The study was approved by the ethics committee of the West China Second Hospital of Sichuan University (approval no. 2014–034). In addition, we obtained written, informed consent from the patient's parents prior to performing WES and for the inclusion of the patient's clinical and imaging details in publications.

The proband was a 14-year-old female who presented with a two-year history of reduced tolerance to physical exertion and subsequently experienced severe dyspnea, respiratory distress, and fatigue following exertion. The patient suffered a sudden cardiac arrest 2 h before arrival at the hospital, during which carotid pulsation and respiratory movement were absent. CPR and defibrillation were promptly administered by first-aid personnel, resulting in the return of heartbeats after 15 min and restoration of sinus rhythm. Nevertheless, the patient remained unconscious and exhibited no spontaneous breathing. The patient was transferred to the emergency department while receiving laryngeal mask ventilation and subsequently underwent tracheal intubation, positive pressure ventilation, fluid infusion, sedation, and analgesia. The patient was later transferred to the cardiac intensive care unit one hour after the cardiac arrest. The patient's parents denied any history of illness, especially cardiovascular disorders, and any family history of cardiac arrest or cardiovascular disease. Notably, no family member had a history of hypertension or coronary artery disease.

Upon arrival at the cardiac intensive care unit, the patient's blood pressure was approximately 92/63 mmHg, and arterial oxygen saturation was maintained at 97% through mechanical ventilation. Physical examination revealed the patient to be comatose with significant cardiac enlargement, thoracolumbar scoliosis, and muscle weakness.

The results of the blood gas analysis indicated extremely severe respiratory alkalosis (pH = 7.52, PCO2 = 24 mmHg, PO2 = 155 mmHg), electrolyte disturbance (K⁺ = 4.0 mmol/L, Na⁺ = 136 mmol/L, Cl⁻ = 104 mmol/L, and Ca²⁺ = 0.99 mmol/L), and high lactate levels (4.8 mmol/L). Peripheral blood counts revealed an increased leukocyte count of 13.2 × 109/L. Blood biochemical tests demonstrated an elevated level of lactic dehydrogenase [494 U/L; normal range (NR) 109–245 U/L], while other renal and hepatic function parameters showed no apparent abnormalities. Thyroid function test results showed a decreased free triiodothyronine level at 3.2 pmol/L (NR > 4.3 pmol/L). Myocardial markers revealed significantly increased levels of troponin I (0.791 µg/L; NR < 0.2 µg/L), creatine kinase MB isoenzyme (11.75 µg/L; NR < 5 µg/L), and b-type natriuretic peptide (>5,000.00 pg/ml; NR < 100 pg/ml).

The electrocardiogram (ECG) revealed right axis deviation, biventricular hypertrophy, and ventricular escape beats (Figure 1A). Transthoracic echocardiography revealed significant hypertrophy of the left ventricular wall, particularly the interventricular septum (IVS) and left posterior ventricular wall (LVPW) (Figure 1C). In addition, cardiac magnetic resonance imaging (CMR) demonstrated diffuse hypertrophy of the ventricular myocardium. The thickness of each part during the diastolic period was as follows: LVPW, 28.3 mm; right ventricular anterior wall (RVAW), 8.3 mm; and IVS, 32.2 mm (Figure 1B, left panel). Additionally, the left ventricular ejection fraction (LVEF) measured by CMR was decreased (40.2%). Furthermore, the T2-weighted image revealed an abnormal signal intensity of the left ventricular subendocardial myocardium indicating myocardial ischemia (Figure 1B, right panel). It is noteworthy that the parents of the patient also underwent physical examinations and echocardiographic assessments conducted by cardiologists, revealing no indications associated with HCM.

We obtained a peripheral blood sample in an EDTA anticoagulant blood sample tube from the patient and stored it at 4°C for less than 6 h. DNA extraction was performed using the Blood Genome Column Medium Extraction Kit (Tiangen Biotech, Beijing, China) according to the instruction. Protein-coding exome enrichment was performed using the xGen Exome Research Panel v1.0. WES was performed using the Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA), while primary quality control was performed using FastP, comprising process of the raw data and removement of filter low-quality reads. Variants were annotated in accordance with database-sourced minor allele frequencies (MAFs) and practical guidelines on pathogenicity issued by the American College of Medical Genetics. The sequencing data have been deposited in GSA database (http://ngdc.cncb.ac.cn/gsub/). MutationTaster software and combined annotation dependent depletion (CADD) scaled c-scores were used to predict the pathogenicity of variants, while GRCh37 reference genome was used for alignment. We searched database including gnomAD, ExAC and 1000G to identify prevalence of variants. Effects of genetic variants on protein structure were evaluated via PROVEAN protein batch software with Provean score. As there is no available protein crystal structure for ALPK3, AlphaFold database (https://alphafold.ebi.ac.uk/) tool is used to predict protein crystal structure. Within the structure, three important domains have been revealed with analyzed crystal structure. PyMOL software was used to annotate domains and variant sites of the protein. Then we performed modeling analysis and compared three domains with the 6c6m.2.A, 3uto.2.A, and 1ia9.1.A template via SWISS-MODEL database (https://swissmodel.expasy.org/), to visualize and analyze the altered amino acid sequence and stability of ALPK3. And other identified variants had been presented in Supplementary Table S1.

Based on the clinical manifestations and laboratory analyses, HCM induced by genetic anomaly was strongly suspected. Thus, WES was performed, which identified a novel compound heterozygous variant of c.3907_3922del (p.G1303Lfs*28) and c.2200A>T (p.R734*) in ALPK3 gene, while genomic coordinates of these two variants are chr15:85401269-85401285delGGCCTCCTGGGGGCCT and chr15:85384104A>T (depth of coverage is 236.34, percent of exome captured is 98.34%). The patient's parents presented normal cardiac morphology, thus, we employed Sanger sequencing to validate the genotypes of the parents of the patient (forward primer “agcccacacactccttgacc” and reverse primer “tacatcagagctgctgctgg” for c.2200A>T and forward primer “ctgtacctcccgccgcctca” and reverse primer “tcccctgggaacttctcctc” for c.3907_3922del), which revealed that each parent carries a heterozygous variant of the ALPK3 gene. The variant of c.3907_3922del was maternal inherit, and the variant of c.2200A>T was paternal inherit (Figures 2A,B). According to the American College of Medical Genetics, both variants have pathogenicity as PVS1+PM2_Supporting+PM3 (Trans), and both were related to familial HCM. According to updated data in gnomAD, ExAC and 1000G, these two variants have not been reported in any populations, that means it is the first report of these variants (Figure 2C). Analysis performed with MutationTaster revealed that variant of c.3907_3922del in ALPK3 was considered pathogenic (probability 1.000) due to nonsense-mediated mRNA decay (NMD), amino acid sequence changed, frameshift, protein features affected and splice site changes, while c.2200A>T was also considered pathogenic because of NMD, acid sequence changed, and protein features affected (probability 1.000). Besides, CADD scaled c-scores of variant c.2200A>T is 36, which implies that the predicted pathogenicity of the variant is extremely high. PROVEAN protein batch software indicated that the p.R734* protein was deleterious with the PROVEAN score of −4.79, due to frameshift and NMD of p.G1303Lfs*28, PROVEAN and SIFT prediction were not applicable. While all the reported variants of ALPK3 had been listed in Figure 2D.

The entire amino acid sequence crystal structure was predicted by AlphaFold and assigned the name AF-Q96L96-F1 (Figure 3A). Although the predicted protein covered the entire length of the amino acid sequence, only three domains demonstrated high confidence (pLDDT >70). These domains were labeled red, green, and orange (Figure 3B). Other regions displayed low confidence in the crystal structure. While all potential templates were searched, only partial parts of the protein had been analyzed previously. We picked structures with the highest predictive value, which may cause several parts do not have a specific folding. In a word, the AlphaFold-predicted structure was the only model that could be utilized. The c.2200A>T and c.3907_3922del variants would result in a protein-truncating variant, typically leading to protein denaturation. The sites of truncated sequences caused by variants were labeled in yellow (Figures 3C,D). SWISS-MODEL was then employed to present the crystal structures of the variant's three domains, including two immunoglobulin-like (Ig-like) domains and an alpha-type protein kinase domain (Figure 3B). An ig-like domain superfamily is a heterogeneous group of proteins that play the role of cell recognition. The alpha-kinase domain is an atypical protein kinase catalytic domain that exhibits no detectable similarity to conventional protein serine/threonine kinases. This protein kinase recognizes protein sequences that adopt an alpha-helical conformation by its initial members, which act as the final link and effector of intracellular information transmission. The identified ALPK3 variants, c.3907_3922del and c.2200A>T would cause truncated protein, leading to the loss of an Ig-like domain and an alpha-type protein kinase domain, resulting in the dysfunction of the ALPK3 molecule. The aforementioned analyses suggested that both newly identified variants could alter the transcription of the ALPK3 gene and damage the protein structures. Therefore, the compound heterozygous variant of ALPK3 was considered to be genetically associated with HCM in this patient. In addition, several heterozygous variants were identified by WES, such as c.4639A>G in the FBN1 gene, c.3791G>A in ANKRD26, and c.1123G>T in DPYS. However, all three genes were considered to exhibit recessive inheritance, and the pathogenicity predictions for these variants were uncertain. Furthermore, all of these variants were inherited from one of her parents, unaffected by associated diseases. Consequently, they were not considered to be associated with HCM.

Following comprehensive laboratory and echocardiographic assessments, the patient was diagnosed with HCM. A 6-week hospitalization period was instituted, during which the patient received a range of medical interventions, including invasive and noninvasive mechanical ventilation, myocardial protection, anti-arrhythmia, cerebral protection, anti-infection, anti-inflammatory, diuresis, and blood transfusion. Although there was residual muscle weakness, the patient was discharged from the hospital after partial recovery from her major concerns with respect to heart rhythm control and cardiac function. However, two weeks after discharge, the patient experienced recurrent cardiac arrest during rehabilitation training and subsequently regained consciousness. The patient was subsequently readmitted to our department, where mechanical ventilation and gastrointestinal decompression were provided to alleviate symptoms. Anti-infective therapy was initiated with cefoperazone and sulbactam, while captopril and metoprolol were prescribed to address HCM and inhibit potentially lethal arrhythmias. Nutritional and rehabilitation therapies were also administered. After a month of comprehensive medical management, including fluid infusion, diuretic therapy, and vitamin supplementation, the patient was discharged with improved symptoms. However, due to the prolonged duration of the condition and recurrent cardiac arrest, the patient had not regained consciousness and experienced severe cognitive and neurological impairment. Oral medication administration and continuous follow-up and evaluation were regularly conducted, with clinic visits scheduled every two weeks in the first month and every three months thereafter.