The Animal Care and Use Committee of the First Affiliated Hospital of Zhengzhou University approved all animal protocols. The animal experiments were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals (NIH Publication No. 80–23, revised in 1996).

Single guide RNA (sgRNA) targeting CCAGGGCTATGGTGGCGACT in the first exon of LAPTM5 was designed and cloned in the BsaI restriction site of the pUC57-T7-sgRNA (Addgene, 51132). Cas9 mRNA and guide RNA (gRNA) were generated by in vitro transcription following the instructions (Thermo Fisher Scientific, USA) and co-microinjected into the cytoplasm of fertilized eggs collected from C57BL/6N mice at the one-cell stage. The injected embryos were then implanted into the oviducts of pseudopregnant foster mothers. Two-week-old newborn mice were subjected to DNA extraction from the ear tissue and genotyped through sequencing PCR-amplified products with the following primers: LAPTM5-check F1: 5′- GGGCCCAAGACTCCTTACTC-3′, LAPTM5-check R1: 5′- CCCAGACTCCCCAATACTCA -3′.

AAV9-LAPTM5 (also called Ad-LAPTM5) and AAV9-Vector (as a negative control, also called Ad-NC) were constructed as described above. In brief, the LAPTM5 cassette consists of a CMV promoter followed by the human LAPTM5 sequence, and LAPTM5 was cloned into a pAAV-Vector. Then, the recombinant plasmid was identified by RT–PCR 24 h later. Next, the recombinant plasmids together with Helper and pAAV-RC were cotransfected into AAV-293 cells. After 3 days, viral stocks were obtained by CsCL2 gradient centrifugation. Finally, RT–PCR was used to detect the titration of aav9-LAPTM5 and AAV9-Vector. Two weeks before AB, mice were injected via the tail vein with virus containing 7.5 × 10¹¹ VG of the AAV9-LAPTM5 or AAV9-Vector.

AB surgery was performed as we previously described (14, 15). The mice were depilated and fasted for 12 h before the operation, and the mice were anesthetized by intraperitoneal injection of pentobarbital. In the AB groups, the aortic arch was separated and ligated. In the sham groups, the aortic arch was isolated without ligation. The appropriate ligation was evaluated by Doppler ultrasound.

A high-resolution small animal ultrasound system was used to evaluate the structure and function of the mouse heart as we previously described (16). The left ventricular end systolic diameter (LVESD) and left ventricular end diastolic diameter (LVEDd) were measured by M-mode. The contraction function is reflected by calculating the left ventricular fraction shortening (LVFS). All parameters were measured by M-mode for at least 5 cardiac cycles and then averaged.

The mice were euthanized at 4 weeks after AB or sham surgery to assess hypertrophic growth and cardiac fibrosis. Paraffin-embedded heart sections were stained with hematoxylin and eosin (H&E) for histopathology or with picrosirius red (PSR) to clarify collagen deposition. A fluorescence microscope was used to acquire images, and a digital image analysis system (Image-Pro Plus 6.0) was used to measure individual cell sizes. The LV collagen volume fraction was calculated from the PSR-stained sections as the area stained by PSR divided by the total area by Image-Pro Plus 6.0.

Lentiviruses used for overexpressing LAPTM5 (Lenti-LAPTM5) or LAPTM5 knockdown (LentishLAPTM5) were constructed. Briefly, full-length LAPTM5 coding cDNA was inserted into the lentiviral vector construct downstream of a cytomegalovirus (CMV) promoter to overexpress LAPTM5. Three pairs of oligo sequences targeting rat LAPTM5 mRNA containing different candidate short hairpin RNA sequences were synthesized, denatured and separately ligated into the pLKO1 lentiviral vector downstream of the U6 promoter to produce Lenti-LAPTM5. The lentivirus vector construct, packaging construct and envelope plasmid were cotransfected into 293T cells to prepare lentivirus particles, and the virus was stored at −80°C until use.

In particular, three lines of Lenti-LAPTM5 were screened for their efficiency in LAPTM5 knockdown, and the lentiviral line that produced the highest reduction in LAPTM5 protein levels was utilized. Lentivirus expressing GFP protein was used as a control for Lenti-LAPTM5, and a scramble Lenti-shRNA was used as a control for Lenti-shLAPTM5.

Primary neonatal rat cardiomyocyte culture, lentivirus transfection and Ang II stimulation were performed as we previously described (16). In brief, NRCMs were isolated from the hearts of 1- to 2-day-old Sprague–Dawley rat pups and cultured in gelatin-coated six-well plates. Lentivirus was added at a multiplicity of infection (MOI) of 10 to transfect NRCMs in serum-free medium for 6 h. Then, these cells were maintained for 72 h, synchronized with serum-free medium and stressed with Ang II (1 μmol/L) for the indicated hours. Immunofluorescence staining of α-actinin (Sigma–Aldrich, A7811) in cultured NRCMs was performed using established protocols.

Total RNA was isolated and purified as described in our previous study (16). The SuperScript first strand complementary DNA system (Invitrogen) was used for reverse transcription. PCR amplifications were quantified using SYBR Green PCR Master Mix (Applied Biosystems) and normalized to GAPDH gene expression. Primer sequences used for RT–PCR listed in Table 1.

Total proteins were extracted as described in our previous study (16), and the protein concentration was determined with a BCA protein assay kit. Protein extracts (50 μg) were separated by SDS–PAGE and transferred to nitrocellulose membranes and probed with various primary antibodies, including β-MHC, LAPTM5 (from Abcam, 1:1,000 dilution), ANP (from Santa Cruz, 1:200 dilution), GAPDH, P-MEK1/2, T-MEK1/2, P-ERK1/2, ERK1/2, P-JNK1/2, JNK1/2, P-P38, and P38 (from Cell Signaling Technology, 1:1000 dilution). After incubation with a secondary IRDye^® 800CW-conjugated antibody, Image Lab 5.2.1 software was used for quantification. GAPDH was used as a reference protein.

For the Co-IP assay, the treated cells were collected, and IP lysate was added to lyse the cells. The cell lysate was added with the corresponding antibody and A/G-Agarose beads for incubation. After the immunoprecipitation reaction, the immune complex was collected and eluted from agarose beads to free antigen, antibody and beads. Finally, Western blotting was performed to determine the binding protein.

The GST-fused full-length and truncated forms of LAPTM5 and Rac1 were expressed in Rosetta (DE3) Escherichia coli and purified after being immobilized on glutathione-sepharose 4B beads (GE Healthcare). Then, protein-bound beads were incubated with Flag-Rac1- or Flag-LAPTM5-expressing HEK293T cell lysates in IP buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA and 0.5% NP-40 supplemented with protease inhibitor cocktail) for 4 h at 4°C. The beads were then washed four times with IP lysis buffer in the absence of protease inhibitor cocktail. Finally, the bound proteins on the beads were eluted, resolved by SDS–PAGE and analyzed by Western blotting.

HEK293T cells were cultured on gelatin-coated coverslips and cotransfected with pEGFP-LAPTM5 and pmCherry-Rac1 for 48 h. Then, the cells were fixed with paraformaldehyde, permeabilized in PBS with Triton X-100, and stained with DAPI. The slides were fixed with fixed solution and finally observed and photographed with a confocal laser scanning microscope.

Data are shown as means ± SD. Differences among groups were assessed by ANOVA followed by Tukey's post-hoc test. Comparisons between two groups were performed by Student's t-test. A value of P < 0.05 was considered to be a statistically significant difference.

To clarify the role of LAPTM5 in pathological cardiac hypertrophy, we detected the expression level of LAPTM5 under various pathological stimuli. According to the western blotting results, the LAPTM5 protein levels in AB-induced hypertrophic mouse hearts were significantly decreased compared with those in sham groups, as assessed by increased levels of cardiac hypertrophic markers, such as atrial natriuretic peptide (ANP) and β-myosin heavy chain (β-MHC) (Figures 1A,B). In addition, we stimulated cardiomyocyte hypertrophy with Ang II and found that ANP and β-MHC levels increased significantly, but the level of LAPTM5 in cardiomyocytes decreased (Figures 1C,D). The above results suggest that the expression of LAPTM5 decreases during myocardial hypertrophy, which may be related to cardiac dysfunction.

In the second step, we tried to clarify the regulatory effect of LAPTM5 on pathological cardiac hypertrophy. To confirm this hypothesis, an in vitro experiment was performed on NRCMs, and we infected NRCMs with either AdLAPTM5 to overexpress LAPTM5 (Figure 2A) or AdshLAPTM5 to knockdown LAPTM5 (Figure 2E). NRCMs were stimulated with AngII, and cells were transfected with adenovirus to overexpress LAPTM5. With the administration of PBS, there were no significant differences in cardiomyocyte morphology or cardiomyocyte surface area between each group. However, following Ang II stimulation, NRCMs overexpressing LAPTM5 significantly inhibited cardiomyocyte hypertrophy, as assessed by cell surface area (Figures 2B–D). In contrast, there was a significantly greater cardiomyocyte surface area in cells with LAPTM5 knockdown than in AdshRNA-infected controls. In accordance with these results, NRCMs with AdLAPTM5 infection showed reduced ANP and β-MHC transcription levels in response to Ang II, whereas AdshLAPTM5-infected NRCMs showed higher transcription levels of those markers compared with controls under stimulation (Figures 2F–H). Together, these results indicate that LAPTM5 may function as a positive regulator in cardiac hypertrophy.

To further confirm the regulatory effect of LAPTM5 on cardiac hypertrophy in vivo, we generated LAPTM5 global knockout (KO) mice (Figures 3A–C). Under physiological conditions, LAPTM5 gene deletion mice have healthy behavior and normal fertility, and there is no difference in cardiac morphology and function between LAPTM5 gene deletion mice and WT mice. After 4 weeks of AB, LAPTM5 gene-deleted mice showed worsening pathological myocardial hypertrophy, as assessed by higher heart weight (HW)/body weight (BW), lung weight (LW)/BW and HW/tibial length (TL) (Figure 3D) than WT controls. In addition, LAPTM5 gene-deleted mice showed more severe cardiac dilation and dysfunction, as evidenced by echocardiographic parameters (Figure 3E). The staining results showed that the cross-sectional area of cardiomyocytes in LAPTM5 gene-deleted mice was larger than that in WT mice (Figure 3F). In addition, the transcription of cardiac hypertrophy markers in LAPTM5-ko mice was significantly increased (Figure 3H).

Myocardial fibrosis is also an important sign of pathological cardiac hypertrophy (17). Therefore, we examined the effect of LAPTM5 gene deletion on myocardial fibrosis. The staining results showed obvious perivascular and interstitial fibrosis in WT mice 4 weeks after AB operation. However, this fibrosis was significantly aggravated in the hearts of gene-deleted mice (Figure 3G). LAPTM5 gene deletion also increased the transcription of fibrosis markers (collagen I, collagen III and connective tissue growth factor) (Figure 3I). These results suggest that LAPTM5 gene deletion can aggravate the pathological myocardial hypertrophy induced by pressure overload.

Since AAV9 has strong guidance to cardiomyocytes (18), we used the AAV9 overexpression system to overexpress LAPTM5 in mouse hearts. Mice injected with AAV9-LAPTM5 showed elevated expression of LAPTM5 compared with the control mice (Figure 4A). Moreover, LAPTM5 overexpression suppressed the cardiac hypertrophic response, as we observed reduced HW/BW, HW/TL, and LW/BW ratios in the AAV9-LAPTM5 group 4 weeks after AB (Figure 4B). Mice injected with AAV9-LAPTM5 also showed ameliorated cardiac dilation and dysfunction (Figure 4C), a lower cardiomyocyte cross-sectional area (Figures 4D,E), and reduced transcription of hypertrophic markers compared with the control mice (Figure 4H).

Consistently, cardiac fibrosis was also attenuated in mice injected with AAV9-LAPTM5 (Figures 4F,G), as assessed by PSR staining and analysis of collagen volume and fibrosis marker expression (Figure 4I). Together, these data suggest that LAPTM5 protects against cardiac hypertrophy and heart failure.

Because the MAPK pathway plays a key role in pathological cardiac hypertrophy, we examined whether LAPTM5 affects these signaling molecules (19, 20). After 4 weeks of AB, the phosphorylated MEK1/2 and ERK1/2 in the hearts of WT mice increased significantly, but the phosphorylation level of the above proteins in the hearts of LAPTM5 gene-deleted mice was higher than that in the WT group (Figure 5A). The phosphorylation level of the above proteins in the hearts of LAPTM5-overexpressing mice was lower than that in the hearts of control mice (Figure 5B). However, deletion or overexpression of LAPTM5 in mouse hearts did not affect the levels of phosphorylated JNK1/2 and p38 (Figures 5A,B). To further verify these results, we detected changes in MAPK signaling molecules in NRCMs. Our results showed that silencing LAPTM5 in NRCMs could increase the phosphorylation levels of MEK1/2 and ERK1/2 (Figure 5C). However, overexpression of LAPTM5 in cardiomyocytes reduced the phosphorylation levels of MEK1/2 and ERK1/2 (Figure 5D). These results suggest that LAPTM5 inhibits the activation of MEK1/2 and ERK1/2 signaling and plays a cardioprotective role.

The above results indicated that LAPTM5 might regulate pressure overload-induced cardiac hypertrophy by inhibiting MEK-ERK signaling. However, the molecular mechanisms of how LAPTM5 regulates the MEK-ERK signaling pathway remain unknown. Rac1 is one of the most upstream regulators of MAPK signaling and has been reported to localize to endosomes, which are also located in the region of LAPTM5 (21). To further validate the correlation between LAPTM5 and Rac1, we first examined the subcellular localization of LAPTM5 and Rac1 by immunofluorescent staining. 293T cells were transfected with pEGFP-LAPTM5 and pmCherry-Rac1. Both LAPTM5 and Rac1 were located in the cytoplasm, and their locations overlapped with each other (Figure 6A). We also detected the interaction between LAPTM5 and Rac1. 293T cells were transfected with Flag-LAPTM5 and HA-Rac1. Coimmunoprecipitation results showed an interaction of Flag-LAPTM5 with HA-Rac1 (Figures 6B,C). We also GST pulldown to confirm this interaction. The results revealed that Flag-LAPTM5 was pulled down with GST-tagged Rac1, and HA-Rac1 was pulled down with GST-tagged LAPTM5 but not GST per se (Figures 6D,E). Overall, these data demonstrated that LAPTM5 could directly interact with Rac1.

We further explored whether activation of the MEK-ERK signaling cascade by Rac1 could affect the regulatory effect of LAPTM5 in cardiomyocyte hypertrophy. We overexpressed a constitutively active mutant of Rac1 (G12V) in NRCM (22), and the western blot results revealed that Ang II-triggered activation of MEK1/2 and ERK1/2 was exaggerated in Rac1 (G12V)-expressing cardiomyocytes. In response to Ang II induction, the protective effect of LAPTM5 on cardiomyocyte hypertrophy was markedly blocked by Rac1 (G12V) overexpression (Figure 7A). Furthermore, the mRNA levels of hypertrophic markers were altered in a similar pattern (Figure 7B). In accordance with the above results, Rac1 (G12V) expression depleted the attenuating effects of LAPTM5 on the phosphorylation levels of MEK1/2 and ERK1/2 (Figure 7C). Taken together, these results demonstrate that LAPTM5 ameliorates the development of pathological cardiac hypertrophy by interacting with Rac1 and then blocking the activation of the Rac1-dependent signaling cascade.