We previously performed an RNA-seq analysis in PE-induced cardiomyocyte hypertrophy (17). After re-evaluating the genes with altered expression, we noticed a five-fold upregulation of Nap1l5, but not other Nap1l family members, in PE-treated NRVMs compared with control, which was validated by qRT-PCR (Figure 1A and Supplementary Figure 1A). To examine whether NAP1L5 plays a role in cardiomyocyte hypertrophy, we designed a Nap1l5-specific siRNA (siNap1l5) that achieving 80% knockdown efficiency 48h after transfection in NRVMs (Figure 1B and Supplementary Figure 1B). NAP1L5 silence did not change the cell size at basal level, but significantly suppressed PE-induced cell size enlargement (Figures 1C,D). Consistently, NAP1L5 knockdown significantly reversed the induction of hypertrophy markers, natriuretic peptide A (Nppa; also known as ANP) and natriuretic peptide B (Nppb; also known as BNP), after PE treatment (Figures 1E,F). These data suggest that NAP1L5 is required for cardiomyocyte pathological growth induced by PE.

We then constructed an Adenovirus carrying rat Nap1l5 gene (Ad-Nap1l5) to overexpress it in NRVMs. Both qRT-PCR and Western blot analyses confirmed the overexpression of NAP1L5 48h after infection (Figures 2A,B). NAP1L5 overexpression had a marginal effect on cell size at basal level; however, it significantly aggravated the cell size enlargement after PE treatment (Figures 2C,D). Moreover, the PE-induced expressions of Nppa and Nppb were significantly enhanced by NAP1L5 overexpression (Figures 2E,F). These results indicate that NAP1L5 functions as a pro-hypertrophic factor.

To explore the underlying mechanism, we performed a transcriptome analysis in NRVMs with NAP1L5 knockdown. Expression plotting confirmed the knockdown of NAP1L5 and the suppression of hypertrophy markers, including Nppa, Nppb and Acta1 (actin alpha 1, skeletal muscle), after siNap1l5 transfection (Figure 3A). Principal component analysis (PCA) showed that NAP1L5 knockdown alleviated the pro-hypertrophic effect of PE treatment at the transcriptome level, and also caused a special impact on global gene expression (Figure 3B). Venn diagram showed that the down-regulated genes after NAP1L5 knockdown shared more genes with the upregulated genes after PE treatment in comparison with the down-regulated ones, and vice versa (Figure 3C), suggesting a general anti-hypertrophic impact of NAP1L5 silence on PE-induced transcriptome reprogramming. Furthermore, heatmap of the union set between siNap1l5-sensitive and PE-sensitive genes showed that NAP1L5 knockdown was generally oppositely correlated with PE in gene expression patterns (Figure 3D). These data further support a crucial role of NAP1L5 in pro-hypertrophic transcriptome reprogramming.

Gene ontology (GO) analysis showed that the upregulated genes after NAP1L5 knockdown mainly related to immune responses, whereas the down-regulated genes covered oxidative phosphorylation, cardiac muscle contraction, and ribosome (Figures 4A,B). Gene set enrichment analysis (GSEA) also showed that hypertrophic cardiomyopathy-related genes were enriched in the down-regulated genes after NAP1L5 knockdown (Figure 4C), suggesting an involvement of NAP1L5 in hypertrophic cardiomyopathy.

Interestingly, the genes altered by siNap1l5 were negatively correlated with the regulations by polycomb repressive complex II (PRC2; Figure 4D) and complex I (PRC1; Figure 4E). We became curious about a possible role of NAP1L5 in epigenetic reprogramming. However, neither NAP1L5 knockdown nor its overexpression affected global methylations at histone H3 K4, K9, K27 and K36 sites, modifications essential for transcription regulation (Figures 4F,G). These data implicate that epigenetic regulation might not be the key mechanism underlying NAP1L5-mediated gene regulation.

Consistently with the GO analysis results, GSEA also revealed a down-regulation of ribosomal genes after NAP1L5 knockdown (Figure 5A), covering nearly all the genes of large and small ribosome subunits (Figure 5B). This result implicates a potential role of NAP1L5 in translation control. To test this hypothesis, we performed the puromycin incorporation assay, which allowing the detection of nascently synthesized peptides using Western blot with a specific anti-puromycin antibody (17, 44). We found that NAP1L5 knockdown significantly blocked the accelerated protein synthesis rate after PE treatment (Figure 5C). On contrary, NAP1L5 overexpression was sufficient to increase the protein synthesis rate (Figure 5D), suggesting that NAP1L5 promotes translation activity during cardiomyocyte hypertrophy.

We next analyzed the interactome of NAP1L5 from the String database, and found that NAP1L5 linked to core ribosomal proteins through binding to ribosome assembly or transport factors, including SDAD1, RRP7A, and NOL6 (Figure 6A). Interestingly, NAP1L1 also exhibited a similar interactome covering most of the NAP1L5-interacting factors (Figure 6B), although they share little identity in protein sequence (22.5%) or structure (Supplementary Figure 2). These observations implicate that NAP1L5 might participate in ribosome assembly. Nucleolus develops hypertrophy to accelerate ribosomal RNA transcription and ribosome assembly upon pro-growth stimulation (45). We found that NAP1L5 overexpression substantially increased the size of nucleolus, as evidenced by immunofluorescence of a nucleolar marker Fibrillarin (Figure 6C) (46). We then examined the ribosome profiles in NRVMs with NAP1L5 overexpression or knockdown. Compared with the Ad-Vector control, Ad-NAP1L5-infected NRVMs exhibited more ribosomal contents in the 40S, 60S, and 80S components (Figures 6D,E). Consistently, Nap1l5 knockdown in NRVMs reduced the contents of 40S, 60S and 80S components (Figures 6F,G), suggesting a crucial role of NAP1L5 in ribosome biogenesis.

To further explore the molecular mechanism, we tried to validate the interaction between NAP1L5 and SDAD1 or NOL6. Unfortunately, we did not observe a direct interaction between NAP1L5 and SDAD1, nor the full-length or spliced NOL6 isoforms (Supplementary Figure 3). These data suggest that other factors may be involved in the regulation of ribosome assembly by NAP1L5.

Neonatal rat ventricular myocytes (NRVMs) were isolated and cultured as described previously (17). Neonatal rat hearts (within 3 days after birth) were immediately extracted after decapitation and placed in a dish containing precooled PBS. Left ventricular tissues were dissected, finely cut into pieces, and then digested in a solution containing 0.08% type II collagenase (Sigma) and 0.125% protease (Sigma) at 37°C for 20 min/time. The supernatants were discarded at the first time and collected after that. This process continued until the heart tissues were completely digested. Cardiomyocytes were separated from fibroblasts by percoll (GE) density gradient centrifugation, and cultured in high glucose DMEM (Hyclone) containing 10% FBS (Gbico) and 1% penicillin/streptomycin. After 24 h of culture, the medium was changed to DMEM medium with 1% ITS (Invitrogen) for another 24 h before further treatment.

The full-length cDNA sequence of rat Nap1l5 (rNap1l5) were obtained by the National Center for Biotechnology Information (NCBI). The pcDNA3.1-rNap1l5-Flag recombinant plasmid were constructed by cloning the entire coding region of rNap1l5 into the NheI and XhoI sites of the pcDNA3.1-HA plasmid. The primer pair rNap1l5 CZF (5′- GGGAGACCCAAGCTGGCTAGCGCCACCatggccgaccccgagaag−3′) and rNap1l5 CZR (5′- TACGTCGTATGGGTATCTAGATcttctcggcagagtcgggacc−3′) was used to amplify a cDNA fragment encoding the mature rNap1l5 peptide. Massive plasmid replication was performed by transforming the pcDNA3.1-rNap1l5-Flag plasmid into E. coli DH-5α. In addition, in order to overexpress Nap1l5 in NRVM, the pcDNA3.1-rNap1l5-Flag plasmid was sent to Shanghai Hanheng Biotechnology Co., Ltd. for adenovirus packaging.

The full-length cDNA sequence of rat Nol6 and SDAD1 were obtained by the National Center for Biotechnology Information (NCBI). The pcDNA3.1-SDAD1-HA recombinant plasmid were constructed by cloning the entire coding region of SDAD1 into the NheI and XhoI sites of the pcDNA3.1-Flag plasmid. The primer pair SDAD1 CZF (5′- ACTATAGGGAGACCCAAGCTGGCTAGCGCCACCatgtccgggaggaacaac−3′) and SDAD1 CZR (5′- ATCTGGTACGTCGTATGGGTATCTAGActtcattcttttcctctttttcag−3′) was used to amplify a cDNA fragment encoding the mature SDAD1 peptide. Again, to get the mature Nol6 peptide, the primer pair Nol6 CZF (5′- ACTCACTATAGGGAGACCCAAGCTGGCTAGCGCCACCatgggaccagcccccgccgga−3′) and Nol6 CZR (5′- ATCTGGTACGTCGTATGGGTATCTAGAcacagtccacctctcacttcggg−3′) was used to amplify a cDNA fragment encoding the mature Nol6 peptide. However, the sequencing results showed that the deletion of exon 18 of this Nol6 resulted in frameshift mutation after exon 18, so we named this spliced NOL6 isoforms as Nol6Δ. To get the full-length Nol6, we used genomic DNA of Nol6 as a template and designed primers NOL6 gBF (tggtttgtcacctggagggcagcgg) and NOL6 gBR (cttgaggacgtcagtgtgtgtggcag) amplified in the upstream and downstream of exon 18 to obtain the missing fragment, and then the-full length Nol6 was obtained by bridging and recombination.

Cell size was measured using wheat germ agglutinin (WGA) staining as previously described. Briefly, cardiomyocytes were stimulated with 50 μM of PE for 48 h after transfection with different siRNA or infection with different adenoviruses for 24 h, the culture medium was discarded, washed with PBS, and fixed with 4% paraformaldehyde for 15 min at room temperature. Then 5.0 μg/mL WGA (Invitrigen) was applied to incubate with cardiomyocytes for 10 min at 37°C. When labeling was complete, removed the labeling solution, and washed cells three times with PBS. Then dyed with DAPI for 10 min at room temperature, and washed 5–7 times with PBS for 5 min each time. Finally, Images collected under a fluorescence microscope. Image Pro Plus 6.0 software was used to measure cardiomyocyte surface area. Each field of view measured more than 50 to calculate the surface area of cardiomyocytes.

The method of immunofluorescence staining of cardiomyocytes was as described above. The cardiomyocytes used for immunofluorescence staining were cultured in a six well cell culture plate containing sterile glass slides. Cardiomyocytes were stimulated with 50 μM of PE for 48 h after transfection with different siRNA or infection with different adenoviruses for 24 h, The cells were then fixed with 4% formaldehyde in PBS for 15 min at room temperature, permeabilized with 0.1% Triton X-100 in PBS for 10 min, goat serum was blocked at room temperature for 30 min, and then incubated with α-actinin antibody (1:100, Proteintech) or Fibrillarin antibody (1:100, Abclonal) at 4°C overnight. The next day, incubated the cell sample with the corresponding secondary antibody for 1 h at room temperature. Then dyed with DAPI for 10 min at room temperature. Then washed 5–7 times with PBS for 5 min each time. Finally, removed the slides from the 6-well plate and mounted the slides. Then, the fluorescence staining pictures of cardiomyocytes were collected under a fluorescence microscope. Image Pro Plus 6.0 software was used observe and take pictures.

Cultured HEK293T cells co-transfected with the appropriate plasmids were collected and lysed in an IP buffer (50mM Tris-HCl (pH 8.0), 150mM NaCl, 2mM EDTA, 1% NP-40 and 5% Glycerol) supplemented with a protease inhibitor cocktail (Roche) and PMSF. After incubating for 30 min at 4°C, followed by centrifuging 13,000 g for 15 min, the cell lysates were precleared with normal mouse or rabbit immunoglobulin G and protein A/G-agarose beads (Roche) for 1h at 4°C. The precleared lysates (500 μl) were then incubated with 1 μg of antibody and 10 μl of protein A/G-agarose beads on a rocking platform at 4°C overnight. The immunocomplex was collected, washed 5–6 times with cold IP wash buffer (50mM Tris-HCl (pH 8.0), 150mM NaCl, 2mM EDTA, 0.1% NP-40) and blotted using the indicated primary antibodies.

Total proteins were extracted from NRVM cells. NRVM cells lysed in Radio Immunoprecipitation Assay (RIPA) lysis buffers (Beyotime, Nanjing, China). Cell lysates were centrifuged at 12,000 × g for 15 min. The proteins concentration was detected by the BCA method, and equal quantities of protein extracts were loaded on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore Corp., Bedford, MA, U.S.A.). The membranes were blocked with 5% (w/v) non-fat milk for 1 h at room temperature, the membranes were incubated with specific primary antibodies overnight at 4°C. After washing 3 times with TBST, the membranes were incubated with the HRP-linked secondary antibody at room temperature for 1 h, and then washed 3 times with TBST again. Finally, the protein bands on the membranes were detected by chemiluminescent reagents (Beyotime, Nanjing, China). Chemiluminescence signals were quantified using an ECL imager, and analyzed using Quantity One software (Bio-Rad, Hercules, CA, USA). The specific primary antibodies were: anti-GAPDH (Proteintech), anti-Histone3 (Proteintech), anti-H3K4me3 (CST), anti-H3K9me3 (CST), anti-H3K27me3 (CST), anti-H3K36me3 (CST), anti-Flag (Sigma), and anti-Puromycin (Santa Cruz).

Different treatments of NRVM cells, 30 min before harvesting, add 1μM puromycin to each well for 30 min, then harvest the cells and extract the protein, and detect the binding level of puromycin by Western blot with anti-Puromycin antibody.

Ribosome profiling was performed as described. Cardiomyocytes were transfection with different siRNA or infection with different adenoviruses for 48 h, and were treated with with CHX (100 μg/mL) for 10–30 min before harvested. Cells were harvested using trypsin and then lysed in polysome extraction buffer (20 mM Tris-HCl [pH 7.0], 100 mM KCl, 5 mM MgCl₂, 0.5% Nonidet P-40) containing 100 μg/ml CHX, 1x protease inhibitors and 1:1,000 dilution of RiboLock RNase inhibitor for 15 min on ice. Following centrifugation, lysates were ultracentrifuged on 10–50% sucrose gradients at 190,000g for 1.5 h at 4°C. Following ultracentrifugation, fractions were collected from each sample using a BioComp Piston Gradient Fractionator instrument fitted with a TRIAX flow cell to measure absorbance.

NRVMs were transfected with siNap1l5 or siNeg using Lipofectamine RNAiMAX. After transfected 24 h, 50 μM phenylephrine (PE) were added in the media to induce cardiomyocyte hypertrophy, was performed as described previously (17). 48 h after treated with PE, NRVMs were harvested to extracted RNA according to the manufacturer's instructions. Transcriptome sequencing of RNA was completed by Beijing Genomics Institution (BGI). Three independent biological replicate samples were sequenced for each group. (i) The different expression genes (DEGs) between groups were screened using linear models for microarray data (limma) package in R. |Fold change| >1.5 and adjusted P-value < 0.05 were considered the threshold. (ii) Enrichment analysis of DEGs using Metascape online database with default parameters. (iii) Gene Set Enrichment Analysis (GSEA) is used to screen significantly enriched signaling pathways and transcription factors with default parameters, was performed as described previously.

Total RNA was extracted from NRVM cells using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich), following the manufacturer's instructions. RNA was quantified using NanoDrop (Thermo Fisher Scientific). The cDNAs were synthesized from 1μg RNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, U.S.A.). Real-time PCR was performed using the specific primers and Ultra SYBR Mixture (Monad, Suzhou, China) on CFX96M Touch Real-Time PCR Detection System (Roche, Basel, Switzerland). The PCR primer sequences used in this study include rNap1l5-forward: GAGCACAGCAGCTGACAGAC; rNap1l5-reverse: ATGACGTCGTTCTTGGGTTC; rNppa-forward: ATACAGTGCGGTGTCCAACA; rNppa-reverse: AGCCCTCAGTTTGCTTTTCA; rNppb-forward: CAGCTCTCAAAGGACCAAGG; rNppb-reverse: GCAGCTTGAACTATGTGCCA; rGAPDH-forward: ACAGCAACAGGGTGGTGGAC; rGAPDH-reverse: TTTGAGGGTGCAGCGAACTT. Relative expression of genes was determined with GAPDH as an endogenous control.

Statistical analyses were performed using GraphPad Prism 8 Software. All experimental data are presented as mean ± SEM of at least three independent experiments unless denoted elsewhere. Statistical significance for multiple comparisons was determined by one-way ANOVA or two-way ANOVA followed by Tukey's test. Bonferroni adjustment was used for post hoc analysis. Student's t-test was used for comparisons between two groups. P < 0.05 was considered statistically significant.