For each group, at least six different fields were randomly chosen and the positively stained cells were counted and divided by the number of total cells. The data are expressed as relative EdU staining compared to the control group arbitrarily set as 1.

One-way ANOVA with post hoc Scheff’e analyses were performed by SPSS software (IBM SPSS v18.0, Chicago, IL, United States). Unless otherwise specified, values of p < 0.05 were considered statistically significant.

Of the three MYC family members, the regulatory role of c-MYC in liver regeneration has been extensively studied whereas little is known regarding the expression patterns of L-MYC in hepatocytes or its regulation. On the other hand, Corral et al. (1988) have reported that N-MYC expression is up-regulated during liver regeneration in a rat model of partial hepatectomy but the underlying mechanism is unclear. Therefore, we focused our study on the regulatory mechanism that might contribute to N-MYC up-regulation in proliferating hepatocytes. We examined the fluctuation of MYCN expression in the course of liver regeneration in two different animal models. In the first model, the mice were injected with a single dose of acetaminophen (APAP) to induce acute liver injury; liver regeneration typically peaks between 12 h and 48 h after the injection (Bhushan and Apte, 2019). Quantitative PCR showed that MYCN mRNA levels started to increase 12 h following APAP injection, peaked at 24 h, and declined at 48 h (Figure 1A); the pattern of MYCN expression tracked closely with hepatocyte proliferation as indicated by proliferating cell nuclear antigen (PCNA) expression. Protein levels of MYCN, as measured by Western blotting (Figure 1B) and immunohistochemical staining (Figure 1C), were similarly up-regulated and mirrored the kinetics of hepatocyte proliferation. In an alternative model, the mice were subjected to 45 min of hepatic ischemia followed by reperfusion; liver regeneration occurs as early as a few hours after the injury and can sustain for a couple of days (Schlossberg et al., 1996; Martins and Markmann, 2013). As shown in Figures 1D–F, there was again a simultaneous up-regulation of MYCN and the proliferative marker PCNA during the hepatic regenerative response as assessed by qPCR, Western blotting, and immunohistochemical staining. Finally, when primary murine hepatocytes were exposed to the pro-proliferative growth factor HGF, it was discovered that MYCN expression was strongly up-regulated by HGF treatment (Figures 1G,H).

To verify whether the observed induction of MYCN expression during liver regeneration was due to altered transcription rate, a MYCN promoter-luciferase construct (−225/ + 18) was transfected into HepG2 cells followed by HGF treatment. The MYCN promoter activity was significantly augmented by HGF treatment as early as 6 h and remained high by 24 h (Figure 2A). In order to uncover the upstream transcriptional regulators that might mediate MYCN induction by HGF, we performed ingenuity pathway analysis (IPA), which revealed the top five putative regulators of MYCN transcription to be FOXP2, E2F5, TFDP1, TWIST2, and FOXP1 (Figure 2B). To further narrow the specific regulator(s) of MYCN transcription, siRNAs targeting each individual transcription factor were designed, transfected into murine primary hepatocytes, and validated by Western blotting (Figure 2C). Knockdown of E2F5 or TFDP1 was sufficient to attenuate HGF-induced MYCN expression at mRNA (Figure 2D) and protein (Figure 2E) levels where knockdown of the other three factors did not impact MYCN expression. E2F5 and TFDP1 belong to the E2F family of transcription factors that recognize the consensus TTTSSCGC motif (La Thangue, 1994). To further demonstrate the essentiality of E2F5/TFDP1 in MYCN transcription, two putative E2F sites (TTGGCGCG) located on the proximal MYCN promoter, one between −181 and −174 relative to the transcription start site and the other between −162 and −155, were mutated and the mutant promoter displayed significantly weakened response to HGF treatment (Figure 2F).

BRG1 is a chromatin remodeling protein playing essential roles in liver regeneration (Li et al., 2019; Wang et al., 2019). We asked whether BRG1 might be involved in the regulation of MYCN transcription. To this end, WT and BRG1 hepatocyte conditional knockout (CKO) mice were injected with APAP and sacrificed 24 h later. As shown in Figure 3A, compared to the APAP-injected WT livers, MYCN mRNA expression in the APAP-injected CKO livers was down-regulated by 72%. Western blotting (Figure 3B) and immunohistochemical staining (Figure 3C) showed a decrease in MYCN protein expression in the CKO livers compared to the WT livers. Similarly, in the ischemia-reperfusion model, BRG1 deficiency repressed MYCN expression in the livers as measured by qPCR (Figure 3D), Western blotting (Figure 3E), and immunohistochemistry (Figure 3F). When primary hepatocytes were isolated from WT and BRG1 CKO mice and treated with or without HGF, MYCN induction was much less prominent in the CKO cells than in the WT cells (Figures 3G,H). Finally, the MYCN promoter-luciferase construct was transfected into WT and CKO cells followed by HGF treatment; augmentation of the MYCN promoter activity by HGF treatment in the CKO cells was not as strong as in the WT cells (Figure 3I), pointing to the mandatory role of BRG1 in MYCN transcription.

We next examined the potential interplay between BRG1 and E2F5/TFDP1 in regulating MYCN transcription. Co-immunoprecipitation assay showed that BRG1 could form a complex with both E2F5 and TFDP1 in primary hepatocytes (Figure 4A). Chromatin immunoprecipitation (ChIP) assay showed that in response to HGF treatment, the occupancies of E2F5, TFDP1, and BRG1 on the MYCN promoter region were similarly increased and followed the kinetics of MYCN expression (Figure 4B). Depletion of endogenous E2F5 or TFDP1 largely abrogated the binding of BRG1 to the MYCN promoter suggesting that BRG1 might rely on its interaction with E2F5/TFDP1 to bind to the MYCN promoter (Figure 4C). The binding of either E2F5 or TFDP1, on the other hand, was not reciprocally influenced by each other (Figures 4D,E). Since E2F5 or TFDP1 appears to be non-redundantly necessary for MYCN trans-activation and for BRG1 recruitment to the MYCN promoter, it is likely that E2F5 and TFDP1 may form a dimmer and cooperatively recruit BRG1, which serves as a rate-limiting factor for MYCN trans-activation; loss of either component of this complex would disrupt BRG1 binding and consequently dampen MYCN trans-activation.

On the contrary, recruitment of either E2F5 or TFDP1 to the MYCN promoter did not appear to be reliant on BRG1 because E2F5/TFDP1 binding on the MYCN promoter was comparable in the WT cells and the CKO cells (Figures 4F,G). When the WT cells were exposed to HGF, histone H3 acetylation (Figure 4H) and H3K4 trimethylation (Figure 4I) started to abound the MYCN promoter consistent with transcriptional activation. The changes in acetyl H3 and trimethyl H3K4 surrounding the MYCN promoter were much subtler in the CKO cells. In addition, the recruitment of RNA polymerase II was severely compromised in the absence of BRG1 likely explaining the reduced transcription rate (Figure 4J). Because previous studies have suggested that BRG1 can interact with histone acetyltransferase p300 (Xu et al., 2015) and histone H3K4 methyltransferase KMT2A (also known as mixed lineage leukemia 1, MLL1) (Shao et al., 2020), we hypothesized that BRG1 might recruit p300 and/or KMT2A to the MYCN promoter to alter histone modifications. ChIP assays performed with anti-p300 (Figure 4K) and anti-KMT2A (Figure 4L) antibodies showed that occupancies of both enzymes on the MYCN promoter were up-regulated by HGF treatment, which were weakened by BRG1 deficiency.

In order to further demonstrate the functional relevance of BRG1-dependent MYCN transcription in hepatocyte proliferation, a rescue experiment was performed. Adenovirus carrying either MYCN (Ad-MYCN) or GFP (Ad-GFP) was used to transduce primary hepatocytes isolated from WT or BRG1 CKO mice. As shown in Figures 5A,B, expression levels of several cell cycle regulators involved in hepatocyte proliferation, including cyclin A2 (Ccna2), cyclin B1 (Ccnb1), and cyclin E1 (Ccne1) were down-regulated in the CKO cells compared to the WT cells. Over-expression of ectopic MYCN, however, partially restored the expression of the cell cycle regulators. In addition, EdU incorporation assay showed that HGF-induced hepatocyte proliferation was impaired in the CKO cells, which could be corrected by MYCN over-expression (Figure 5C).

Finally, we compared the correlation between MYCN and its upstream regulators in human liver specimens. As shown in Figure 5D, MYCN expression was stronger in the liver with higher levels of BRG1/E2F5/TFDP1. Linear regression analysis identified significant correlation between MYCN expression and BRG1/E2F5/TFDP1 expression (Figure 5D).