Ankrd31 mutant lines were generated using CRISPR/Cas9 genome editing (Hwang et al., 2013), targeting exon 4 of the Ankrd31 gene. In order to produce a small frameshift deletion, two guide RNAs were designed using the online platform at http://crispor.tefor.net/. For each CRISPR-Cas9 ribonuclear protein (RNP) complex, fifty nanograms per microliter of Cas9 protein (PNA Bio) was complexed with an equimolar amount of crRNA (Eurogentec - ANKRDd315 5′[C^∗A^∗U^∗]UCUCCCGAGAUUCAACUGUUUUAGAGCUAU GCUGUUUU3′ or ANKRDd313 5′ [G^∗U^∗U]GUUGCUGGCUC UUAGUGGUUUUAGAGCUAUGCUGUUUUG3′) and tracrRNA (TriLink) in microinjection buffer (Life Technologies), as previously described (Teixeira et al., 2018). The two RNP complexes were co-injected into the cytoplasm of C57BL/6JCrl fertilized oocytes. The oocytes were subsequently transferred into pseudopregnant recipients. Design, production of RNP complexes, injections, and embryo transfer were performed by the AniRA-PBES transgenic facility of SFR Biosciences, Lyon. Out of 189 injected embryos, 90 were transferred into females and 14 were born. Eleven of the 14 born pups had alterations in the targeted genomic locus. Two mice that were heterozygotes for predicted frameshift-causing alleles (mut1 and mut2) were bred with C57BL/6JCrl wild-type (WT) mice to establish mouse lines. All experiments reported in the manuscript are based on samples from mice that were derivatives of the founder lines after at least three backcrosses.

Animal care and experimental procedures were performed following French and European guidelines on the protection of animals used for scientific purposes and approved by an ethical committee for animal experimentation (CEEA Val de Loire Projet 12884).

Trizol R Reagent (Invitrogen Life Technologies, Paisley, United Kingdom) was used to extract total RNA from WT and Ankrd31^–/– mouse epididymides following the manufacturer’s instructions. In brief, the epididymis was homogenized in Trizol Reagent and incubated for 5 min at 20°C. Then, 0.2 ml chloroform/ml Trizol Reagent was added and the samples were centrifuged at 12,000× g for 15 min at 4°C. The aqueous phase was transferred to a fresh tube and total RNA was precipitated by mixing with isopropyl alcohol (0.5 ml/ml Trizol Reagent) and 1 μl of glycogen (20 mg/ml). After centrifugation at 12,000× g for 10 min at 4°C, the RNA pellet was washed with 75% ethanol, centrifuged at 7,500× g for 10 min at 4°C, and dissolved in DEPC-H₂O. Total RNAs were assessed with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States) to quantify concentration (ng/ml) and purity (260/280 and 260/230 ratios). Then, RNA aliquots (10 μg) were treated with 2U DNase I (RNase-free DNase I, Ambion, Thermo Fisher Scientific, Massachusetts, United States) to remove potential contamination of genomic DNA and finally preserved at −80°C until the next step.

According to the manufacturer’s instructions, a kit containing quantitative real-time polymerase chain reaction (qRT-PCR) enzyme mix and an Evagreen qPCR Mastermix (Applied Biological Materials Inc.) was used for gene expression analysis in WT and Ankrd31^–/– epididymides (n = 5 animals for each genotype). A concentration of 50 ng of total RNA was used for all reactions on a CFX-96 Real Time polymerase chain reaction (PCR) System (Biorad). A negative control, without RNA, was included. The qRT-PCR in triplicates from each genotype was analyzed. Gene expression analysis, corrected for PCR efficiency, and normalized toward the reference gene (RP18S), was performed by CFX Manager software (Bio-Rad). Normalized fold expression (n.f.e) of mRNAs was calculated by applying the 2^–ΔΔCt method.

Primers to amplify selected RNAs in WT and Ankrd31^–/– samples were designed through the online tool Primer-BLAST¹. Primers for mouse genes are shown in Table 1.

The epididymis from WT and Ankrd31^–/– mice (n = 5 animals for each genotype) was separately homogenized in RIPA buffer [PBS, pH 7.4, 10 mM of dithiothreitol, 0.02% sodium azide, 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, in the presence of protease inhibitors (10 μg/ml of leupeptin, aprotinin, pepstatin A, chymostatin, and 5 μg/ml of TPCK)] and sonicated three times for 30 s bursts, each at 60 mW. Proteins were separated by SDS-PAGE (8% acrylamide) and transferred to a polyvinylidene difluoride membrane (GE Healthcare) at 280 mA for 2.5 h, at 4°C. The filters were treated for 2.5 h with blocking solution [5% non-fat milk, 0.25% Tween-20 in Tris-buffered saline (TBS, pH 7.6)] and incubated with different primary antibodies [occludin, diluted 1:500, sc-133255 Santa Cruz Biotechnology, Cambridge, United Kingdom; tubulin, diluted 1:5000, Sigma-Aldrich (T5168); actin, diluted 1:2000, sc-517582 Santa Cruz Biotechnology, Cambridge, United Kingdom; ZO-1, diluted 1:500, sc-33725 Santa Cruz Biotechnology, Cambridge, United Kingdom; claudin5 diluted 1:500, 4C3C2, Invitrogen; E-cadherin, diluted 1:500, SHE78-7, Invitrogen; connexin43; diluted 1:500; sc-271837 Santa Cruz Biotechnology, Cambridge, United Kingdom; SPECTRIN, diluted 1:500; sc-53444 Santa Cruz Biotechnology, Cambridge, United Kingdom] in TBS-milk buffer (TBS pH 7.6, 3% non-fat milk) overnight, at 4°C. The filters were washed in 0.25% Tween20-TBS and incubated with 1:1,000 horseradish peroxidase-conjugated mouse IgG (Dako Corp., Milan, Italy) in TBS-milk buffer and then washed again. An enhanced chemiluminescence-Western blotting detection system (Amersham ECL Western Blotting Detection Reagent, cod: RPN2106, GE Healthcare) was used to detect the immune complexes. Western blot experimental triplicates from each genotype analyzed (n = 5 animals for each genotype) were quantified by densitometry analysis, adjusted relatively to Ponceau S staining, and reported as OD fold change (mean ± SEM).

ANKRD31 antibodies were produced in rabbits by injection of two specific peptide regions of ANKRD31 protein. The protein sequences of ANKRD31 of different species (cattle, human, horses, rat) were compared to identify the specific regions for mouse ANKRD31. We, then, identified two potentially immunogenic peptides that were used to generate the antibodies. The sequences of peptides are: SLERKQDTDKNYTKKGP and NPKRRNKKTASQQPSAG.

The peptides were coupled to keyhole limpet hemocyanin (KLH) and injected into rabbits. Four immunization series were realized (0, 7, 14, and 34 days). The antibodies against ANKRD31 were detected in serum at 42 days after the last immunization. The specificity of the ANKRD31 antibody was verified by Western blot, immunochemistry, and protein immunoprecipitation (IP).

For IP, the WT epididymis was lyzed in RIPA buffer, in the presence of protease inhibitors (10 μg/ml of leupeptin, aprotinin, pepstatin A, chymostatin, and 5 μg/ml of TPCK), sonicated three times for 30 s bursts, each at 60 mW, and then incubated on ice for 30 min. After centrifugation at maximum speed for 30 min at 4°C, the protein supernatant was collected. A concentration of 500 mg of supernatant proteins from the WT epididymis was incubated with 2 μg of ANKRD31 antibody or IgG as negative control (Sigma-Aldrich-12370) under rotary agitation overnight at 4°C. Following, Protein A/G PLUS Agarose Beads (Santa Cruz Biotechnology- sc-2003) were added to each sample and incubated overnight under rotary agitation at 4°C. After bead incubation, samples were washed three times (3,000× g for 3 min at 4°C) in TBS pH 7.6 and boiled in Laemmli sample buffer for 10 min to be later analyzed by SDS-PAGE.

WT and Ankrd31^–/– mouse testes (n = 5 for each genotype) were fixed overnight in Bouin’s solution, dehydrated in ethanol, cleared in xylene, and embedded in paraffin using standard procedures. Microtome serial sections (7 μm thick) were cut and processed for histopathological analysis. For hematoxylin and eosin staining (H&E), sections were deparaffinized and processed using standard procedures. Histological observations and analysis were conducted under a light microscope (Leica CTR500, Leica Microsystems Inc., Milan, Italy) and images were captured using a high resolution digital camera (Leica DC300F). For DAPI immunofluorescence staining, testis sections were deparaffinized, rehydrated, and permeabilized with PBS pH 7.4 containing 0.1% Triton-X-100. Cell nuclei were marked with DAPI and the analysis was conducted under an optical microscope (Leica DM 5000 B + CTR 5000) with a UV lamp. For immunocytochemistry staining, WT and Ankrd31^–/– caput and cauda epididymal (n = 5 for each genotype) sections were deparaffinized, rehydrated, and permeabilized with PBS pH 7.4 containing 0.1% Triton-X-100. A citrate buffer of 0.01 M (pH 6.0) was used for antigen retrieval. After blocking with PBS containing 5% BSA and normal goat serum (diluted 1:5), sections were incubated with anti-ANKRD31 antibody (diluted 1:100) overnight at 4°C. Immunoreactivity was revealed using the avidin/biotin complex system and H₂O₂/DAB as the substrate/chromogen. The histological observations and analysis were conducted under a light microscope (Leica CTR500, Leica Microsystems Inc., Milan, Italy) and images were captured using a high resolution digital camera (Leica DC300F). WT and Ankrd31^–/– cauda sperm Harris-Shorr staining (n = 6 for each genotype) was performed using standard procedures.

The seminiferous tubular cells were isolated from 8-week WT or Ankrd31^–/– mouse testes (n = 5 animals for each genotype) according to the following protocol. The tunica albuginea was removed from testes. The testis was incubated for 10 min at 37°C in 3 ml of L15 medium containing 1 ml of collagenase (2 mg/ml) and 20 μl of DNAse 1 (2 mg/ml). The seminiferous tubules were isolated by sedimentation and the supernatant containing cells from the interstitial compartment was removed. The seminiferous tubules were incubated for 15 min at 37°C in 2.45 ml of L15 containing 2 ml of collagenase (2 mg/ml) and 20 μl of DNAse 1 (2 mg/ml). The cells of the seminiferous tubules were recovered by centrifugation at 80× g for 15 min. The cell pellet was suspended and fixed for 15 min in 100 μl of PBS containing 4% of paraformaldehyde. The cells were then centrifuged at 80× g for 8 min. The cell pellet was washed in PBS and centrifuged at 80× g for 8 min.

Cell analysis and sorting was carried out on WT and Ankrd31^–/– testicular germ cell populations (n = 6 animals for each genotype), using a MoFlo Astrios^EQ high speed cell sorter (Beckman Coulter Inc., Brea, CA, United States) with a nozzle of 90 μm using Summit 6.3 software (Beckman Coulter Inc.). Analysis was triggered with a blue laser (488 nm), debris was eliminated based on morphological criteria using forward scatter (FSC) vs. side scatter (SSC). We used Hoechst 33342 (Sigma) fluorophore to measure DNA content, excited using a violet laser (405 nm), and the blue fluorescence emitted was measured trough a 448/59 nm band pass filter. To preserve cell quantity for post-sorting experiences, a maximum of 200,000 events was analyzed before proceeding to the gating selection. Three peaks with increasing Hoechst fluorescence, representative of haploid (1C—Region 1), diploid (2C—Region 2), and tetraploid (4C—Region 3) cells, were detected and sorted using a dot-plot of side scatter (SSC) vs. Hoechst blue fluorescence. Sorting flow rate was adapted to the sample and set around 10,000 events/s for the most concentrated samples; for cell recovery, a 1.5 ml Eppendorf tube containing 350 μl of RPMI with 10% FBS was used.

After sacrifice via cervical dislocation, sperm cells from cauda epididymides (n = 5 animals for each genotype) were allowed to swim for 10 min at 37°C in 1 ml of M2 medium (Sigma-Aldrich, L’Isle d’Abeau, France). Sperm concentration was evaluated with a counting chamber, sperm vitality with eosin-nigrosin staining, and motility analysis was performed using a computational sperm analyzer (Hamilton Thorn Research, Beverley, MA, United States) as previously described (Martinez et al., 2017), with an evaluation of total and progressive motility, curvilinear velocity (VCL, μM/s), straight-line velocity (VSL, μM/s), average path velocity (VAP, μM/s) and lateral amplitude of the head (ALH, μM). A minimum of 100 motile SPZ were recorded in real time and analyzed for each sample. The remaining sperm cells were washed by centrifugation for 5 min at 500× g in PBS and fixed either in ether/ethanol 1:1 for morphology analysis or in 3:1 methanol/acetic acid solution for fluorescence in situ hybridization (FISH) analysis. Morphology analysis was performed on at least 200 cells for each sample after the Harris-Shorr staining procedure.

After methanol/acetic acid fixation, cauda epididymal SPZ (n = 6 animals for each genotype) were spread on Superfrost slides and air-dried at room temperature overnight (n = 3 for each animal). Cells were stained through incubation in 0.25 mg/ml of chromomycin A3 (CMA3) solution in McIlvaine buffer (pH 7) for 20 min followed by two washes for 2 min with McIlvaine buffer. Slides were then mounted with DAPI II (Abbott Laboratories) to counterstain sperm nuclei. A minimum of 100 sperm cells were evaluated and counted for each assay.

Cauda epididymal SPZ (n = 6 animals for each genotype) samples were dried on slides (n = 3 for each animal). After glutaraldehyde fixation, slides were incubated for 5 min in water, 10 min in 5% aniline blue solution diluted in 4% acetic acid solution, twice for 2 min in water, 2 min in 70, 90, and 100% ethanol solutions and, finally, 2 min in toluene. Slides were then mounted with Eukitt^® and analyzed using a microscope with a transmitted light microscope 100× objective with oil. A total of 100 SPZ for each slide were evaluated, and microscopic analysis was performed under an optical microscope (Leica DM 5000 B + CTR 5000). A minimum of 100 sperm cells were evaluated and counted for each assay.

Post fixation, sperm cells (n = 6 animals for each genotype) were spread onto slides (n = 3 for each animal) at optimum density to avoid nuclei overlapping and then dried overnight. Sequentially sperm cells were washed in 2× Standard Saline Citrate (SSC) solution, decondensed with 10 mM of DTT in 0.1 M of Tris-HCl, pH 8.0 for 30 min at room temperature and then washed in SSC solution, and dehydrated with ethanol. Three-color FISH was performed using whole chromosome painting probes for autosome 8 (XMP8 Orange, D1408-050-OR and XMP 8 Green, D-1408-050-FI, MetaSystems Probes), and both sexual chromosomes (XMPX Orange, D-1420-050-OR and XMPY Green, D-1421-050-FI, MetaSystems Probes). Denaturation occurred at 72°C for 5 min and hybridization at 37°C overnight. Slides were then washed for 2 min in 0.4× of SSC solution with 0.1% (v/v) Nonidet-P40 (Sigma-Aldrich) and 1 min in 2× of SSC solution at room temperature. Nuclei were counterstained with DAPI II counterstain medium (Abbott Molecular Inc.). Scoring was performed with a METAFER Metasystems^® device, previously validated for sperm FISH analysis (Martinez et al., 2013). The galleries of images provided by the machine were manually verified by two experienced biologists (GM and CC) applying the same strict criteria. A minimum of 5,000 nuclei was analyzed for each assay. Sperm cells were considered normal if they showed one distinct signal for each chromosome, disomic if they showed two distinct signals for a chromosome, and diploid if they showed two distinct signals for all chromosomes investigated.

Mating experiments were conducted to evaluate if Ankrd31 gene deletion negatively impaired male fertility. Copulatory plug formation was monitored as parameter of appropriate mounting behavior. For the analysis, equal numbers of 8-week-old male/female WT mice and male/female Ankrd31^–/– mice were used (n = 10 for each sex/genotype). The strategy included three types of mating: (♂WT ×♀WT); (♂WT ×♀Ankrd31^–/–); (♂Ankrd31^–/– ×♀WT). Mouse fertility index was defined evaluating the frequency of pups born for each individual pair of mice and for experimental groups.

ANOVA followed by Student’s t-test (for two independent group comparisons) was conducted to identify groups having different mean. Differences with p < 0.05 were considered statistically significant. Data are expressed as the mean ± SEM from at least five independent animals for each genotype or experimental group. For qRT-PCR and Western blot analyses, triplicates from each animal/genotype or experimental group were considered.

Ankrd31^–/– mutant lines were generated using CRISPR/Cas9 genome editing. Our strategy used two guide RNAs for the deletion of exon 4 and generated a frameshift to create a stop codon (Figure 1A). Ninety injected embryos with the two guide RNAs were transferred into females and 14 mice were born. Eleven of the 14 born pups had alterations in the targeted genomic locus. Eight mice showed a single CRISPR/Cas9 cut-off site. Only three mice showed the double cleavage leading to the deletion of exon 4. Sequencing of exons 3 and 4 of the Ankrd31 gene in three mice are shown in Figure 1B. For lines 430 and 435, the sequences showed that the CRISPR/Cas9 cut exactly occurred as expected from the experimental design. We observed the deletion of exon 4 and the formation of the expected stop codon. In these two lines of mice, a residual peptide of 66 amino acids out of the 1857 amino acids that the ANKRD31 protein possesses should be expressed. The sequence of this peptide is shown in Figure 1B. For line 432, the two guide RNAs slightly slipped, the cuts made by CRIPSR/Cas9 shifted in 5′ by 4 nucleotides upstream of the theoretical cut-off site and in 3′ by 14 nucleotides downstream of the theoretical cut-off site (Figure 1B). This caused a change in reading frame and the stop codon was shifted by 15 nucleotides. In this line of mice, a residual peptide of 66 amino acids added with 5 amino acids without homology with ANKRD31 protein should be expressed. The sequence of this peptide is shown in Figure 1B. An example of the exon 4 deletion from mouse line 430 is shown by PCR (Figure 1C). All experiments reported in the manuscript were based on samples from mice that were derivatives of founder lines after at least three backcrosses. All three lines showed the same phenotypes described in the results below.

With the aim to investigate the impact of Ankrd31 gene deletion on spermatogenesis, WT and Ankrd31^–/– male mice were sacrificed, testes were collected and used for histological and molecular analyses. Ankrd31^–/– testes appeared macroscopically smaller than WT. A significant reduction in testis weight (p < 0.01), from a media value of 77.5–41.5 mg was, in fact, observed in Ankrd31^–/– compared to WT, suggesting that Ankrd31 gene deletion negatively affected normal testis development (Figure 2A).

Histological analysis performed by H&E staining on testicular sections showed inefficient spermatogenesis in Ankrd31^–/– testes (Figure 2C). In comparison to spermatogenic stage VIII of WT testes (Figure 2B), Ankrd31^–/– testes showed a complete deregulation of normal seminiferous epithelium morphology. The physiologic basal and abluminal germ cell regionalization was not maintained in Ankrd31^–/– testes, indeed a large number of spermatocytes was found in the proximity of tubular lumen. In addition, WT testis sections showed a complete set of germ cells, including spermatocytes, round spermatids, and elongated spermatids (Figures 2B–D). Conversely, Ankrd31^–/– testis sections showed that a large number of spermatogonia and spermatocytes were not completely differentiated into spermatids, in association with sporadic spermatids not correctly oriented toward the seminiferous lumen (Figure 2H). Cells in metaphase with unaligned chromosomes were frequently observed in Ankrd31^–/– compared to WT testes (Figures 2D,E). In addition, a significant increase of the percentage of seminiferous tubules containing spermatocytes in metaphase was observed in Ankrd31^–/– testes (Figure 2F). Finally, immunofluorescent DNA staining by DAPI revealed an abundance of cells with high DNA content, suggesting an accumulation of early stage meiotic cells (Figures 2G,H).

To confirm the morphological studies suggesting impaired spermatogenesis in Ankrd31^–/– testes, we carried out a Fluorescence-Activated Cell Sorting (FACS) analysis to quantify the different germ cell sub-populations in WT and Ankrd31^–/– testes and cells. The inputted single-cell suspensions were obtained by testis dissociation. After that, the single-cell suspension was stained with Hoechst, a fluorescent dye staining DNA, and emitted blue fluorescence after excitation by violet laser at 405 nm. Germ cell analysis data clearly showed the three typical germ cell sub-populations related to DNA fluorescence intensities: 1C, 2C, and 4C, corresponding to spermatids, spermatogonia, and spermatocytes, respectively (Figures 3A,B). The single-plot and dot-plot histograms showed a reduction in 1C peak (spermatid cell population) and an increase in 2C and 4C peaks (spermatogonia and spermatocyte cell populations, respectively) in Ankrd31^–/– testes compared to WT (Figure 3B). Figure 3C showed the percentage of germ cells in WT and Ankrd31^–/– testes: a significant reduction in spermatid content (1C) and a significant increase in spermatogonia and spermatocyte content (2C and 4C, respectively) were observed in Ankrd31^–/– testes compared to WT, suggesting that Ankrd31 gene deletion negatively affected germ cell progression.

As reported, Ankrd31 gene deletion negatively affected germ cell progression inducing a significant reduction in SPZ production. Based on this, we decided to evaluate the possible impact on male fertility. Thus, a fertility test was carried out in WT compared to Ankrd31^–/– male mice (Table 2). As shown, Ankrd31^–/– male mice were totally infertile. Interestingly, when WT male mice mated with Ankrd31^–/– female mice, all pregnancies were successful with a normal number of pups, suggesting that Ankrd31 gene deletion negatively affected only male reproductive abilities. Sperm parameters were assessed from sperm cells collected from WT and Ankrd31^–/– cauda epididymides. Sperm cell number was significantly lower in Ankrd31^–/– as suggested by FACS analysis (Figure 4A).

Sperm vitality was reduced in the Ankrd31^–/– mice and correlated with a dramatic decrease of total and progressive motility (Figure 4B). The few motile SPZ exhibited severely impaired swimming [average path velocity (VAP) = 42.5 vs. 137.1 μM/s for WT mice; straight-line velocity (VSL) = 25.8 vs. 115.4 μM/s; curvilinear velocity (VCL) = 77.2 vs. 232.6 μM/s; amplitude of lateral head displacement (ALH) = 5.6 vs. 11.2 μM], concluding that Ankrd31 gene deletion induced severe asthenozoospermia (Supplementary Videos 1,2).

In addition, a significant increase in morphological abnormalities, predominantly linked to sperm heads, was found in Ankrd31^–/– SPZ (Figures 4C,D). To investigate whether the abnormal head morphology of the Ankrd31^–/– sperm may be associated with nuclear abnormalities, aniline blue staining was performed to gauge chromatin quality in WT and Ankrd31^–/– sperm. This staining has a selective affinity for lysine residues of histones, but not for arginine/cysteine residues of protamines. As the results showed a significant increase in the number of aniline blue-positive cells in Ankrd31^–/– SPZ compared with WT SPZ (p < 0.05), this suggests that a percentage of the Ankrd31^–/– SPZ had an immature chromatin state and an unbalanced histone/protamine ratio (Figures 4E–I).

In addition, we performed CMA3 staining on WT and Ankrd31^–/– cauda SPZ to detect potential protamine deficiency. Complementarily to the aniline blue staining, the results showed that the percentage of CMA3-positive SPZ was higher in Ankrd31^–/– than in WT SPZ, suggesting that the deletion of the Anrkd31 gene induced a reduction in protamine levels, confirming an impairment of sperm chromatin compaction (Figures 4G–I).

Finally, FISH analysis was carried out to investigate if Ankrd31 gene deletion may induce pathological aneuploidy. Results showed that Ankrd31^–/– SPZ displayed normal aneuploidy rates similar to WT mice and an equal distribution of sex chromosomes resulting in a ratio close to 1:1 (Table 3).

With the aim to investigate whether immotile features of Ankrd31^–/– SPZ were due to epididymal alterations induced by Ankrd31 gene deletion, histological and molecular analyses were carried out in WT and Ankrd31^–/– epididymides. Histological analysis was performed by H&E staining on caput and cauda epididymal sections of both WT and Ankrd31^–/– epididymides (Figures 5A–D). WT showed a pseudo-layered epithelium compared to caput Ankrd31^–/– epididymides (Figures 5A,B). Caput Ankrd31^–/– epididymides showed a basal detachment of principal cells in association with luminal infiltration due to a misfolding of the layered epithelium (Figure 5B). No appreciable alterations in the other epididymal epithelium cells, such as clear and narrow cells, were observed in Ankrd31^–/– compared to WT in caput epididymides (Figures 5A,B). Instead, histological analysis of WT caudal epididymal sections showed an increased stratification of the columnar epithelium, while a severe loss of the layered structure of the epididymal epithelium was observed in cauda Ankrd31^–/– epididymides where epithelial cells appeared to be not clearly distinguishable (Figures 5C,D). In addition, the caudal epididymal lumen of Ankrd31^–/– was characterized by a striking infiltration of blood cells and epithelial matrix, suggesting a possible involvement of ANKRD31 protein in BEB stabilization during epididymal transit (Figure 5D).

Then, ANKRD31 protein levels were evaluated by Western blot analysis in WT and Ankrd31^–/– epididymides, using the respective testis protein extracts, as internal control. As shown in Figure 5E, results confirmed the absence of ANKRD31 in both Ankrd31^–/– testes and epididymides, but more interestingly, a clear ANKRD31 protein signal appeared in WT epididymides. In order to minimize any discrepancies in protein amount, Ponceau S staining was carried out. Based on these results, a regionalized analysis of ANKRD31 protein levels was carried out in WT caput and cauda epididymides by Western blot. Results showed, in cauda epididymides, a significant increase in ANKRD31 protein levels compared to caput epididymides (p < 0.01), suggesting an increase in ANKRD31 protein level during epididymal transit (Figure 5F). Immunocytochemistry analysis performed in WT epididymal sections using ANKRD31 antibody showed, in WT caput epididymides, ANKRD31 protein localization in the cytoplasm of principal cells (Figure 5G). In WT cauda epididymides, the ANKRD31 signal was stronger than in WT caput epididymides, confirming Western blot results; in addition, in cauda epididymides, the ANKRD31 protein localization was not only observed in the cytoplasm of principal cells, but also became more intense in stereocilia proximal to epididymal lumen (Figure 5H, inset). ANKRD31 protein immunocytochemistry was performed in Ankrd31^–/– epididymal sections as internal control. As expected, no ANKRD31 signal was observed in Ankrd31^–/– epididymides (Figures 5I,J).

In order to study the effects of Ankrd31 gene deletion on BEB integrity, the expression analysis of epithelial junction markers, in WT and Ankrd31^–/– epididymides, was carried out by qRT-PCR (Figure 6). Regarding tight junctions, results showed lower expression levels of Ocln and ZO-1 in Ankrd31^–/– than WT epididymides (Figures 6A,B) (p < 0.01) and, conversely, higher expression levels of Cldn5 in Ankrd31^–/– than WT epididymides (p < 0.01) (Figure 6C). For adherens and gap junctions, a reduction in CDH1 and an increase in Cx43 expression levels (p < 0.01) were observed in Ankrd31^–/– compared to WT epididymides (Figures 6D,E), suggesting a complete deregulation of BEB epithelial junctions.

Western blot analysis was carried out to investigate the levels of junction epithelial proteins between WT and Ankrd31^–/– epididymides. Interestingly, actin and tubulin protein levels, frequently chosen as housekeeping proteins to normalize protein signals, were higher in Ankrd31^–/– than WT epididymides (p < 0.01), suggesting possible cytoarchitecture anomalies of epididymal epithelial cells (Figures 6F,G). For this reason, protein profiles were normalized relative to Ponceau S. In Ankrd31^–/–, a significant reduction in OCLN and an increase in ZO-1 and CLDN5 protein levels were observed in comparison to WT epididymides (Figures 6H–J; p < 0.05). In addition, quantitative densitometry analysis of CDH1 and Cx43 signals, showed, respectively, lower and higher protein levels in Ankrd31^–/– than WT epididymides (Figures 6K,L; p < 0.01), suggesting that Ankrd31 gene deletion negatively affected BEB junction epithelial protein levels.

Based on these results, protein IP experiments, using ANKRD31 antibody, were carried out in WT epididymides to investigate a possible physical interaction between ANKRD31 and junction epithelial proteins. As reported, ANKRD31-IP showed protein signals for CDH1, ZO-1, and OCLN, suggesting that the deregulation of BEB observed in Ankrd31^–/– epididymides may be the direct consequence of the loss of physical interaction among ANKRD31 and junction epithelial proteins (Figure 6M). In addition, ANKRD31-SPECTRIN interaction was evaluated as a positive experimental control in order to demonstrate the efficiency in the ANKRD31 IP assay (Figure 6M).