PU was synthesized by mixing 0.3 mL L-lysine-diisocyanate (LDI; Alfa Aesar, Haverhill, MA) and 130 mg N,N′-bis-(2-hydroxyethyl)-piperazine (PPA; Alfa Aesar) in 1 mL anhydrous dimethylformamide (DMF) inside a three-neck reaction flask under a dry nitrogen purge. The reaction was performed at 70°C for 12 h using 0.5% dibutyltin dilaurate as a catalyst. Then, ethanol was slowly added into the reaction mixture until no unreacted LDI was detected. The PU was collected after precipitation/purification in ethyl ether and vacuum-drying at 40°C. The characteristics of PU were confirmed by ¹H NMR (400 MHz, DMSO-d6, ppm).

For the synthesis of PU-PEI₆₀₀, 100 mg PU and an excess amount (300 mg) of PEI₆₀₀ (Sigma-Aldrich, St. Louis, MO) were dissolved in dichloromethane (DCM) in a round-bottom flask and were left to react at 75°C. After stirring for 48 h, the free PEI₆₀₀ in DCM was removed and the precipitate (PU-PEI₆₀₀) was collected. PU-PEI₆₀₀ was further washed three times with DCM to remove the unreacted PEI₆₀₀. Distinct signals of ¹H NMR (400 MHz, D2O, ppm) from the grafting of PEI₆₀₀ appeared at δ: 0.95 (–NHCH2CH2NH–), 2.0 (–CONHCH2CH2–), 2.38, 3.12 (–NHCH2CH2NH–), and 3.8 (–CONHCH2CH2–).

For functionalization with maleimide, 5 mg of 3-maleimidopropionic acid (TCI, Tokyo, Japan) dissolved in DCM was mixed with 4 mg N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC; Alfa Aesar) and 4 mg N-hydroxysuccinimide (NHS; Alfa Aesar) and allowed to react for 30 min at 35°C. Then, this mixed solution (containing 3-(maleimido)propionic acid N-hydroxysuccinimide ester) was reacted with 200 mg PU-PEI₆₀₀ dissolved in 1 mL of methanol to form PU-PEI₆₀₀-Mal in 12 h at room temperature. The product was vacuum-dried and rinsed with acetonitrile (ACN). PU-PEI₆₀₀-Mal was also analyzed by ¹H NMR. The new signals resultant from grafting of maleimide in ¹H NMR (400 MHz, D2O, ppm) were observed at δ: 2.94, 4.02 (–COCH2CH2N(CO–)2), 5.05 (–CH2CH2NHCOCH2CH2–), and 8.22 (–COCH = CHCO–).

PU-PEI₆₀₀-Mal was dissolved in 20 mM HEPES buffer (pH 7.4) to a concentration of 10 mg/mL. PU-PEI₆₀₀-Mal/plasmid DNA complexes were individually prepared at PU-PEI₆₀₀-Mal/DNA ratio of 10/1 (w/w) with the final concentration of DNA in the complexes of 5 μg/mL. These polymer/DNA complexes were self-assembled in a HEPES buffer at room temperature for at least 30 min.

For dual DNA transfection, two distinct PU-PEI₆₀₀-maleimide/DNA complexes were separately prepared and conjugated in the presence of 1,6-hexanedithiol (HDT) dissolved in HEPES buffer. The conjugation reaction was conducted with HDT/PU-PEI₆₀₀-Mal molar ration of 1.25/1 for 30 min at room temperature.

The hydrodynamic sizes of polymer/DNA complexes and their conjugates were measured by dynamic light scattering (DLS) using a Nicomp 380 Submicron Particle Sizer (PSS, Santa Barbara, CA, United States) at 25°C with a 5 mW, λ = 633 nm He–Ne laser as an incident beam.

sgRNA-coding sequence (ACAAATACTTCCAAATAGTGTGG) and HDR DNA template sequence (chrX:101,399,138-101,400,132; GRCh38/hg38 assembly) were cloned into pLAS2w.Ppuro (Academia Sinica, Taipei, Taiwan) encoding RFP reporter. pSpCas9(BB)-2A-GFP (PX458) (Addgene, Watertown, MA, United States) encoding GFP reporter was used for Cas9 expression. The plasmids were amplified in Escherichia coli (DH5α strain) and purified by column chromatography using a Plasmid Mega Kit (QIAGEN, Hilden, Germany). The purity of each DNA sample was determined by the ratio of UV absorbance at 260/280 nm and DNA was stored in Tris-EDTA buffer (10 mM Tris and 1 mM EDTA, pH 8.0).

The peripheral blood mononuclear cells (PBMCs) were taken from Fabry patients and further isolated by gradient centrifugation in Histopaque-1077 (Sigma Aldrich). PBMCs were collected from the buffy coat and incubated in X-VIVO medium (Lonza, Basel, Switzerland). PBMCs were transfected with reprogramming factors (OCT4, SOX2, KLF4, L-MYC, LIN28, and TP53shRNA) and enhancer factor (EBNA1) using the Nucleofector Kits for Human T Cells (Lonza). After transfection, the cells were plated onto inactivated MEF-coated dishes with hESC medium (DMEM/F12 with 20% KSR, 1% GlutaMAX, 1% NEAA, 1% Penicillin/Streptomycin, 0.1 μM 2-mercaptoethanol, and 10 ng/mL bFGF) supplemented with 0.5 μM Thiazovivin, 2 μM SB431542, 0.5 μM PD0325901, and 50 μM Vitamin C. The cells were incubated at 37°C and supplied with 5% CO₂ for ∼14–30 days until colony formation and medium was changed every 2 days.

FC-iPSCs and control-iPSCs were differentiated into cardiomyocytes (CMs) according to the reported established protocol (Lian et al., 2013; Chou et al., 2017). FC-iPSCs or control-iPSCs were first seeded on Geltrex-coated plates in mTeSR1 medium (STEMCELL Technologies, Vancouver, Canada), and Accutase (Innovative Cell Technologies, San Diego, CA, United States) was used to detach iPSCs from the plates. The iPSCs were then re-suspended in mTeSR1 with 5 μM of Y27632 (Tocris Bioscience, Bristol, United Kingdom), a ROCK inhibitor, and re-plated on Geltrex-coated 12-well plates at a density of 1 × 10 (Hung and Cherng, 2015) cells per well. After 4 days of culturing in mTeSR1 medium, the culture medium was changed to RPMI (Thermo Fisher Scientific) supplemented with B-27 supplement minus insulin (Thermo Fisher Scientific) and CHIR99021 (Selleck Chemicals, Houston, TX), a GASK3 inhibitor. After 24 h, the medium was replaced with RPMI/B-27 minus insulin. On day 3 of differentiation, combined medium was prepared by mixing the old medium with fresh RPMI/B-27 minus insulin at a 1:1 ratio. The medium was replaced with combined medium containing 5 μM of IWP-2 (Tocris Bioscience, Bristol, United Kingdom), a Wnt signaling inhibitor. On day 5 of differentiation, the medium was changed to fresh RPMI/B-27 minus insulin. On day 7 of differentiation, RPMI with B-27 was added and changed every other days for the following 3 weeks. CMs appeared after 3 weeks, showing regular contractile movements.

Cells were fixed with 1% paraformaldehyde solution at room temperature for 15 min and permeabilized with 0.1% Triton X-100 for 10 min. After several washes with 1 × PBS, fixed cells were blocked with 3% BSA and 5% FBS at room temperature for 1 h and incubated with primary antibody against Gb3/CD77 (1:100, ab19795, Abcam, Cambridge, United Kingdom) or cTnT (xxx) overnight at 4°C. Cells were washed three times with 1 × PBS and incubated with secondary antibodies at room temperature for 1 h. Finally, the cells were mounted and observed using a fluorescent or FV10i confocal microscope (Olympus, Center Valley, PA, United States). The measurement of cardiomyocyte size was conducted by the measurement of the cellular area contents of iPSC-derived cardiomyocytes. Cardiomyocytes were then plated onto gelatin-coated dishes and subjected to subsequent analysis. The cellular images of cTnT-positive cells were recorded using the confocal microscope (FV10i, Olympus) at various time points (i.e., 30, 40 and 60 days after cardiomyocyte differentiation). The cellular area pixels of cTnT-positive cells was analyzed with the ImageJ software package (National Institutes of Health, Bethesda, MD, United States).

The morphological characterization of iPSC-derived cardiomyocytes was performed by using a JEM-2000 EX II transmission electron microscope (JEOL, Tokyo, Japan). The cardiomyocytes were dehydrated and embedded in epoxy resin for ultra-thin sectioning. The ultra-thin sections were covered with 400 mesh carbon-coated copper TEM grid. The grid was stained with 1% phosphotungstic acid (Sigma-Aldrich, St. Louis, MO, United States) for 20 min and tapped with filter paper to remove the excess water. The samples were air-dried overnight and then observed under TEM.

The cytotoxicity of PU-PEI₆₀₀-Mal/DNA complexes was assessed utilizing the MTT assay. iPSCs were seeded in complete DMEM with a seeding density of 1 × 10⁴ cells/well in a 96-well plate. The cells were incubated in 5% CO2 at 37°C for 24 h. Afterward, the PU-PEI₆₀₀-Mal/DNA complexes were prepared in FBS-free DMEM medium and added to iPSCs at a volume of 200 μL/well. After incubating for 1 h, the iPSCs were washed with PBS and supplemented with complete DMEM medium containing FBS and incubated for further 48 h. 50 μL of MTT reagent (Sig ma-Aldrich, St. Louis, MO) was added to each well and incubated for 1 h at 37°C, after which the absorbance at 490 nm was measured on a microplate reader. The results were expressed as the relative cell viability (%) with respect to control groups treated only with DMEM.

Total RNA from Ctrl-iPSC-CMs, FC-iPSC-CMs, and corrected FC-iPSC-CMs was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA) and resuspended in RNase-free water. The preparation of RNA-seq libraries of polyadenylated RNA was conducted using the TruSeq RNA Library Prep Kit v2 (Illumina, San Diego, CA, United States). cDNA libraries were sequenced using an Illumina NextSeq 500 platform. Following the differential expression analysis using DESeq, raw reads were aligned to the human genome using the RNA-Seq Alignment Application on BaseSpace (Illumina). Differentially expressed genes were identified for each sample and used as a query to search for enriched biological processes and pathways using Enrichr tool.¹ Hierarchical clustering heatmap was generated using Orange Data Mining tool.² Principal component analysis (PCA) was performed on the Log2(fold change) values using Prcomp function in RStudio (1.3.959 version).

10 μl of lysates were added to 50 μl of assay buffer (lysis buffer without Triton X-100) containing 6 mM of 4-methylumbelliferyl-β-D-galactopyranoside and 117 mM of N-acetyl-D-galactosamine and incubated at 37°C for 1 h. The stop solution (0.4 M glycine, pH 10.8; 70 μl) was added, and the fluorescence was read on a Victor plate reader (PerkinElmer, Waltham, MA) at 355nm excitation and 460nm emission. The enzyme activity was normalized by total amount of protein.

All the experimental procedures were conducted as in the previous study (Chou et al., 2017). Briefly, the probe-containing culture dishes (Alpha MED Scientific, Osaka, Japan) were pre-coated 0.1% gelatin overnight and further washed three times by PBS. iPSCs-derived cardiomyocytes were seeded on the pre-coated dishes and the culture medium the day after. The electrical potentials were examined by MED64 multi-electrode array system (Alpha MED Scientific, Osaka, Japan) after the CMs spontaneous beating.

Total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Total RNA was reverse transcribed into cDNA using a SuperScript III Reverse Transcriptase kit (Thermo Fisher Scientific).

The following primer pairs were used: wild type GLA (forward TTGGATACTACGACATTGATGCC, reverse GTAT AATTGGGCTTTTGAAAGG), GLA IVS4 + 919 G > A mutant (forward GTCCTTGGCCCTGAATAG, reverse GTCCAGCA ACATCAACAATT), NPPA (forward TAGAAGATGAGGTC GTGCCC, reverse CGCCCTCAGCTTGCTTTTTA), ACTC1 (forward TGTGCCAAGATGTGTGACGA, reverse AGGGTCA GGATGCCTCTCTT), MYL2 (forward GGGCGAGTGAACGT GAAAAA, reverse GTGGTCAGCATTTCCCGAAC), and MYL7 (forward TCCATGTTTGAACAAGCCCA, reverse AAAGAGC GTGAGGAAGACGG).

Cas9 endonuclease, homology directed repair (HDR) DNA donor template, and sgRNA are the key components of the CRISPR/Cas9 gene editing system. Conventionally, considering the limited cloning capacity of plasmids, the Cas9-encoding gene and DNA donor template are usually loaded in distinct plasmids and transfected separately into target cells. Co-expression of all the components of CRISPR/Cas9 system in a single cell is the major prerequisite for successful editing. In this study, we designed an approach to ensure co-delivery of two plasmids encoding components of CRISPR/Cas9 system utilizing our previously designed polyurethane (PU)-based short branch polyethyleneimine (PEI₆₀₀)-grafted nanoparticles (PU-PEI₆₀₀) (Hung and Cherng, 2015). In such an approach, PU-PEI₆₀₀ was first functionalized by a maleimide (Mal) group to form PU-PEI₆₀₀-Mal (Figure 1A). Two distinct plasmids, one encoding sgRNA, Cas9 and GFP reporter (plasmid1), another encoding DNA template and mCherry reporter (plasmid2) were separately loaded on PU-PEI₆₀₀-Mal particles, and 1,6-hexanedithiol (HDT) was used to covalently conjugate two nanoparticle/DNA formulations (Figure 1A).

PU-PEI₆₀₀ and PU-PEI₆₀₀-Mal were synthesized as described in our previous work and the chemical structures of these polymers were confirmed by FT-IR and ¹H NMR spectroscopy (Hung and Cherng, 2015). The size of polymer/DNA complexes is affected by a polymer’s capacity to condense DNA. Therefore, to evaluate the efficiency of plasmid1 and plasmid2 DNA condensation by PU-PEI₆₀₀ and PU-PEI₆₀₀-Mal, we measured the sizes of the respective complexes by the dynamic light scattering (DLS). The sizes of PU-PEI₆₀₀/plasmid1 (encoding Cas9) and PU- PEI₆₀₀/plasmid2 (encoding mCherry) prepared at a ratio of 5/1 were around 150 and 90 nm, respectively (Table 1). The grafting of Mal group resulted in larger polymer/DNA complexes, approximately 300 nm of PU-PEI₆₀₀-Mal/plasmid1 and 200 nm of PU-PEI₆₀₀-Mal/plasmid2, which was indicative of less efficient DNA condensation by the modified complexes (Table 1). As was demonstrated by measurement of zeta potentials of PU-PEI₆₀₀ and PU-PEI₆₀₀-Mal, the grafting of Mal resulted in decreased positive charge due to amidation reaction on the 1o amine of PEI₆₀₀ (Table 2). These data indicate that the size of polymer/DNA complexes is affected by structural arrangements on a polymer and by distribution of positive charge density (Hung et al., 2009).

To conjugate PU-PEI₆₀₀-Mal/plasmid1 and PU-PEI₆₀₀-Mal/plasmid2 complexes for their concomitant delivery into cells, Mal groups were covalently linked via a thioester bond by treatment with HDT. As was shown by DLS, the average size of such conjugated complex was 550 nm, when a molar ratio 1.25/1 of HDT/PU-PEI₆₀₀-Mal was applied (Table 1). Since the average sizes of individual unconjugated complexes were 300 nm and 200 nm, it can be estimated that a conjugate with a size of 550 nm with a broad size distribution (Pdi = 0.7) could consist of two PU-PEI₆₀₀-Mal/DNA complex moieties and the probability to have two distinct complexes in a conjugate is estimated as 50%. Moreover, as was demonstrated by transmission electron microscopy (TEM), the individual PU-PEI₆₀₀/DNA (Figure 1B) and PU-PEI₆₀₀-Mal/DNA complexes not subjected to HDT-mediated crosslinking (Figure 1C) looked like fairly separated particles. In contrast, HDT-treated PU-PEI₆₀₀-Mal/DNA complexes looked significantly more compacted and formed aggregates (conjugates) (Figure 1C).

In the present study, we sought to use FC-iPSC-CMs as an in vitro platform to evaluate the efficacy of CRISPR/Cas9-mediated gene editing on FC-related manifestations, and test the efficiency of PU-PEI₆₀₀-Mal-mediated delivery of CRISPR/Cas9 components. Therefore, iPSCs were obtained by reprogramming T lymphocytes of two patients, who exhibited typical symptoms and clinical signs of FC, including marked ventricular septum and posterior wall hypertrophy of the left ventricle (Figure 2A), markedly hypertrophic and disorganized myocyte structure with large perinuclear and sarcoplasmic vacuoles (Figure 2B), accumulation of glycosphingolipids in the myocardium (Figure 2C), the presence of lamellar bodies (zebra bodies) representing lysosomes containing glycolipids in the myocardium (Figure 2D). FC patient-specific iPSCs (FC-iPSCs) were generated from patients’ T cells by overexpression of Yamanaka factors, and control iPSCs (Ctrl-iPSCs) were generated from two healthy subjects simultaneously (Figure 2E). Both FC-iPSC lines were confirmed to carry the GLA IVS4 + 919 G > A mutation by Sanger sequencing (Figure 2F). All generated FC-iPSC and Ctrl-iPSC clones were positively stained for alkaline phosphatase and exhibited embryonic stem cell-like morphology and other iPSC characteristics as described previously (Chien et al., 2016, 2018; Figure 2G). FC-iPSCs and Ctrl-iPSCs were further subjected to a 40-day cardiomyocyte differentiation protocol (Chien et al., 2016, 2018; Chou et al., 2017) to generate FC-iPSC-CMs and Ctrl-iPSC-CMs, respectively. FC-iPSC-CM and Ctrl-iPSC-CM clones were immunostained positively for cardiac troponin T (cTnT) and image analysis revealed that FC-iPSC-CMs exhibited cellular hypertrophy as compared to Ctrl-iPSC-CMs (Figures 2H,I). Meanwhile, the GLA enzyme activity of FC-iPSC-CMs was significantly lower than that of Ctrl-iPSC-CMs (Figure 2J).

Next, we evaluated the delivery efficiency of unconjugated mix of PU-PEI₆₀₀-Mal/plasmid1 and PU-PEI₆₀₀-Mal/plasmid2 with that of HDT-conjugated complex. As was shown by fluorescence microscopy, HDT-mediated conjugation resulted in markedly more efficient co-expression of GFP and mCherry reporters indicative of co-delivery of plasmid1 and plasmid2 to the same cells (Figure 3A). The simultaneous delivery of plasmid1 and plasmid2 encoding different components of CRISPR/Cas9 system is an absolute requirement for successful editing. Given that IVS4 + 919 G > A mutation results in an alternatively spliced form of GLA mRNA (Ishii et al., 2002), we designed forward and reverse primers to specifically amplify wild type (217 bp amplicon) and mutant (272 bp amplicon) forms (Figure 3B). FC-iPSCs were treated with the polymer/DNA mixture (PU-PEI₆₀₀-Mal/plasmid1 and PU-PEI₆₀₀-Mal/plasmid2 without HDT) and HDT-conjugated polymer/DNA complexes (PU-PEI₆₀₀-Mal/plasmid1-HDT-PU-PEI₆₀₀-Mal/plasmid2) and expression of wild type and mutant forms of GLA mRNA was evaluated by RT-PCR. The results of RT-PCR showed that, comparing with the polymer/DNA mixture without HDT conjugation, HDT enhanced the generation of wild type GLA mRNA with the concomitant decrease of the remnant mutated GLA mRNA (Figures 3C,D). Furthermore, sequence analysis confirmed the A > G gene correction of the IVS4 + 919 G > A mutated genotype in two clones of FC-iPSCs (Figure 3E). Collectively, these data indicated that HDT conjugation could enhance concomitant transfection of two distinct plasmids and, therefore, enhanced the CRISPR/Cas9-mediated correction efficiency.

Cytotoxicity is a critical issue that hinders the success of gene delivery. Previously, our data revealed that PU-PEI₆₀₀/DNA complexes were not cytotoxic for COS-7 cells till a ratio of 100/1 (w/w). In addition, HDT-conjugated PU-PEI₆₀₀-Mal/DNA complexes only showed a mild effect on the viability of COS-7 cells when HDT/PU-PEI₆₀₀-Mal/DNA molar ratios were below 5/1 (w/w) (Hung and Cherng, 2015). To evaluate whether PU-PEI₆₀₀, PU-PEI₆₀₀-Mal, or HDT-conjugated PU-PEI₆₀₀-Mal affect the viability of Ctrl-iPSCs, we measured the growth of Ctrl-iPSCs and the viability of Ctrl-iPSC-CMs after transfection with the indicated polymer/DNA complexes. As was shown by MTT assay, there was no significant difference in cell growth of parental Ctrl-iPSCs treated with PU-PEI₆₀₀ free of DNA or loaded with plasmid 1 or plasmid2 (Figure 4A). A parallel experiment also showed that the HDT linker did not modify the growth of Ctrl-iPSCs after all indicated transfections (Figure 4A, right). Meanwhile, all of polymers tested in this study did not affect the ability of iPSCs to form colonies (Figure 4B). In addition, the transfection with any polymer/DNA complex did not affect the ability of Ctrl-iPSCs to undergo embryoid body formation and cardiac differentiation (data not shown). Furthermore, the cell viability was not changed by any given treatment at post-induction days 0, 15, or 30 (Figure 4C). Taken together, these data revealed that neither PU-PEI₆₀₀ per se, Mal-functionalized PU-PEI₆₀₀, nor HDT-conjugated PU-PEI₆₀₀ nanoparticles affected the regular growth of Ctrl-iPSCs and their ability for cardiac differentiation.

Along with the observations that HDT-conjugated Mal-functionalized PU-PEI₆₀₀ promoted dual DNA transfection and enhanced CRISPR/Cas9-mediated gene correction, we sought to further examine whether this enhanced gene correction could rescue FC-associated manifestations. First, we subjected Ctrl-iPSC-CMs, FC-iPSC-CMs, and FC-iPSC-CMs with CRISPR/Cas9-mediated gene correction (post-induction day 20) to RNA-Seq analysis. Indeed, the gene expression profiles of corrected (CR) FC-iPSC-CM clones were similar to those of Ctrl-iPSC-CMs, but rather different from uncorrected FC-iPSC-CMs (Figure 5A). Furthermore, gene set enrichment analysis revealed that dysregulated genes in FC-iPSC-CMs that were rescued by the CRISPR/Cas9-mediated genetic correction, were enriched in the pathways related to myocardial infarction, portal hypertension, fatty acid degradation, sphingolipid metabolism, cardiac muscle contraction, secondary/extrinsic cardiomyopathies, atrial fibrillation, calcium regulation in the cardiac cell, TGF-beta receptor signaling, sphingolipid signaling pathway, proteins involved in hypertrophic cardiomyopathy, hypothesized pathways in pathogenesis of cardiovascular disease, sphingolipid pathway, degradation pathway of sphingolipids, other hypertrophic cardiomyopathy, glycerolipid metabolism, hypertrophic cardiomyopathy, physiological and pathological hypertrophy of the heart, and lysosome (Figure 5B). Principal component analysis further revealed that the global gene expression pattern of FC-iPSC-CMs with CRISPR/Cas9-mediated genetic correction was closer to that of Ctrl-iPSC-CMs than FC-iPSC-CMs (Figures 5C,D).

Cardiomyocyte hypertrophy is one of the major clinical manifestations in FC patients with IVS4 + 919 G > A mutation. To examine whether CRISPR/Cas9-mediated genetic correction of IVS4 + 919 G > A could prevent the development of cardiomyocyte hypertrophy in FC-iPSC-CMs that carried IVS4 + 919 G > A, the transfected FC-iPSCs and untreated Ctrl-iPSCs were directed to cardiac differentiation and the cardiomyocyte size was measured by quantification of the cTnT-positive area in FC-iPSC-CMs. Compared with that of Ctrl-iPSC-CMs, FC-iPSC-CMs that carried IVS4 + 919 G > A consistently exhibited the enlarged cell size at post-induction days 30–60, whereas FC-iPSC-CMs subjected to CRISPR/Cas9-mediated genetic correction did not undergo cell hypertrophy (Figures 5E,F). Several genes, including NPPA (natriuretic peptide A), ACTC1 (alpha-cardiac actin), MYL2 (myosin regulatory light chain 2), and MYL7 (myosin regulatory light chain 7), have been previously implicated in cardiac hypertrophy (Lan et al., 2013). qRT-PCR analysis confirmed the upregulation of these cardiac hypertrophy-associated genes in the time course of cardiac induction (Figure 5G). All of these hypertrophy-associated genes were upregulated in all groups of CMs, however, they were much less efficiently upregulated in CRISPR/Cas9-corrected FC-iPSC-CMs as compared to Ctrl-iPSC-CMs and FC-iPSC-CMs treated with scramble control formulation (Figure 5G). One of the important features of Fabry disease is the electric conduction abnormalities. Therefore, we applied MED64 array system to measure the electrical conductivity of the CMs. Comparing with Ctrl-iPSC-derived CMs, Fabry iPSC-derived CMs exhibited impaired conductivity. No significant difference was observed between Ctrl-iPSC-derived CMs and corrected iPSC-derived CMs (Figure 5H). These results indicate that CRISPR/Cas9-mediated genetic correction of IVS4 + 919 G > A effectively prevented the cardiomyocyte hypertrophy in FC-iPSC-CMs and prevented the impairment of conductivity.

Since intramyocardial Gb3 accumulation resulting from GLA deficiency is the landmark of the FC and the milestone for monitoring the efficacy of enzyme replacement therapy, we therefore evaluated the lysosomal abnormalities and the magnitude of Gb3 accumulation in FC-iPSC-CMs by TEM. After the dual transfection-mediated gene correction and the induction of cardiac differentiation, transfected FC-iPSC-CMs were subjected to TEM inspection. Comparing with untreated Ctrl-iPSC-CMs, untreated FC-iPSC-CMs and FC-iPSC-CMs transfected with the scramble sequence exhibited widespread hypertrophic and vacuolated features with electron-dense concentric lamellar bodies in the cytosol at day 40 post-induction (Figure 6A). Remarkably, FC-iPSC-CMs subjected to PU-PEI₆₀₀-Mal-HDT-mediated CRISPR/Cas9 gene correction did not reveal the formation of Gb3-enriched lamellar bodies (Figure 6A). We further used immunofluorescence staining to validate this observation and found a strong intensity of Gb3 signal within FC-iPSC-CMs transfected with a scramble sequence (Figures 6B,C). Consistently with the findings of TEM, Gb3 accumulation was not observed in FC-iPSC-CMs subjected to CRISPR/Cas9-mediated gene correction (Figures 6B,C). Since GLA is the enzyme responsible for the cleavage of Gb3, we also evaluated the GLA activity in Ctrl-iPSC-CMs, FC-iPSC-CMs transfected with scramble sequence, and FC-iPSC-CMs subjected to CRISPR/Cas9-mediated gene correction. Comparing with that of Ctrl-iPSC-CMs, the basal GLA activity was reduced in FC-iPSC-CMs transfected with a scramble sequence, while CRISPR/Cas9-mediated gene correction restored this activity (Figure 6D). Collectively, these data indicated that CRISPR/Cas9-mediated genetic correction of IVS4 + 919G > A mutation could prevent the development of Gb3 depositions through restoration of GLA enzyme activity in FC-iPSC-CMs.