The mTrp53inp2 floxed allele was generated at UCSD Transgenic Mouse shared resource core (https://moorescancercenter.ucsd.edu/research/shared-resources/transgenic-mouse/index.html) via Cas9-Crispr mediated flox sites insertion flanking the exon 2 of mouse trp53inp2 gene on Chromosome 2. The trp53inp2^{flox/flox/cre} mice (Trp53inp2-cKO) were generated by crossing the trp53inp2^flox/flox mice with αMHC-Mer-Cre-Mer mice (19) where the Trp53inp2 can be inactivated in cardiomyocytes upon tamoxifen treatment as previously described (Figure 1). The genotype was confirmed by genotyping PCR for 2 flox sites. Genotyping primers: 5LoxP F: TTATGATGAT GGTAATAAGA; 5LoxP R: GGATATGGAAGAAGTGATAT; 3LoxP F: TATTTGGATGTTGGAGTCC 3LoxP R: CTAGGTGTCCCAGGTGTGTG. The genetic background of both strains is C57BL/6J. The mice were treated by Tamoxifen diet (Envigo TD 130855) for 2 weeks followed by a wash out period of 7 days. All animals in this study were handled in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Transverse aortic constriction (TAC): The mice were placed on a volume ventilator (80 breaths/min, 1.2 ml/g/min) and anesthetized by isoflurane. The chest was opened, and the aorta was identified at the T8 region. For TAC only surgery, the suture was passed around the transverse aorta and tightened against a 28 g needle. For TAC + HFD surgery, the suture was passed around the transverse aorta and tightened against a 25 g needle.

Echocardiography: Mice were anesthetized and maintained with 2% isoflurane in 95% oxygen. A Vevo 3000 (Visual Sonics) echocardiography systems with 30 mHz scan head was used to image the heart. Both long axis and short axis view were recorded. The ejection fraction and fraction shortening were generated based on M-Mode images.

Mice were euthanized and the cardiac tissues were fixed with 10% Formalin before paraffin embedding. The H&E staining was performed at CCHMC pathology research core. For Wheat germ agglutinin (WGA) staining, cardiac tissue was cryo-preserved. Tissue sections were incubated with pre-chilled methanol at −20 °C for 10 min before blocking with 10% goat serum in 1%BSA/PBS for 1 h Alex Fluor 498 conjugated WGA (5 mg/ml, Invitrogen) were diluted in 1% BSA/PBS and incubated with section for 1hr at room temperature. Samples were counterstained and mounted with SlowFade Gold Antifade reagent with DAPI (Invitrogen). The images were taken using Leica Stellaris 8 Confocal and the cross-sectional area was quantified using Image J.

Hexokinase activity in cardiac tissues was measured using Hexokinase Activity Assay Kit (Abcam ab211103) according to the manufacturer's instruction. Briefly, ∼10 mg of left ventricle tissues were homogenized in cold assay buffer and centrifuged to remove insoluble materials. The supernatant was collected and proceed with the assay. The fluorescence was measured at Ex/Em = 535/587 in microplate reader (Biotek Synergy HT Microplate Reader) in kinetic mode for 10–30 min at 25 °C. The HK activity was calculated based on HK activity = (B/ΔT × V) × D and normalized to the original tissue weight.

Total RNA was extracted from tissues using Trizol Reagent (Thermo Fisher Scientific). RNA was used for first-strand complementary DNA synthesis using Random Primer (Thermo Fisher Scientific) and Maxima Reverse Transcriptase (Thermo Fisher Scientific) according to manufacturer's instruction. Real-time polymerase chain reaction (PCR) was performed using iTAQ SYBR Green Supermix (Bio-Rad Laboratories) with CFX Opus 96 Real-time PCR Detection System (Bio-Rad Laboratories). Values were normalized to GAPDH or ACTB. Primers are listed in Table 1.

Values are expressed as mean ± SEM. Student's t-test, 1- or 2-way ANOVA are used to determine significant differences. p < 0.05 was considered as statistically significant.

In order to understand the functional role of Trp53inp2 in intact heart physiology, we utilized Cas9-Crispr mediated gene editing to insert 2 loxP sites flanking the exon 2 of the mouse trp53inp2 gene on Chromosome 2 (Trp53inp2^flox/flox) (Figure 1A). To inactivate the Trp53inp2 in a cardiomyocytes specific manner, we crossed the Trp53inp2^flox/flox mice with αMHC-Mer-Cre-Mer mice to generate Trp53inp2^{flox/flox/cre} as well as their littermate controls Trp53inp2^flox/flox. Both cohorts were treated with a tamoxifen diet at the age of 8 weeks for 2 weeks prior to experiments (Figure 1A). To confirm that Trp53inp2 is completely inactivated in cardiomyocytes, we isolated cardiomyocytes from Trp53inp2^{flox/flox/cre} mouse hearts and compared with the control (Trp53inp2^flox/flox) mice for Trp53inp2 expression. Real-time PCR measurements confirmed that more than 90% knockout efficiency of Trp53inp2 was achieved in the Trp53inp2-cKO cardiomyocytes, while the expression of Trp53inp2 in liver or skeletal muscle was not affected (Figures 1B–D). Inactivation of Trp53inp2 in intact heart does not change the cardiac morphology comparing to the control littermates, as reflected by cardiac section H&E staining (Figure 1E).

Although Trp53inp2 has been suggested to play a role in glucose mediated regulation of cardiomyocytes hypertrophy in vitro, the in vivo function of Trp53inp2 has yet to be explored. We first investigated the functional role of Trp53inp2 in a severe pressure overload induced heart failure model by applying transverse aortic constriction (TAC) surgery using 28 g size needle (Figure 2A). We measured the cardiac function in the control and the Trp53inp2-cKO mice at baseline (one week post tamoxifen washout) and observed no differences in echo parameters between the control and the Trp53inp2-cKO mice (Figures 2B–E). However, at 4 weeks post TAC, the Trp53inp2-cKO mice demonstrated marked heart failure with significantly reduced ejection fraction (Figure 2B) and fraction shortening (Figure 2C) while the control mice only showed a trend in reduced cardiac function at more modest scale. Although no significant differences in ventricular wall thicknesses were observed based on echocardiography imaging between the two genotypes (LVPW; s and LVPW;d), the Trp53inp2-cKO hearts demonstrated a trend in wall thickening associated with cardiac hypertrophy (Figures 2D–E). This was supported by histological analysis at the tissue level. The Trp53inp2-cKO mice showed significant enlargement in heart and left ventricle weights (Figures 2F,G). No obvious pulmonary congestion or change of atrial sizes were observed based on lung weight and left atrial weight normalized by tibia length (Figures 2H,I). At molecular level, we observed higher levels of expression of heart failure marker genes including ANF and BNP in the Trp53inp2-cKO hearts comparing to the controls following TAC (Figures 2J,K). Lastly, enhanced cardiomyocyte hypertrophy was observed in the Trp53inp2-cKO heart following pressure overload, based on enlarged cardiomyocytes cross-section areas (Figures 2L,M). These evidence support that cardiomyocyte Trp53inp2 expression is protective and its inactivation promotes pressure overload induced pathological hypertrophic and cardiac dysfunction in intact heart.

Next, we explored the role of Trp53inp2 in the pathogenesis of heart failure induced by a combined stresses of moderate mechanical stress and metabolic overload. We challenged the Trp53inp2-cKO mice and their age-matched littermate controls with continuing high fat diet (HFD). At 4 weeks post HFD, additional mechanic stress was induced by applying a moderate pressure overload using TAC with a 25 g needle (Figure 3A). The combination of the moderate pressure overload and metabolic stress would lead to cardiometabolic disorder, characterized by both systolic and diastolic dysfunction. Cardiac function was monitored for additional 8 weeks following TAC. In contrast with the results observed in the pressure overloaded lean mice, pressure-overload in the HFD treated control mice led to significantly reduced ejection fraction (Figure 3B) and fraction shortening (Figure 3C). On the other hand, the statistic significances for the reduction of ejection fraction and fraction shortening were diminished in the Trp53inp2-cKO mice (Figures 3B,C). Importantly, the diastolic dysfunction observed in the control mice was significantly attenuated in the Trp53inp2-cKO mice (Figures 3F,G). These changes in cardiac function appeared to be independent from the status of hypertrophy since the cardiac hypertrophy remained significantly induced in the Trp53inp2-cKO heart at comparable level as the controls based on echo parameters such as LVPW; s (Figure 3D) and LVPW;d (Figure 3E), tissue weights, marker gene expression and cross-section area measurements (Figures 3H–O). Remarkably, left atrial sizes showed a significant induction in control mice, but not in Trp53inp2-cKO mice, further supporting our conclusion that Trp53inp2 plays a role in cardiac diastolic function in cardiometabolic disease (Figure 3K). In summary, combined cardiac and metabolic stresses led to both diastolic and systolic dysfunction in control mice, however, inactivation of Trp53inp2 in cardiomyocytes protected the heart from both systolic and diastolic dysfunction without an impact on cardiac hypertrophic remodeling.

Previously, Trp53inp2 has been suggested to play an important role in cardiomyocytes glucose utilization linking with hypertrophy based on in vitro analysis (18). The different outcome of Trp53inp2 inactivation under different stresses raised the question about its impact on glucose metabolism. Therefore, we performed real-time PCR to determine the expression of selected glucose utilization genes in the same mouse hearts obtained from this study. Strikingly, a diametrically different expression pattern of glucose utilization genes was observed in different stress conditions. Under single pressure overload, inactivation of Trp53inp2 in cardiomyocytes led to a significant reduction of glucose utilization genes including HK-2 and Pfkm (Figures 4A–D). In sharp contrast, the Trp53inp2-cKO mouse hearts showed a significant induction of these glucose utilization genes including HK-1 and HK-2 in cardiometabolic disorder (Figures 4E–H). Therefore, the different functional impact on cardiac contractile function from Trp53inp2 inactivation may be highly correlated with its impact on glucose utilization. However, the impact of Trp53inp2 KO on cardiac hypertrophy does not appear to be related to glucose utilization as originally predicted. To exclude the cardiac amyloidosis as a potential cause for the cardiac hypertrophy that we observed in our Trp53inp2-cKO mice, we further evaluated BDNF, a marker for cardiac amyloidosis (20). Real-time PCR analysis showed no significant changes of BDNF in either our pressure overload model or cardiometabolic disorder model, providing support for our conclusion that Trp53inp2 impacts on cardiac function through glucose utilization and that hypertrophic response we have observed in our study was bona fide pathological remodeling to pressure overload (Figures 4I,J). Lastly, to understand whether inactivation of Trp53inp2 in intact heart directly impacts on the hexokinase enzymatic activity, we performed hexokinase activity assay using the cardiac tissue from the two disease models. Interestingly, inactivation of Trp53inp2 in heart led to a significant decrease of hexokinase activity in response to severe pressure overload (Figure 4K), the hexokinase activity in Trp53inp2-cKO hearts showed a similar trend with control littermates in our cardiometabolic disorder model (Figure 4L). This data suggested that the changes in hexokinase activity could partially explain the differential cardiac phenotype we observed in Trp53inp2-cKO mouse. Additional analysis is necessary to understand the protection in diastolic function in Trp53inp2-cKO mice post metabolic challenge.

In summary, we have uncovered for the first time the in vivo function of Trp53inp2 in cardiac hypertrophy and dysfunction through a cardiomyocyte specific Trp53inp2 knockout mouse model. We find the impact of Trp53inp2 on cardiac contractility is stress-dependent and highly correlated with its impact on glucose utilization related genes. On the other hand, the impact on hypertrophy is not stress-specific or correlated with glucose utilization. These insights suggest that Trp53inp2 is a potentially important molecular link between glucose utilization and cardiac contractility and can have a protective or detrimental role depending on the nature of pathological stress.