<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Bioeng. Biotechnol.</journal-id>
<journal-title>Frontiers in Bioengineering and Biotechnology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Bioeng. Biotechnol.</abbrev-journal-title>
<issn pub-type="epub">2296-4185</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">1355957</article-id>
<article-id pub-id-type="doi">10.3389/fbioe.2024.1355957</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Bioengineering and Biotechnology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>Application of the iPLUS non-coding sequence in improving biopharmaceuticals production</article-title>
<alt-title alt-title-type="left-running-head">Reis-Claro et al.</alt-title>
<alt-title alt-title-type="right-running-head">
<ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fbioe.2024.1355957">10.3389/fbioe.2024.1355957</ext-link>
</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Reis-Claro</surname>
<given-names>In&#xea;s</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2607018/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Silva</surname>
<given-names>Maria In&#xea;s</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2627225/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Moutinho</surname>
<given-names>Ana</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2605740/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Garcia</surname>
<given-names>Beatriz C.</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Pereira-Castro</surname>
<given-names>Isabel</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/513343/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/investigation/"/>
<role content-type="https://credit.niso.org/contributor-roles/methodology/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Moreira</surname>
<given-names>Alexandra</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/592435/overview"/>
<role content-type="https://credit.niso.org/contributor-roles/conceptualization/"/>
<role content-type="https://credit.niso.org/contributor-roles/funding-acquisition/"/>
<role content-type="https://credit.niso.org/contributor-roles/project-administration/"/>
<role content-type="https://credit.niso.org/contributor-roles/supervision/"/>
<role content-type="https://credit.niso.org/contributor-roles/writing-original-draft/"/>
<role content-type="https://credit.niso.org/contributor-roles/Writing - review &#x26; editing/"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Gene Regulation</institution>, <institution>i3S&#x2014;Instituto de Investiga&#xe7;&#xe3;o e Inova&#xe7;&#xe3;o em Sa&#xfa;de</institution>, <institution>Universidade do Porto</institution>, <addr-line>Porto</addr-line>, <country>Portugal</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>IBMC&#x2014;Instituto de Biologia Molecular e Celular</institution>, <institution>Universidade do Porto</institution>, <addr-line>Porto</addr-line>, <country>Portugal</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>ICBAS&#x2014;Instituto de Ci&#xea;ncias Biom&#xe9;dicas Abel Salazar</institution>, <institution>Universidade do Porto</institution>, <addr-line>Porto</addr-line>, <country>Portugal</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/626023/overview">Carla Silva</ext-link>, University of Minho, Portugal</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/2611998/overview">Joao C. Guimaraes</ext-link>, University of Lisbon, Portugal</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/142632/overview">Muriel Bardor</ext-link>, Universit&#xe9; de Rouen, France</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Alexandra Moreira, <email>alexandra.moreira@i3s.up.pt</email>
</corresp>
</author-notes>
<pub-date pub-type="epub">
<day>06</day>
<month>02</month>
<year>2024</year>
</pub-date>
<pub-date pub-type="collection">
<year>2024</year>
</pub-date>
<volume>12</volume>
<elocation-id>1355957</elocation-id>
<history>
<date date-type="received">
<day>14</day>
<month>12</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>25</day>
<month>01</month>
<year>2024</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2024 Reis-Claro, Silva, Moutinho, Garcia, Pereira-Castro and Moreira.</copyright-statement>
<copyright-year>2024</copyright-year>
<copyright-holder>Reis-Claro, Silva, Moutinho, Garcia, Pereira-Castro and Moreira</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>The biotechnological landscape has witnessed significant growth in biological therapeutics particularly in the field of recombinant protein production. Here we investigate the function of 3&#x2032;UTR <italic>cis</italic>-regulatory elements in increasing mRNA and protein levels in different biological therapeutics and model systems, spanning from monoclonal antibodies to mRNA vaccines. We explore the regulatory function of iPLUS - a universal sequence capable of consistently augmenting recombinant protein levels. By incorporating iPLUS in a vector to express a monoclonal antibody used in immunotherapy, in a mammalian cell line used by the industry (ExpiCHO), trastuzumab production increases by 2-fold. As yeast <italic>Pichia pastoris</italic> is widely used in the manufacture of industrial enzymes and pharmaceuticals, we then used iPLUS in tandem (3x) and iPLUSv2 (a variant of iPLUS) to provide proof-of-concept data that it increases the production of a reporter protein more than 100-fold. As iPLUS functions by also increasing mRNA levels, we hypothesize that these sequences could be used as an asset in the mRNA vaccine industry. In fact, by including iPLUSv2 downstream of Spike we were able to double its production. Moreover, the same effect was observed when we introduced iPLUSv2 downstream of MAGEC2, a tumor-specific antigen tested for cancer mRNA vaccines. Taken together, our study provides data (TLR4) showing that iPLUS may be used as a valuable asset in a variety of systems used by the biotech and biopharmaceutical industry. Our results underscore the critical role of non-coding sequences in controlling gene expression, offering a promising avenue to accelerate, enhance, and cost-effectively optimize biopharmaceutical production processes.</p>
</abstract>
<kwd-group>
<kwd>
<italic>cis</italic>-regulatory sequences</kwd>
<kwd>mRNA therapeutics</kwd>
<kwd>recombinant protein expression</kwd>
<kwd>USE</kwd>
<kwd>3&#x2032;UTR</kwd>
<kwd>iPLUS</kwd>
</kwd-group>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-at-acceptance</meta-name>
<meta-value>Industrial Biotechnology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec sec-type="intro" id="s1">
<title>1 Introduction</title>
<p>The recombinant protein production market has grown immensely over the past years, with a strong impact in biological therapeutics (<xref ref-type="bibr" rid="B43">O&#x2019;Flaherty et al., 2020</xref>; <xref ref-type="bibr" rid="B62">Tihanyi and Nyitray, 2020</xref>). Since the first time the Food and Drug Administration (FDA) approved insulin to be used as a therapeutics, 41&#xa0;years have passed and several hundred more have been approved (<xref ref-type="bibr" rid="B15">Dingermann, 2008</xref>; <xref ref-type="bibr" rid="B30">Kesik-Brodacka, 2018</xref>). Recombinant proteins of therapeutic interest include monoclonal antibodies, hormones, enzymes, among other classes of proteins and/or peptides (<xref ref-type="bibr" rid="B43">O&#x2019;Flaherty et al., 2020</xref>). Other biopharmaceutical whose importance and usage rose with the COVID-19 pandemic is the mRNA vaccines. mRNA as a therapeutics has the advantage of delivering the specific sequence of a known antigen, instructing the cells to manufacture the protein, which then culminates in an immunologic response specific for that immunogen (<xref ref-type="bibr" rid="B48">Pardi et al., 2018</xref>). Additionally, as they are simple to use and manufacture, mRNA vaccines have a variety of applications, from therapeutic vaccination for multiple cancers, to preventive immunization towards different pathogens, including new pandemics and outbreaks (<xref ref-type="bibr" rid="B54">Rauch et al., 2018</xref>).</p>
<p>The mRNAs untranslated regions (UTRs) have been known for a long time to have a crucial role in gene expression regulation (<xref ref-type="bibr" rid="B19">Gruber and Zavolan, 2019</xref>; <xref ref-type="bibr" rid="B50">Pereira-Castro and Moreira, 2021</xref>). There is a large variety of <italic>cis</italic>-regulatory elements present in the UTRs, either in the 5&#x2032; or the 3&#x2032; (<xref ref-type="bibr" rid="B37">Matoulkova et al., 2012</xref>). The 5&#x2032;UTR has an important role in translation initiation, becoming an important region for regulation of translational efficiency (<xref ref-type="bibr" rid="B26">Jackson et al., 2010</xref>). For example, the presence of the internal ribosomal entry sites (IRES) sequence in the 5&#x2032;UTR, found originally in certain virus, promotes the recruitment of the ribosomes, improving translation initiation. As so, this sequence is commonly employed in different expression systems (<xref ref-type="bibr" rid="B28">Johnson et al., 2017</xref>). The Kozak motif is also a commonly employed 9-nucleotide conserved sequence in expression vectors, as it is critical for the recognition of the translation initiation site by the ribosomes in eukaryotic mRNAs (<xref ref-type="bibr" rid="B21">Hern&#xe1;ndez et al., 2019</xref>). As for the 3&#x2032;UTRs, their ability to control the mRNA fate comes from numerous <italic>cis</italic>-regulatory elements, by allowing the binding of <italic>trans</italic>-acting factors, such as RNA-binding proteins (RBPs) and microRNAs (miRNAs) (<xref ref-type="bibr" rid="B39">Mayr, 2019</xref>). The binding of these factors will impact gene expression regulation, not only by affecting the protein expression levels, but also other important factors for the fate of the transcript, namely, its stability, subcellular localization, translation efficiency and the function of the resulting protein (<xref ref-type="bibr" rid="B38">Mayr, 2017</xref>; <xref ref-type="bibr" rid="B50">Pereira-Castro and Moreira, 2021</xref>). Usually, each 3&#x2032;UTR regulatory sequence is tested in a gene and cell-type specific context (<xref ref-type="bibr" rid="B63">Vallazza et al., 2015</xref>). Sequences from the &#x3b1;-globin and &#x3b2;-globin, for example, are highly employed in expression systems since it is known that, in a physiological context, they promote a high stability to their mRNAs (<xref ref-type="bibr" rid="B27">Jiang et al., 2006</xref>). Another example of a broadly used sequence, is the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE), a 597 nucleotide-long sequence, that has been showed to increase luciferase and GFP production levels by five to eight-fold, when subcloned in the 3&#x2032; of the cDNAs subcloned in expression vectors (<xref ref-type="bibr" rid="B68">Zufferey et al., 1999</xref>).</p>
<p>Recently, genome-wide studies have been conducted in the search for active regulatory sequences naturally present in the genomes, reveling new sequences that may be employed in the production of recombinant proteins of high commercial value by the biopharma and biotech industries (<xref ref-type="bibr" rid="B56">Sample et al., 2019</xref>; <xref ref-type="bibr" rid="B4">Cao et al., 2021</xref>; <xref ref-type="bibr" rid="B35">Leppek et al., 2022</xref>; <xref ref-type="bibr" rid="B32">Kirshina et al., 2023</xref>). For the 5&#x2032;UTR, <xref ref-type="bibr" rid="B4">Cao et al. (2021)</xref> employed high-throughput screening in combination with sequence engineering, by initially analyzing 5&#x2032;UTRs that naturally reveal good translation efficiencies, followed by synthetic modification of these sequences to improve their effectiveness even further. The results obtained were validated in several cell models and the increase of protein expression was corroborated also in proteins with therapeutic value, such as vascular endothelial growth factor (VEGF). This approach has also been applied to the search for regulatory regions in the 3&#x2032;UTR, also in the context of mRNA-based therapeutics, such as cancer vaccines, by increasing the mRNA stability and protein expression (<xref ref-type="bibr" rid="B35">Leppek et al., 2022</xref>; <xref ref-type="bibr" rid="B32">Kirshina et al., 2023</xref>). For example, the application of a combination of mtRNR1 (mitochondrial rRNA) and AES (Amino-Terminal Enhancer Of Split) 3&#x2032;UTR sequences, promoted a T cell immune response against a vaccine antigen, as well as an increase in the delivery of reprogramming factors to induce pluripotency of differentiated cells (<xref ref-type="bibr" rid="B46">Orlandini von Niessen et al., 2019</xref>). These efforts to find new non-coding regulatory sequences reveal a yet unexplored field to optimize the expression vectors used in the production of biological therapeutics.</p>
<p>Certainly, <italic>cis</italic>-regulatory sequences present in the UTRs can be used to increase mRNA expression, as well as protein production, either in large scale as for recombinant protein production, or in the cells in the context of an immunization with an mRNA vaccine (<xref ref-type="bibr" rid="B18">G&#xf3;mez-Aguado et al., 2020</xref>). For example, the human albumin 3&#x2032;UTR increases the production of secreted luciferase by 2-3 fold in CHO cells (<xref ref-type="bibr" rid="B49">Pearson et al., 2012</xref>). The structure of the mRNAs in the vaccines mimics endogenous mRNAs (<xref ref-type="bibr" rid="B48">Pardi et al., 2018</xref>) and their design has been optimized to elicit a strong and specific immunological response. Delivery of the mRNA vaccines must promote the antigen&#x2019;s expression at levels sufficient for detection of immune responses (<xref ref-type="bibr" rid="B29">Karik&#xf3; et al., 1999</xref>). Thus, 5&#x2032;UTR and 3&#x2032;UTR secondary structures, 3&#x2032;UTR length, and different <italic>cis</italic>-regulatory elements present in both the 3&#x2032;UTR and 5&#x2032;UTR contribute to achieve high expression levels (<xref ref-type="bibr" rid="B18">G&#xf3;mez-Aguado et al., 2020</xref>; <xref ref-type="bibr" rid="B25">Jackson et al., 2020</xref>; <xref ref-type="bibr" rid="B7">Castillo-Hair and Seelig, 2022</xref>).</p>
<p>The upstream sequence elements (USEs), located upstream of polyadenylation signals (PAS), are a good example of <italic>cis</italic>-regulatory sequences present in the 3&#x2032;UTR. USEs are involved in cleavage and polyadenylation (CPA) efficiency, by allowing the binding of the CPA machinery (<xref ref-type="bibr" rid="B67">Zhao et al., 1999</xref>; <xref ref-type="bibr" rid="B53">Proudfoot, 2011</xref>; <xref ref-type="bibr" rid="B13">Darmon and Lutz, 2012</xref>; <xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>). USEs possess a characteristic pyrimidine and/or U-rich stretch (<xref ref-type="bibr" rid="B8">Chan et al., 2011</xref>) and function as binding sites for various RBPs, modulating gene expression (<xref ref-type="bibr" rid="B5">Carswell and Alwine, 1989</xref>; <xref ref-type="bibr" rid="B41">Moreira et al., 1998</xref>; <xref ref-type="bibr" rid="B12">Danckwardt et al., 2007</xref>). Therefore, USEs have the potential to be employed in different applications besides their physiological role in CPA. For example, the subcloning of different USEs in viral vectors was tested to improve their 3&#x2032;end processing efficiency by avoiding readthrough, consequently increasing both their efficiency and biosafety (<xref ref-type="bibr" rid="B58">Schambach et al., 2007</xref>). Also, it was demonstrated that the use of the USE SV40-derived sequence, as well as its repetition in tandem 2 times, led to an increase of 45%&#x2013;100% in gene expression, depending on the promoters used (<xref ref-type="bibr" rid="B58">Schambach et al., 2007</xref>).</p>
<p>We have previously found that <italic>Drosophila</italic>&#x2019;s <italic>polo</italic> gene possesses a USE upstream of a weak PAS, highly conserved among <italic>Drosophila</italic> genomes (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>). This 28-nucleotides long, pyrimidine-rich USE presents a physiological role in increasing Polo&#x2019;s protein levels (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>). This result led us to hypothesize that this mechanism is conserved, therefore, its function was investigated in proof-of-concept experiments in other genes and organisms. In <italic>Danio rerio</italic>, the microinjection of a plasmid containing this USE downstream of the green fluorescent protein (GFP) was used as a reporter and showed that the USE increases GFP expression levels by &#x223c;2-fold, indicating that the function of the USE is conserved in vertebrates (<xref ref-type="bibr" rid="B17">Eufr&#xe1;sio et al., 2023</xref>). We found that three RBPs (HuR, hnRNP C and PTBP1) bind to the USE in human cells, and in <italic>Drosophila,</italic> Hephaestus (the ortholog of the human PTBP1), enhances the use of the PAS through interaction with <italic>polo</italic>&#xb4;s USE leading to higher mRNA and protein levels (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>; <xref ref-type="bibr" rid="B17">Eufr&#xe1;sio et al., 2023</xref>). In mammalian cell lines, specifically HeLa cells, it has previously been shown that this sequence led to an increase in a reporter&#x2019;s activity (<xref ref-type="bibr" rid="B17">Eufr&#xe1;sio et al., 2023</xref>).</p>
<p>The consistent increase in protein levels observed when <italic>polo</italic>&#x2019;s USE was inserted in the 3&#x2032;UTR led us to secure its potential in biopharmaceutical&#x2019;s formulations usage, patenting it as iPLUS, which stands for increase Protein Levels Universal Sequence (<xref ref-type="bibr" rid="B44">Oliveira et al., 2020</xref>). iPLUS fits in the need for non-coding regulatory regions to improve effectiveness of gene expression, as the biopharmaceutical and biotechnology industries requires their improvement in the manufacture processes with the goal of lowering production costs.</p>
<p>In this work we explored the potentialities of iPLUS in increasing the efficiency of mRNA and protein production for different biopharmaceuticals. We demonstrated that iPLUS, and a variant of this sequence that we named iPLUSv2, which consists of 3 repeats of the most conserved 8 nucleotide sequence stretch of iPLUS/USE (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>) increases mRNA and protein levels in different models and for various proteins of biopharmaceutical interest. These results reinforce the importance of 3&#x2032; non-coding sequences in the regulation of gene expression, highlighting their potential use in the process of manufacture to accelerate, improve and reduce the costs of the biopharmaceutical&#x2019;s production.</p>
</sec>
<sec sec-type="materials|methods" id="s2">
<title>2 Materials and methods</title>
<sec id="s2-1">
<title>2.1 Plasmids construction</title>
<sec id="s2-1-1">
<title>2.1.1 Trastuzumab_LC and HC</title>
<p>The plasmid pcDNA3.4-TOPO (Thermo Fisher Scientific) was used as a backbone to subclone the trastuzumab <italic>LC</italic> (light chain) and <italic>HC</italic> (heavy chain) upstream of the WPRE sequence. The pcDNA3.4-TOPO was digested with <italic>Age</italic>I-HF (NEB), the restriction site was blunted using Klenow (NEB), followed by digestion with <italic>Xba</italic>I (NEB). <italic>LC</italic> and <italic>HC</italic> were amplified by PCR using the phosphorylated primer pair LC&#x2b;XbaI F; LC-R and HC&#x2b;XbaI F; HC-R (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>), pVITRO1-Trastuzumab-IgG1/&#x3ba; [a gift from Andrew Beavil, Addgene plasmid &#x23;61883 (<xref ref-type="bibr" rid="B16">Dodev et al., 2014</xref>)] as the template DNA, and Phusion High Fidelity DNA polymerase (ThermoFisher Scientific) following manufacturer recommendations, for cloning in pcDNA3.4-TOPO in the <italic>Xba</italic>I and blunted <italic>Age</italic>I restriction sites.</p>
</sec>
<sec id="s2-1-2">
<title>2.1.2 Trastuzumab_LC_iPLUS</title>
<p>Firstly, pGEM-4 (Promega) digested with <italic>Sac</italic>I (NEB) and <italic>Kpn</italic>I (NEB) was used to subclone the annealead oligos containing iPLUS sequence (AATTTATTTGTTTTTGCCCCTTCCCCTT&#x2014;<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) flanked by digested <italic>Sac</italic>I and <italic>Kpn</italic>I restriction sites (pGEM-4-iPLUS). pGEM-4-iPLUS was digested with <italic>BamH</italic>I (NEB) and <italic>EcoR</italic>I (NEB) in order to obtain the iPLUS sequence. Trastuzumab_LC was linearized by an inverted PCR using WPRE&#x2b;BamHI-F and WPRE&#x2b;EcoRI-R primers (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) and Phusion High Fidelity DNA polymerase (Thermo Fisher Scientific). Linearized plasmid was digested with <italic>BamH</italic>I and <italic>EcoR</italic>I to clone the iPLUS sequence downstream of the WPRE sequence and upstream the HSV TK PAS.</p>
</sec>
<sec id="s2-1-3">
<title>2.1.3 Trastuzumab_HC_iPLUS</title>
<p>An inverted PCR using Trastuzumab_HC was performed as for Trastuzumab_LC_iPLUS. To obtain Trastuzumab_HC_iPLUS, the linearized plasmid and pGEM-4-iPLUS were digested with <italic>Kpn</italic>I and the restriction site was blunted using Klenow, followed by <italic>EcoR</italic>I digestion.</p>
</sec>
<sec id="s2-1-4">
<title>2.1.4 pTZ-p04_GFP_iPLUS 3X and pTZ-p04_GFP_iPLUSv2</title>
<p>The pTZ-p04_GFP was already prepared and is a proprietary vector of Trenzyme GmbH. The iPLUS 3X (iPLUS in tandem three times) and iPLUSv2 (TTG&#x200b;TTT&#x200b;TTT&#x200b;TGT&#x200b;TTT&#x200b;TTT&#x200b;GTT&#x200b;TTT) inserts were made by Trenzyme by primer design with flanking restriction sites followed by PCR amplification for cloning downstream of the GFP coding sequence in the <italic>Pichia</italic> expression vector pTZ-p04_GFP.</p>
</sec>
<sec id="s2-1-5">
<title>2.1.5 Spike</title>
<p>The CoV2-Spike-D614G plasmid [a gift from Jennifer Doudna, Addgene plasmid &#x23;177960; (<xref ref-type="bibr" rid="B61">Syed et al., 2021</xref>)], containing Spike&#x2019;s coding sequence from the Wuhan variant of SARS-Cov-2, was used for the preparation of the Spike&#x2019;s cDNA by digestion with <italic>Sac</italic>I and <italic>Xho</italic>I (NEB) and creating blunt ends using Klenow. The Trastuzumab_LC_iPLUS was digested with <italic>EcoR</italic>V (NEB) and <italic>Xba</italic>I (NEB), followed by blunting with Klenow to remove trastuzumab LC and insert Spike cDNA (Spike_iPLUS). The iPLUS sequence was removed by <italic>EcoR</italic>V and <italic>Xba</italic>I digestion, followed by blunting with Klenow and re-ligation of the plasmid.</p>
</sec>
<sec id="s2-1-6">
<title>2.1.6 Spike_iPLUSv2</title>
<p>The Spike_iPLUS plasmid was used as backbone for the preparation of the vectors containing iPLUSv2 by removal of iPLUS by digestion with <italic>EcoR</italic>I and <italic>Kpn</italic>I. For the iPLUSv2 preparation, pGEM-4 (Promega) digested with <italic>Sac</italic>I and <italic>Kpn</italic>I was used to subclone the annealead oligos containing iPLUSv2 sequence (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) flanked by digested <italic>Sac</italic>I and <italic>Kpn</italic>I restriction sites (pGEM-4-iPLUSv2). A PCR amplification of the pGEM4_iPLUSv2 was performed to obtain iPLUSv2 using pGEM4-F and pGEM4-R primers (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) and the PCR product was digested with <italic>EcoR</italic>I and <italic>Kpn</italic>I and cloned in the digested Spike_iPLUS plasmid backbone to obtain Spike_iPLUSv2.</p>
</sec>
<sec id="s2-1-7">
<title>2.1.7 MAGEC2</title>
<p>The pDONR223_MAGEC2_WT [a gift from Jesse Boehm &#x26; William Hahn &#x26; David Root, Addgene plasmid &#x23;81862; (<xref ref-type="bibr" rid="B31">Kim et al., 2016</xref>)] was used as template to amplify <italic>MAGEC2</italic> by PCR using MAGEC2_F_XbaI and MAGEC2_R_EcoRV primers (<xref ref-type="sec" rid="s11">Supplementary Table S1</xref>). The purified PCR product was digested with <italic>Xba</italic>I and <italic>EcoR</italic>V and cloned in the Trastuzumab_LC plasmid digested with the same restriction enzymes to remove <italic>LC</italic> and insert <italic>MAGEC2</italic>.</p>
</sec>
<sec id="s2-1-8">
<title>2.1.8 MAGEC2_iPLUSv2</title>
<p>An inverse PCR was performed using primers containing the iPLUSv2 sequence (MAGEC2_inv_F and MAGEC2_inv_R; <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) using MAGEC2 as DNA template. PCR products were treated with <italic>Dpn</italic>I (NEB) to eliminate parental DNA and ligated using T4 DNA ligase (NEB).</p>
<p>Sanger Sequencing was performed at the i3S Genomic Core Facility using the 3500 Genetic Analyzer sequencer (Applied Biosystems) to confirm that all vectors used in this study had the correct sequence.</p>
</sec>
</sec>
<sec id="s2-2">
<title>2.2 Cell culture</title>
<p>HeLa cells were grown and maintained with Dulbecco&#x2019;s Modified Eagle Medium (DMEM) with GlutaMAX (Gibco, Thermo Fisher Scientific), supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific) and 1% penicillin-streptomycin solution (Gibco, Thermo Fisher Scientific). Cells were maintained in an incubator at 37&#xb0;C, with 5% CO<sub>2</sub>, and were subcultured every 3&#x2013;4&#xa0;days.</p>
<p>ExpiCHO-S cell line (Thermo Fisher Scientific) was maintained in 30&#xa0;mL of ExpiCHO Expression Medium (Gibco, Thermo Fisher Scientific), in 125&#xa0;mL Nalgene Single-Use PETG Erlenmeyer Flasks with Plain Bottom (Thermo Fisher Scientific). Cells were kept in an incubator at 37&#xb0;C, with 8% CO<sub>2</sub> and 80% of relative humidity, with agitation at 125&#xa0;rpm. When cells reached a concentration between 4 &#xd7; 10<sup>6</sup> and 6 &#xd7; 10<sup>6</sup> viable cells/mL, routine splitting to the desired dilution was performed, following the manufactures procedure.</p>
</sec>
<sec id="s2-3">
<title>2.3 Cell transfection</title>
<p>HeLa cells were transfected with the different vectors using Lipofectamine 2000 reagent (Thermo Fisher Scientific). For that, HeLa cells were seeded in 24-well plates, in a concentration that allowed them to reach 70%&#x2013;90% confluency in the following day. For transfections, 1&#xa0;&#xb5;L of Lipofectamine 2000 and 500&#xa0;ng of each plasmid was diluted in Opti-MEM (Thermo Fisher Scientific), following the manufacturer&#x2019;s protocol. Cells were allowed to grow at 37&#xb0;C for 48&#xa0;h, after which they were collected and processed, either for total RNA or protein extraction. ExpiCHO-S cells were transfected using ExpiFectamine CHO reagent (Thermo Fisher Scientific), following the manufacturer&#x2019;s protocol. In the day prior to transfection (day &#x2212;1), cells were diluted to a final density of 4 &#xd7; 10<sup>6</sup> viable cells/mL, in order to reach a density of 7 &#xd7; 10<sup>6</sup>&#x2013;10 &#xd7; 10<sup>6</sup> viable cells/mL in the following day (day 0). On the day of transfection, cell viability was assessed, and cells were split to a concentration of 6 &#xd7; 10<sup>6</sup> viable cells/mL in a 25&#xa0;mL final volume. Cells were transfected with 20&#xa0;&#x3bc;g of plasmid DNA in a final volume of 20&#xa0;&#x3bc;L and, for Transtuzumab constructs, a 2:1 LC:HC ratio was followed. Following the Standard Protocol for transfection, ExpiFectamine CHO Enhancer and ExpiCHO Feed (Thermo Fisher Scientific) were added the day after transfection (day 1) and cells were kept at 37&#xb0;C with 8% CO<sub>2</sub> for the remaining 9&#xa0;days. At the time of cell harvest for downstream analysis, cell viability was at least 75%.</p>
</sec>
<sec id="s2-4">
<title>2.4 RNA extraction</title>
<p>Total RNA extraction was performed using TRIzol Reagent (Ambion by Life Technologies) following the manufacturer&#x2019;s standard protocol, with the exception that all RNA precipitations were carried out at &#x2212;80&#xb0;C, during at least 2&#xa0;h, and using 1&#xa0;&#x3bc;L of glycogen (15&#xa0;mg/mL; Roche). Quantification and quality assessment of RNA was performed using the Nanodrop 1000 Spectrophotometer (Thermo Fisher Scientific). RNA samples were stored at &#x2212;80&#xb0;C until further use.</p>
</sec>
<sec id="s2-5">
<title>2.5 DNase I treatment</title>
<p>To eliminate any potential contamination from genomic and/or plasmid DNA in the RNA samples, these were incubated with DNase I (Roche) for 2&#xa0;h at 37&#xb0;C following the manufacturer protocol.</p>
</sec>
<sec id="s2-6">
<title>2.6 cDNA synthesis</title>
<p>Following DNase I treatment, 1&#xa0;&#xb5;L of Random Hexamers (50&#xa0;&#xb5;M) and 1&#xa0;&#xb5;L of dNTPs mix (10&#xa0;nM each) (Thermo Fisher Scientific) were added and samples were incubated at 65&#xb0;C for 5&#xa0;min followed by 5&#xa0;min at 4&#xb0;C. After that, 4&#xa0;&#xb5;L of 5x SSIV Buffer (Invitrogen), 1&#xa0;&#xb5;L of dithiothreitol (DTT; 100&#xa0;mM; Invitrogen), 0.5&#xa0;&#xb5;L of Ribolock Recombinant RNase Inhibitor (40&#xa0;U/&#xb5;L; Thermo Fisher Scientific), and 0.5&#xa0;&#xb5;L of Superscript IV (SSIV) Reverse Transcriptase (200&#xa0;U/&#xb5;L; Invitrogen) were added to each sample. As a negative control to detect genomic DNA, the same mixtures were prepared for each sample, but without the addition of SSIV RT (-RT). Samples were incubated for 10&#xa0;min at 23&#xb0;C, 10&#xa0;min at 55&#xb0;C, and finally, 10&#xa0;min at 80&#xb0;C to inactivate the enzyme. Samples were stored at &#x2212;20&#xb0;C until further use.</p>
</sec>
<sec id="s2-7">
<title>2.7 Reverse transcription quantitative real-time PCR (RT-qPCR)</title>
<p>RT-qPCRs were prepared using 1&#xa0;&#x3bc;L of cDNA and 9&#xa0;&#x3bc;L of a mixture containing 5&#xa0;&#x3bc;L of 2x SYBR Select Master Mix (Applied Biosystems), 0.125&#xa0;&#x3bc;L (0.125&#xa0;&#x3bc;M) of each primer (listed in <xref ref-type="sec" rid="s11">Supplementary Table S1</xref>) and 3.75&#xa0;&#x3bc;L of nuclease-free water. Samples were run in triplicate on a 7500 Fast Real-Time PCR System (Applied Biosystems), using the program: 50&#xb0;C for 2&#xa0;min, 95&#xb0;C for 2&#xa0;min; 40 cycles at 95&#xb0;C for 15&#xa0;s, 60&#xb0;C for 1&#xa0;min followed by a melt curve stage. Non-template controls and -RT samples were also used in each experiment. Results were analyzed using the &#x394;&#x394;Ct method (Normalized fold expression) using <italic>ACTB</italic> (for ExpiCHO-S cells) or <italic>18S</italic> (for HeLa cells) reference genes to normalize gene expression (<xref ref-type="bibr" rid="B51">Pfaffl, 2001</xref>).</p>
</sec>
<sec id="s2-8">
<title>2.8 Enzyme-linked immunosorbent assay (ELISA)</title>
<p>For recombinant trastuzumab protein quantification, the human IgG (total) uncoated ELISA kit with plates (Invitrogen) was used. For sample preparation, ExpiCHO-S cells were collected and centrifuged at 4,000&#xa0;<italic>g</italic> for 30&#xa0;min. The supernatant containing the recombinant protein was recovered and used for the ELISA protocol using 1:250 or 1:500 dilutions. For each condition, duplicates were made and non-transfected cells were used as negative controls. The ELISA manufacturer&#x2019;s protocol was followed and the 96-well plate was read at 450&#xa0;nm and 630&#xa0;nm in a Synergy2 plate reader (BioTek).</p>
</sec>
<sec id="s2-9">
<title>2.9 Western blot</title>
<p>Whole-cell protein extracts were obtained by cell lysis with NP-40 cell lysis buffer (50&#xa0;mM Tris&#x2013;HCl pH 8.0, 150&#xa0;mM NaCl, 1% NP-40), supplemented with 1x protease inhibitor cocktail (Sigma, P8340). Protein extracts were quantified using the Quick Bradford reagent (Bio-Rad) and 20&#x2013;40&#xa0;&#xb5;g were added to Laemmli Buffer 2x (Bio-Rad) with 5% of &#x3b2;-mercaptoethanol in a 1:1 ratio, and boiled for 5&#xa0;min at 95&#xb0;C. Samples were run in a 3% stacking and 10% resolving Tris-glycine SDS-polyacrylamide gel and transferred into a nitrocellulose membrane, using a dry transfer method with the iBlot Gel Transfer Device (Thermo Fisher Scientific). The membrane was incubated with the respective primary antibody diluted in TBS-0.1% Tween 20 containing 5% non-fat dried milk, followed by three washes with TBS-0.1% Tween 20 and incubation with the appropriate secondary antibody. The antibodies used in this study were: anti-SARS-CoV-2 Spike mouse monoclonal antibody (1A9; GeneTex; 1:2,000 dilution), anti-&#x3b1;-tubulin mouse monoclonal antibody (B-5-1-2; Sigma; 1:150,000 dilution), anti-GAPDH mouse monoclonal antibody (ab8245; Abcam; 1:1,500,000 dilution), recombinant anti-MAGEC2 antibody (ab209667; Abcam; 1:2,500 dilution), goat anti-mouse IgG-HRP secondary antibody (Santa Cruz Biotechnologies; 1:10,000 dilution) and goat anti-rabbit IgG-HRP secondary antibody (Santa Cruz Biotechnologies; 1:10,000 dilution). Detection was achieved using enhanced chemiluminescence (ECL Prime, GE Healthcare) and the immunoblots were visualized on the ChemiDoc XRS &#x2b; System (Bio-Rad). Quantification of the protein intensity was performed using the Image lab Software (Bio-Rad).</p>
</sec>
<sec id="s2-10">
<title>2.10 Recombinant GFP protein expression in <italic>Pichia pastoris</italic>
</title>
<p>These experiments were done as a subcontracted service by Trenzyme GmbH (Konstanz, Germany). After transformation of the expression vectors pTZ_P04_GFP (control plasmid without iPLUS sequences), pTZ_P04_GFP_iPLUS 3X and pTZ_P04_GFP_iPLUSv2 into <italic>Pichia pastoris</italic> strain KM71H, positive integrants (stable clones) were selected by their ability to grow in presence of Zeocin. After confirmation of proper integration at the <italic>AOX</italic> locus by PCR based methods, five stable clones per construct were analyzed in duplicates for their ability to synthesize GFP after induction with methanol (0.5% methanol every 24&#xa0;h) in a 72&#xa0;h experiment. Screening process was done in a microbioreactor system (BioLector, equipped with 48-well &#x201c;flower plates&#x201d;) in 48 -well format, sample volume up to 1,000&#xa0;&#xb5;L per well in all clones in parallel.</p>
</sec>
<sec id="s2-11">
<title>2.11 Statistical analyses</title>
<p>Data are presented in the graphs as mean &#xb1; SD (standard deviation) and are from three independent experiments. Statistical differences were tested using two-tailed unpaired t-test. Only <italic>p</italic>-values &#x3c;0.05 were considered statistically significant. All graphs were done using GraphPad Prism version 8.01 (GraphPad Software).</p>
</sec>
</sec>
<sec sec-type="results" id="s3">
<title>3 Results</title>
<sec id="s3-1">
<title>3.1 Incorporation of iPLUS in a mammalian expression vector doubles the production of trastuzumab, a recombinant monoclonal antibody used in cancer immunotherapy</title>
<p>The value of the biopharmaceutical industry has been pushed by the recombinant monoclonal antibodies (mAbs) market (<xref ref-type="bibr" rid="B65">Walsh, 2018</xref>). Therefore, we applied iPLUS to the production of trastuzumab, a human recombinant monoclonal antibody used in cancer immunotherapy (<xref ref-type="bibr" rid="B1">Albanell and Baselga, 1999</xref>; <xref ref-type="bibr" rid="B34">Krasniqi et al., 2019</xref>). As other mAbs, trastuzumab is composed of four polypeptide chains: two identical light chains (LC) and two identical heavy chains (HC), bound by covalent bonds, mainly disulfide bonds, forming a heterodimeric Y-shaped structure (<xref ref-type="bibr" rid="B6">Castelli et al., 2019</xref>). We started by subcloning trastuzumab LC and HC chains separately in the pcDNA3.4 expression vector (<xref ref-type="fig" rid="F1">Figure 1A</xref>). We chose pcDNA3.4 as it is widely used in industrial settings for monoclonal antibodies production (<xref ref-type="bibr" rid="B33">Kosuge et al., 2020</xref>). This vector contains a full-length CMV promoter that drives high levels of expression, and was modified by the vector&#x2019;s industry (Thermo Fisher Scientific) to include the WPRE downstream of the multiple cloning site, which increases the expression of several proteins, such as GFP and luciferase (<xref ref-type="bibr" rid="B68">Zufferey et al., 1999</xref>).</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>iPLUS doubles trastuzumab recombinant protein levels. <bold>(A)</bold> Schematic representation of the constructs containing the light chain (LC) and heavy chain (HC) of trastuzumab, as well as the constructs with the iPLUS sequence, transfected in ExpiCHO-S cells. All vectors contain a full-length cytomegalovirus (CMV) promoter and the herpes simplex virus type 1 thymidine kinase polyadenylation signal (HSV TK PAS). The 28-nucleotide iPLUS sequence is depicted in the constructs scheme. <bold>(B)</bold> Trastuzumab <italic>LC</italic> and <italic>HC</italic> mRNA levels were assessed by RT-qPCR and normalized to <italic>ACTB</italic>. Fold change to LC and HC constructs without iPLUS are represented. Data is represented as mean &#xb1; standard deviation (SD) of three independent experiments. Statistical analyses to identify differences were conducted using a two-tailed unpaired t-test. <bold>(C)</bold> Trastuzumab protein levels were measured by ELISA to human total IgG, and fold change trastuzumab without iPLUS is shown. Data is represented as mean &#xb1; standard deviation (SD) of three independent experiments. Statistical analyses to identify differences were conducted using a two-tailed unpaired t-test. Significant <italic>p</italic>-value is indicated in the graph by asterisks (&#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001).</p>
</caption>
<graphic xlink:href="fbioe-12-1355957-g001.tif"/>
</fig>
<p>Our hypothesis was that the inclusion of the iPLUS in the pcDNA3.4 expression vector could further improve the yield of production. We thus incorporated in the LC and HC containing vectors the 28-nucleotide long iPLUS non-coding sequence downstream of WPRE and upstream of the herpes simplex virus (HSV) type 1 thymidine kinase (TK) PAS (<xref ref-type="fig" rid="F1">Figure 1A</xref>). Co-transfection of LC:HC antibody chains containing vectors with and without iPLUS was performed in ExpiCHO-S cells and antibody protein levels were quantified by an IgG ELISA assay and mRNA levels evaluated by RT-qPCR. ExpiCHO-S cells were selected as they are commonly used in the biopharmaceutical industries for therapeutic recombinant protein production due to their ability to survive in animal-component-free medium and grow in suspension at high densities. As can be observed in <xref ref-type="fig" rid="F1">Figure 1B</xref>, vectors containing iPLUS result in an increase in <italic>LC</italic> and <italic>HC</italic> mRNA levels, as well as in a 2.2-fold increase in trastuzumab protein levels (<xref ref-type="fig" rid="F1">Figure 1C</xref>). These results show that iPLUS doubles the production of this important therapeutic monoclonal antibody at the laboratory scale.</p>
</sec>
<sec id="s3-2">
<title>3.2 iPLUS 3X and the iPLUS variant sequence iPLUSv2 highly improve recombinant protein expression levels in <italic>Pichia pastoris</italic>
</title>
<p>The next step was to evaluate the use of iPLUS in yeast. <italic>Pichia pastoris</italic> may use methanol as a carbon source, allowing the induction of protein expression in a highly controlled manner through the AOX1 promoter, making it especially suitable for large-scale and industrial applications. In fact, <italic>Pichia</italic> is widely used by the biopharmaceutical industry to produce recombinant proteins (<xref ref-type="bibr" rid="B10">Cregg et al., 2000</xref>).</p>
<p>We used the GFP reporter protein as a read-out for the use of iPLUS in <italic>Pichia pastoris</italic>, and started by making GFP constructs with and without iPLUS (GFP-control) sequences by gene synthesis. The iPLUS constructs contained the iPLUS sequence in tandem 3X (iPLUS 3X), to test if the inclusion of several iPLUS repeats would increase protein levels, and a variant sequence of iPLUS (iPLUSv2), which corresponds to the most conserved region of the iPLUS contained in <italic>Drosophila</italic>&#x2019;s <italic>polo</italic> gene (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>), also repeated 3 times (<xref ref-type="fig" rid="F2">Figure 2A</xref>). These sequences were then cloned into a <italic>Pichia</italic> expression vector having GFP under the control of methanol inducible AOX promoter (<xref ref-type="fig" rid="F2">Figure 2A</xref>). After <italic>Pichia</italic> transformation with the different constructs, five stable clones (positive integrants) of each construct were selected and analyzed for their ability to synthesize GFP after induction with methanol. The parallel screening of all clones in a microbioreactor system demonstrates that both iPLUS 3X (<xref ref-type="fig" rid="F2">Figure 2B</xref>) and iPLUSv2 (<xref ref-type="fig" rid="F2">Figure 2C</xref>) can significantly increase GFP expression in <italic>Pichia</italic>. In comparison to the control GFP without any iPLUS sequence (<xref ref-type="sec" rid="s11">Supplementary Figure S1</xref>), the best performing clones showed an increase in GFP expression of 114-fold for iPLUS 3X and 303-fold for iPLUSv2.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>iPLUS 3X and iPLUSv2 boost GFP expression levels in <italic>Pichia pastoris.</italic> <bold>(A)</bold> Scheme of the <italic>Pichia pastoris</italic> pTZ_p04 expression constructs containing the GFP coding sequence, as well as the constructs with the iPLUS sequence in tandem 3X and the iPLUS variant iPLUSv2. All pTZ_p04 vectors contain a methanol inducible alcohol oxidase gene I (AOX) promoter and an AOX terminator. The 84-nucleotide iPLUS 3X sequence and the 24-nucleotide iPLUSv2 sequence introduced downstream the GFP coding sequence are depicted in the constructs. <bold>(B)</bold> Both iPLUS 3X and <bold>(C)</bold> iPLUSv2 increase GFP expression in <italic>Pichia</italic>. Five different <italic>Pichia</italic> stable clones for iPLUS 3X <bold>(B)</bold> and iPLUSv2 <bold>(C)</bold> were analysed in duplicates (replicates 1 and 2) in a microbioreactor system for their ability to synthesize GFP after induction with 0.5% methanol at 24 and 48&#xa0;h time-points. iPLUS containing constructs show a strong increase in GFP expression, 114-fold for iPLUS 3X and 303-fold for iPLUSv2, in the best performing clones (clones &#x23;7), in comparison with the control clone expressing GFP (GFP-control; light green).</p>
</caption>
<graphic xlink:href="fbioe-12-1355957-g002.tif"/>
</fig>
<p>This proof-of-concept experiment underscore the versatility and efficacy of iPLUS and reveals that different iPLUS variants, such as the new iPLUSv2, enhance protein production in <italic>Pichia pastoris</italic> expression systems. Furthermore, it clearly shows that iPLUS may be a valuable asset for the improvement of <italic>Pichia</italic> expression vectors with biopharmaceutical applications.</p>
</sec>
<sec id="s3-3">
<title>3.3 iPLUSv2 enhances Spike&#x2019;s mRNA and protein levels in different cell lines</title>
<p>In the post COVID-19 pandemic landscape, mRNA vaccines are positioned as a dynamic and groundbreaking technology platform for addressing global health threats (<xref ref-type="bibr" rid="B36">Lorentzen et al., 2022</xref>). However, moving from a novel technology to a cornerstone of vaccination strategies in a short time opens space for improvements, such as in the capacity of increasing antigen production levels.</p>
<p>Given our results in improving trastuzumab expression in mammalian cells, as well as with the new variant iPLUSv2 in <italic>Pichia</italic>, we hypothesized that the inclusion of the new activator sequence, iPLUSv2, in the 3&#x2032;end of Spike&#x2019;s coding sequence could be a valuable asset for the mRNA vaccine technology. In fact, the inclusion of <italic>cis</italic>-regulatory sequences in the 3&#x2032; end of Spike was also applied by Moderna and Pfizer in their COVID-19 mRNA vaccines (<xref ref-type="bibr" rid="B66">Xia, 2021</xref>).</p>
<p>As in the trastuzumab experiments, the pcDNA3.4 constructs were used (<xref ref-type="fig" rid="F3">Figure 3A</xref>), with iPLUSv2 downstream of Spike. We tested two different cell lines, HeLa and ExpiCHO-S. Human HeLa cells are excellent models for proof-of-concept experiments, due to their easiness in manipulation and analyses. ExpiCHO-S cells were selected not only because they are commonly used by the industry but also as iPLUS increases trastuzumab expression in these cells (<xref ref-type="fig" rid="F1">Figure 1</xref>).</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>iPLUSv2 leads to an increase in Spike&#x2019;s mRNA levels and protein production, in both HeLa and ExpiCHO-S cell lines. <bold>(A)</bold> Schematic representation of the constructs containing Spike&#x2019;s cDNA and the iPLUS variant, iPLUSv2. Additionally, these vectors contain a full-length CMV promoter and the HSV TK PAS. These vectors were used for HeLa and ExpiCHO-S cells transfection, after which protein was quantified and mRNA levels were measured. <bold>(B)</bold> Spike&#x2019;s mRNA levels were measured by RT-qPCR after HeLa cells transfection and normalized to the housekeeping <italic>18S</italic>. Fold change was calculated in relation to Spike. Data are shown as mean &#x2b; standard deviation (SD) for three different experiments (<italic>n</italic> &#x3d; 3). Statistical significancy was determined by two-tailed unpaired t-test. <bold>(C)</bold> Representative image of Spike&#x2019;s protein levels evaluated by Western blot after HeLa cells transfection, being the protein quantification levels plotted for each condition, for three independent experiments (<italic>n</italic> &#x3d; 3) in <bold>(D)</bold>. <bold>(D)</bold> Spike&#x2019;s protein quantification was calculated using &#x3b1;-Tubulin as the loading control for normalization, followed by fold change analyses, normalized to Spike. Data are shown as mean &#x2b; standard deviation (SD). Statistical significancy was determined by two-tailed unpaired t-test. <bold>(E)</bold> Spike&#x2019;s mRNA levels were measured by RT-qPCR after ExpiCHO-S cells transfection and normalized to the housekeeping hACTB. Fold change was calculated in relation to Spike. Data are shown as mean &#x2b; standard deviation (SD) for three different experiments (<italic>n</italic> &#x3d; 3). Statistical significancy was determined by two-tailed unpaired t-test. <bold>(F)</bold> Representative image of Spike&#x2019;s protein levels evaluated by Western blot after ExpiCHO-S cells transfection, being the protein quantification levels plotted for each condition, for three independent experiments (<italic>n</italic> &#x3d; 3) in <bold>(G)</bold>. <bold>(G)</bold> Spike&#x2019;s protein quantification was calculated using GAPDH as the loading control for normalization, followed by fold change analyses, normalized to Spike. Data are shown as mean &#x2b; standard deviation (SD). Statistical significancy was determined by two-tailed unpaired t-test. Significant <italic>p</italic>-value is indicated in the graph by asterisks (&#x2a;<italic>p</italic> &#x3c; 0.05 and &#x2a;&#x2a;<italic>p</italic> &#x3c; 0.01).</p>
</caption>
<graphic xlink:href="fbioe-12-1355957-g003.tif"/>
</fig>
<p>As observed previously for <italic>Pichia</italic> (<xref ref-type="fig" rid="F2">Figure 2</xref>), in HeLa cells the inclusion of iPLUSv2 leads to an increase in both mRNA and protein levels of Spike (<xref ref-type="fig" rid="F3">Figures 3B&#x2013;D</xref>), in comparison to the control vector without iPLUSv2. For the protein levels, this increase is approximately 2.1-fold, while for the mRNA levels the increase is approximately 1.4-fold. In ExpiCHO-S cells, iPLUSv2 promoted, once again, an increase in both Spike&#x2019;s mRNA and protein levels, as illustrated in <xref ref-type="fig" rid="F3">Figures 3E&#x2013;G</xref>. Here, the increase in protein production is approximately 2.5-fold, while for the mRNA levels the increase is approximately 1.6-fold.</p>
<p>These results clearly show that iPLUSv2 can increase Spike&#x2019;s mRNA levels and double protein production, in two different cell lines from different species (human and hamster).</p>
</sec>
<sec id="s3-4">
<title>3.4 MAGEC2 mRNA and protein levels increase with iPLUSv2</title>
<p>The mRNA vaccines are a potential immunotherapy solution to combat various types of cancer, prompting the immune system to destroy cancer cells by triggering a specific and enduring immune response against tumor antigens (TAs), inhibiting tumor growth (<xref ref-type="bibr" rid="B40">Miao et al., 2021</xref>). Nevertheless, in clinical trials it has been observed that although there is a certain level of positive response from patients (<xref ref-type="bibr" rid="B47">Papachristofilou et al., 2019</xref>), it does not seem to be a sufficiently robust response to cause tumor recession or an increase in overall survival for all the patients (<xref ref-type="bibr" rid="B9">Chehelgerdi and Chehelgerdi, 2023</xref>), leading to termination of their production. For that reason, pharmaceutical companies ought to incorporate novel molecular tools to improve cancer mRNA vaccines, to promote good immunological responses.</p>
<p>Therefore, our next step was to assess whether subcloning iPLUSv2 downstream of the melanoma antigen family C2 (MAGEC2) would result in increased mRNA levels and consequent protein production. For these proof-of-concept experiments, MAGEC2, a tumor-specific antigen for non-small cell lung cancer (NSCLC), was selected since it is included in CureVac&#x2019;s CV9202 NSCLC mRNA vaccine and whose information was made public (<xref ref-type="bibr" rid="B47">Papachristofilou et al., 2019</xref>). CV9202 is a vaccine encoding 6 tumor associated antigens, being MAGE-C2 one of them. Antigen-specific immune responses were detected in a phase Ib study enrolling 26 patients with stage IV NSCL (<xref ref-type="bibr" rid="B47">Papachristofilou et al., 2019</xref>; <xref ref-type="bibr" rid="B59">Sebastian et al., 2019</xref>).</p>
<p>As before, the initial step was the construction of vectors containing the <italic>MAGEC2</italic> with and without iPLUSv2 downstream of this antigen (<xref ref-type="fig" rid="F4">Figure 4A</xref>) and these vectors were used to transfect HeLa cells. As it can be observed in <xref ref-type="fig" rid="F4">Figures 4B, C</xref>, the inclusion of iPLUSv2 sequence in <italic>MAGEC2</italic> vectors resulted in an increase in approximately 1.8-fold in <italic>MAGEC2</italic> mRNA levels (<xref ref-type="fig" rid="F4">Figure 4B</xref>) and a 2.8-fold increase in MAGEC2 protein levels, in comparison to vectors without this sequence (<xref ref-type="fig" rid="F4">Figures 4C, D</xref>).</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>iPLUSv2 increases MAGEC2 mRNA and protein levels. <bold>(A)</bold> Schematic representation of the constructs, containing the <italic>MAGEC2</italic> coding sequence and the iPLUS variant, iPLUSv2, transfected in HeLa cells. Vectors contain a full-length CMV promoter and the HSV TK PAS. <bold>(B)</bold> <italic>MAGEC2</italic> mRNA levels increase in the presence of iPLUSv2. mRNA levels were measured by RT-qPCR and normalized to <italic>18S</italic>. Fold change to MAGEC2 without iPLUSv2 is represented as mean &#xb1; standard deviation (SD) of three independent experiments. Statistical analyses to identify differences were done using a two-tailed unpaired t-test. Significant <italic>p</italic>-value is indicated in the graph by asterisks (&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.001). <bold>(C,D)</bold> MAGEC2 protein levels increase &#x3e;2-fold in the presence of iPLUSv2. <bold>(C)</bold> Representative image of MAGEC2 protein levels evaluated by Western blot, with &#x3b1;-Tubulin as a loading control. <bold>(D)</bold> Quantification of MAGEC2 protein levels was calculated using the respective loading control for normalization, followed by fold change analyses to MAGEC2 without iPLUSv2. Data is represented as mean &#xb1; standard deviation (SD) of three independent experiments. Statistical analyses to identify differences were conducted using a two-tailed unpaired t-test. Significant <italic>p</italic>-value is indicated in the graph by asterisks (&#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic> &#x3c; 0.0001).</p>
</caption>
<graphic xlink:href="fbioe-12-1355957-g004.tif"/>
</fig>
<p>As observed with iPLUSv2 in Spike or iPLUS in trastuzumab, these results show that the presence of iPLUS non-coding sequences in vectors used for recombinant protein expression can at least double protein production. Moreover, the impact of iPLUSv2 in MAGEC2 bears substantial implications for its application in cancer mRNA vaccines, as the increase in antigen production certainly influences the efficiency of the process.</p>
</sec>
</sec>
<sec sec-type="discussion" id="s4">
<title>4 Discussion</title>
<p>
<italic>Cis</italic>-regulatory sequences present in the 3&#x2032;UTR that impact both mRNA and protein production, should be further investigated to be applied to enhance the production of biopharmaceuticals (<xref ref-type="bibr" rid="B43">O,Flaherty et al., 2020</xref>; <xref ref-type="bibr" rid="B32">Kirshina et al., 2023</xref>).</p>
<p>The existence of U-rich USEs as auxiliary regulatory elements has been widely recognized since they were originally described in viral mRNAs (<xref ref-type="bibr" rid="B14">DeZazzo and Imperiale, 1989</xref>; <xref ref-type="bibr" rid="B55">Russnak and Ganem, 1990</xref>; <xref ref-type="bibr" rid="B13">Darmon and Lutz, 2012</xref>). In the Human Immunodeficiency Virus 1 (HIV-1), for example, different termination sites exist and it is a USE in the vicinity of the 3&#x2032; long terminal repeats (LTR) PAS that aids in the production of the correct length transcript, disregarding the PAS present in the 5&#x2032;LTR (<xref ref-type="bibr" rid="B64">Valsamakis et al., 1991</xref>). It was initially thought that these sequences were specific to viral genomes, but this notion was questioned when different examples in cellular genes were discovered, such as in complement C2, Lamin B2, cyclooxygenase-2 or prothrombin, in which USEs mode of action has been described (<xref ref-type="bibr" rid="B42">Moreira et al., 1995</xref>; <xref ref-type="bibr" rid="B2">Brackenridge et al., 1997</xref>; <xref ref-type="bibr" rid="B20">Hall-Pogar et al., 2005</xref>; <xref ref-type="bibr" rid="B11">Danckwardt et al., 2011</xref>). For instance, we have showed that <italic>polo</italic>&#x2019;s USE in <italic>Drosophila</italic> is essential for <italic>polo</italic> distal PAS selection and has a function in increasing <italic>polo</italic> mRNA and protein levels (<xref ref-type="bibr" rid="B52">Pinto et al., 2011</xref>; <xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>). Moreover, microinjection of GFP-USE in one-cell stage zebrafish embryos increases GFP levels demonstrating a conservation of the role of the USE in increasing protein levels <italic>in vivo</italic> (<xref ref-type="bibr" rid="B17">Eufr&#xe1;sio et al., 2023</xref>). We then tested if the USE could function downstream of a reporter gene in a mammalian cell model, thus showing that the USE is also able to increase luciferase activity in HeLa cells (<xref ref-type="bibr" rid="B44">Oliveira et al., 2020</xref>). The results obtained with <italic>polo</italic>&#xb4;s USE <italic>in vivo</italic> in two animal models and <italic>in vitro</italic> in Hela cells prompt us to patent the use of this sequence in several applications including in the production of recombinant proteins with therapeutic use and mRNA vaccines and re-named it as iPLUS (<xref ref-type="bibr" rid="B44">Oliveira et al., 2020</xref>). We have previously described the mechanism of action of USEiPLUS and showed that iPLUS regulates several steps of gene expression. By liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis we demonstrated that PTBP1 binds to iPLUS <italic>RNA</italic> and using PTBP1 mutants we showed that it increases mRNA 3&#x2032; end formation, and consequently, mRNA levels (<xref ref-type="bibr" rid="B45">Oliveira et al., 2019</xref>). Additionally, we showed by UV crosslinking and immunoprecipitation assays that HuR (<xref ref-type="bibr" rid="B3">Brennan and Steitz, 2001</xref>; <xref ref-type="bibr" rid="B22">Hinman and Lou, 2008</xref>; <xref ref-type="bibr" rid="B23">Ho et al., 2020</xref>), a RBP with a well-defined role in mRNA stability and translation efficiency, also binds to <italic>in vitro</italic> transcribed iPLUS <italic>RNA</italic>, thus increasing protein levels (<xref ref-type="bibr" rid="B17">Eufr&#xe1;sio et al., 2023</xref>). Despite the fact that USE&#x2019;s/iPLUS physiological roles and mechanistic mode of function have been thoroughly investigated, this is the first time that a USE/iPLUS has been employed with the purpose of boosting protein production in different expression systems.</p>
<p>Here, we have expanded upon our earlier findings by exploring the potential of the non-coding iPLUS sequence to enhance the production of relevant biopharmaceuticals, including monoclonal antibodies used in immunotherapy and antigens employed in mRNA vaccines. Our results show the versatility of iPLUS by demonstrating its efficacy in improving the production of relevant recombinant proteins across various models. We have showed that in a recombinant monoclonal antibody commonly used in cancer immunotherapy, trastuzumab, iPLUS increases <italic>LC</italic> and <italic>HC</italic> mRNA levels and doubles trastuzumab protein levels in ExpiCHO-S cells. Next, we showed that in <italic>Pichia,</italic> a strain of yeast extensively used in recombinant protein production, the inclusion of iPLUS and a new iPLUS variant sequence in <italic>Pichia</italic> expression vectors containing GFP strongly impacts GFP expression levels, in at least 100-fold. Upon these consistent results, we turned our attention to a different kind of biopharmaceutical, in high demand at the moment, mRNA vaccines. For Spike, the antigen used in the COVID-19 mRNA vaccines, we observed again an increase in both mRNA and protein levels, in two different models, HeLa and ExpiCHO-S cells. The same effect was observed when we evaluated a different antigen tested in a lung cancer mRNA vaccine, MAGEC2. These results clearly show that in the three tested models (HeLa, ExpiCHO-S and <italic>Pichia</italic>) and with various proteins, iPLUS or its variant sequence iPLUSv2, consistently exhibit a beneficial impact in increasing both mRNA and protein levels.</p>
<p>These results produce proof-of-concept data of the applicability of the use of iPLUS in the biopharmaceutical industry and pave the way for further scale up experiments, in an industrial context. In yeast, there is evidence that the regulatory role of sequences present in the 3&#x2032;UTR is conserved (<xref ref-type="bibr" rid="B60">Shalgi et al., 2005</xref>; <xref ref-type="bibr" rid="B24">Ito et al., 2020</xref>; <xref ref-type="bibr" rid="B57">Savinov et al., 2021</xref>), but this is still a rather unexplored field of research. When referring specifically to <italic>Pichia pastoris</italic>, the knowledge is even more limited, so there is still room for improvements in this area, as we have demonstrated here by applying iPLUS to this expression system. This also opens the possibility for applying this technology to other recombinant DNA technologies, to increase the production of antibodies for immunotherapy, different mRNA vaccines antigens and possibly other therapeutic proteins, such as hormones or cytokines. Furthermore, it is possible that iPLUS presents a synergistic effect with existing non-coding regulatory sequences located at the 3&#x2032; end of expression systems, such as the WPRE, suggesting new applications for iPLUS and offering an opportunity to further enhance commercially available vectors.</p>
<p>Indeed, both iPLUS and iPLUSv2 offer numerous valuable advantages for their inclusion in vectors used in an industrial environment. As non-coding sequences, they avoid interference with the coding region of the protein or antigen of interest, avoiding additional regulatory steps. Their short size (28 or 25 nucleotides) facilitates easy subcloning into various expression systems or vectors without requiring complex laboratory procedures. Furthermore, iPLUS proves to be a versatile asset, as it functions across different expression systems, proteins, and mRNAs thus enabling the selection of a system tailored to the unique characteristics of each mRNA and protein (<xref ref-type="bibr" rid="B44">Oliveira et al., 2020</xref>).</p>
<p>In summary, iPLUS underscores the importance of the <italic>cis</italic>-acting elements present in the 3&#x2032;UTR in the regulation of gene expression, highlighting its potential application for the development of different vectors and biologics. Our findings clearly show that iPLUS incorporation into vectors used in different models has the potential to be used by the biopharmaceutical industry to increase the yield of protein production, thereby reducing production costs.</p>
</sec>
</body>
<back>
<sec sec-type="data-availability" id="s5">
<title>Data availability statement</title>
<p>The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.</p>
</sec>
<sec id="s6">
<title>Ethics statement</title>
<p>Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used. Ethical approval was not required for the studies on animals in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.</p>
</sec>
<sec id="s7">
<title>Author contributions</title>
<p>IR-C: Investigation, Methodology, Writing&#x2013;original draft, Writing&#x2013;review and editing. MS: Investigation, Methodology, Writing&#x2013;original draft, Writing&#x2013;review and editing. AnM: Investigation, Methodology, Writing&#x2013;original draft, Writing&#x2013;review and editing. BG: Investigation, Methodology, Writing&#x2013;original draft, Writing&#x2013;review and editing. IP-C: Investigation, Methodology, Supervision, Writing&#x2013;original draft, Writing&#x2013;review and editing. AlM: Conceptualization, Funding acquisition, Project administration, Supervision, Writing&#x2013;original draft, Writing&#x2013;review and editing.</p>
</sec>
<sec sec-type="funding-information" id="s8">
<title>Funding</title>
<p>The authors declare financial support was received for the research, authorship, and/or publication of this article. This work was funded by Programa Gilead G&#xe9;nese, ref 13854; by CaixaImpulse, la Caixa Foundation (LCF/TR/CI19/52460018); by National Funds through FCT&#x2014;Funda&#xe7;&#xe3;o para a Ci&#xea;ncia e a Tecnologia, I.P., under the project UIDB/04293/2020; by FCT under the project EXPL/SAU-PUB/1073/2021 (<ext-link ext-link-type="uri" xlink:href="http://doi.org/10.54499/EXPL/SAU-PUB/1073/2021">http://doi.org/10.54499/EXPL/SAU-PUB/1073/2021</ext-link>) and by Programa Operacional Regional do Norte and co-funded by European Regional Development Fund under the project &#x201c;The Porto Comprehensive Cancer Center&#x201d; with the reference NORTE-01&#x2013;0145-FEDER-072678&#x2014;Cons&#xf3;rcio PORTO.CCC&#x2014;Porto Comprehensive Cancer Center. IP-C is funded by a Researcher contract DOI: 10.54499/DL57/2016/CP1355/CT0016.</p>
</sec>
<ack>
<p>We are very thankful to all the current and past members of the Gene Regulation group, as well as to our academic and industrial colleagues for their insightful discussions. We are grateful to the Research and Innovation Unit at i3S for their support, to Mariana Coelho as an industry liaison and to Trenzyme Gmbh as a service provider in the <italic>Pichia</italic> experiments.</p>
</ack>
<sec sec-type="COI-statement" id="s9">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s10">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s11">
<title>Supplementary material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fbioe.2024.1355957/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fbioe.2024.1355957/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet2.PDF" id="SM1" mimetype="application/PDF" xmlns:xlink="http://www.w3.org/1999/xlink"/>
<supplementary-material xlink:href="DataSheet1.PDF" id="SM2" mimetype="application/PDF" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Albanell</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Baselga</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Trastuzumab, a humanized anti-HER2 monoclonal antibody, for the treatment of breast cancer</article-title>. <source>Drugs Today (Barc)</source> <volume>35</volume> (<issue>12</issue>), <fpage>931</fpage>&#x2013;<lpage>946</lpage>. <pub-id pub-id-type="doi">10.1358/dot.1999.35.12.564040</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brackenridge</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Ashe</surname>
<given-names>H. L.</given-names>
</name>
<name>
<surname>Giacca</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Proudfoot</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Transcription and polyadenylation in a short human intergenic region</article-title>. <source>Nucleic Acids Res.</source> <volume>25</volume> (<issue>12</issue>), <fpage>2326</fpage>&#x2013;<lpage>2335</lpage>. <pub-id pub-id-type="doi">10.1093/nar/25.12.2326</pub-id>
</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brennan</surname>
<given-names>C. M.</given-names>
</name>
<name>
<surname>Steitz</surname>
<given-names>J. A.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>HuR and mRNA stability</article-title>. <source>Cell Mol. Life Sci.</source> <volume>58</volume> (<issue>2</issue>), <fpage>266</fpage>&#x2013;<lpage>277</lpage>. <pub-id pub-id-type="doi">10.1007/pl00000854</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Novoa</surname>
<given-names>E. M.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W. C. W.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>G. C. G.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>High-throughput 5&#x27; UTR engineering for enhanced protein production in non-viral gene therapies</article-title>. <source>Nat. Commun.</source> <volume>12</volume> (<issue>1</issue>), <fpage>4138</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-021-24436-7</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Carswell</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Alwine</surname>
<given-names>J. C.</given-names>
</name>
</person-group> (<year>1989</year>). <article-title>Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences</article-title>. <source>Mol. Cell Biol.</source> <volume>9</volume> (<issue>10</issue>), <fpage>4248</fpage>&#x2013;<lpage>4258</lpage>. <pub-id pub-id-type="doi">10.1128/mcb.9.10.4248</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castelli</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>McGonigle</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Hornby</surname>
<given-names>P. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>The pharmacology and therapeutic applications of monoclonal antibodies</article-title>. <source>Pharmacol. Res. Perspect.</source> <volume>7</volume> (<issue>6</issue>), <fpage>e00535</fpage>. <pub-id pub-id-type="doi">10.1002/prp2.535</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castillo-Hair</surname>
<given-names>S. M.</given-names>
</name>
<name>
<surname>Seelig</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Machine learning for designing next-generation mRNA therapeutics</article-title>. <source>Acc. Chem. Res.</source> <volume>55</volume> (<issue>1</issue>), <fpage>24</fpage>&#x2013;<lpage>34</lpage>. <pub-id pub-id-type="doi">10.1021/acs.accounts.1c00621</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>E. A.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Pre-mRNA 3&#x27;-end processing complex assembly and function</article-title>. <source>Wiley Interdiscip. Rev. RNA</source> <volume>2</volume> (<issue>3</issue>), <fpage>321</fpage>&#x2013;<lpage>335</lpage>. <pub-id pub-id-type="doi">10.1002/wrna.54</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chehelgerdi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Chehelgerdi</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2023</year>). <article-title>The use of RNA-based treatments in the field of cancer immunotherapy</article-title>. <source>Mol. Cancer</source> <volume>22</volume> (<issue>1</issue>), <fpage>106</fpage>. <pub-id pub-id-type="doi">10.1186/s12943-023-01807-w</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cregg</surname>
<given-names>J. M.</given-names>
</name>
<name>
<surname>Cereghino</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Higgins</surname>
<given-names>D. R.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Recombinant protein expression in Pichia pastoris</article-title>. <source>Mol. Biotechnol.</source> <volume>16</volume> (<issue>1</issue>), <fpage>23</fpage>&#x2013;<lpage>52</lpage>. <pub-id pub-id-type="doi">10.1385/mb:16:1:23</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danckwardt</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Gantzert</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Macher-Goeppinger</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Probst</surname>
<given-names>H. C.</given-names>
</name>
<name>
<surname>Gentzel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Wilm</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>p38 MAPK controls prothrombin expression by regulated RNA 3&#x27; end processing</article-title>. <source>Mol. Cell</source> <volume>41</volume> (<issue>3</issue>), <fpage>298</fpage>&#x2013;<lpage>310</lpage>. <pub-id pub-id-type="doi">10.1016/j.molcel.2010.12.032</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Danckwardt</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kaufmann</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Gentzel</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Foerstner</surname>
<given-names>K. U.</given-names>
</name>
<name>
<surname>Gantzert</surname>
<given-names>A. S.</given-names>
</name>
<name>
<surname>Gehring</surname>
<given-names>N. H.</given-names>
</name>
<etal/>
</person-group> (<year>2007</year>). <article-title>Splicing factors stimulate polyadenylation via USEs at non-canonical 3&#x27; end formation signals</article-title>. <source>Embo J.</source> <volume>26</volume> (<issue>11</issue>), <fpage>2658</fpage>&#x2013;<lpage>2669</lpage>. <pub-id pub-id-type="doi">10.1038/sj.emboj.7601699</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Darmon</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Lutz</surname>
<given-names>C. S.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Novel upstream and downstream sequence elements contribute to polyadenylation efficiency</article-title>. <source>RNA Biol.</source> <volume>9</volume> (<issue>10</issue>), <fpage>1255</fpage>&#x2013;<lpage>1265</lpage>. <pub-id pub-id-type="doi">10.4161/rna.21957</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>DeZazzo</surname>
<given-names>J. D.</given-names>
</name>
<name>
<surname>Imperiale</surname>
<given-names>M. J.</given-names>
</name>
</person-group> (<year>1989</year>). <article-title>Sequences upstream of AAUAAA influence poly(A) site selection in a complex transcription unit</article-title>. <source>Mol. Cell Biol.</source> <volume>9</volume> (<issue>11</issue>), <fpage>4951</fpage>&#x2013;<lpage>4961</lpage>. <pub-id pub-id-type="doi">10.1128/mcb.9.11.4951</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dingermann</surname>
<given-names>T.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Recombinant therapeutic proteins: production platforms and challenges</article-title>. <source>Biotechnol. J.</source> <volume>3</volume> (<issue>1</issue>), <fpage>90</fpage>&#x2013;<lpage>97</lpage>. <pub-id pub-id-type="doi">10.1002/biot.200700214</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dodev</surname>
<given-names>T. S.</given-names>
</name>
<name>
<surname>Karagiannis</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Gilbert</surname>
<given-names>A. E.</given-names>
</name>
<name>
<surname>Josephs</surname>
<given-names>D. H.</given-names>
</name>
<name>
<surname>Bowen</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>James</surname>
<given-names>L. K.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>A tool kit for rapid cloning and expression of recombinant antibodies</article-title>. <source>Sci. Rep.</source> <volume>4</volume>, <fpage>5885</fpage>. <pub-id pub-id-type="doi">10.1038/srep05885</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Eufr&#xe1;sio</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Azevedo</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Machado</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Ferreira</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Moutinho</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Henriques</surname>
<given-names>F.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Unravelling the regulatory function of a short 3&#x2019;UTR sequence in zebrafish and in human cells</article-title>. <source>bioRxiv</source>. <pub-id pub-id-type="doi">10.1101/2023.11.15.567165</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>G&#xf3;mez-Aguado</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Rodr&#xed;guez-Castej&#xf3;n</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Vicente-Pascual</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Rodr&#xed;guez-Gasc&#xf3;n</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Solin&#xed;s</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Del Pozo-Rodr&#xed;guez</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Nanomedicines to deliver mRNA: state of the art and future perspectives</article-title>. <source>Nanomater. (Basel)</source> <volume>10</volume> (<issue>2</issue>), <fpage>364</fpage>. <pub-id pub-id-type="doi">10.3390/nano10020364</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gruber</surname>
<given-names>A. J.</given-names>
</name>
<name>
<surname>Zavolan</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Alternative cleavage and polyadenylation in health and disease</article-title>. <source>Nat. Rev. Genet.</source> <volume>20</volume> (<issue>10</issue>), <fpage>599</fpage>&#x2013;<lpage>614</lpage>. <pub-id pub-id-type="doi">10.1038/s41576-019-0145-z</pub-id>
</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hall-Pogar</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Tian</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Lutz</surname>
<given-names>C. S.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>Alternative polyadenylation of cyclooxygenase-2</article-title>. <source>Nucleic Acids Res.</source> <volume>33</volume> (<issue>8</issue>), <fpage>2565</fpage>&#x2013;<lpage>2579</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gki544</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hern&#xe1;ndez</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Osnaya</surname>
<given-names>V. G.</given-names>
</name>
<name>
<surname>P&#xe9;rez-Mart&#xed;nez</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Conservation and variability of the AUG initiation codon context in eukaryotes</article-title>. <source>Trends Biochem. Sci.</source> <volume>44</volume> (<issue>12</issue>), <fpage>1009</fpage>&#x2013;<lpage>1021</lpage>. <pub-id pub-id-type="doi">10.1016/j.tibs.2019.07.001</pub-id>
</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hinman</surname>
<given-names>M. N.</given-names>
</name>
<name>
<surname>Lou</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Diverse molecular functions of Hu proteins</article-title>. <source>Cell Mol. Life Sci.</source> <volume>65</volume> (<issue>20</issue>), <fpage>3168</fpage>&#x2013;<lpage>3181</lpage>. <pub-id pub-id-type="doi">10.1007/s00018-008-8252-6</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ho</surname>
<given-names>J. J. D.</given-names>
</name>
<name>
<surname>Balukoff</surname>
<given-names>N. C.</given-names>
</name>
<name>
<surname>Theodoridis</surname>
<given-names>P. R.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Krieger</surname>
<given-names>J. R.</given-names>
</name>
<name>
<surname>Schatz</surname>
<given-names>J. H.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>A network of RNA-binding proteins controls translation efficiency to activate anaerobic metabolism</article-title>. <source>Nat. Commun.</source> <volume>11</volume> (<issue>1</issue>), <fpage>2677</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-020-16504-1</pub-id>
</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ito</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Terai</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Ishigami</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hashiba</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Nakamura</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Bamba</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Exchange of endogenous and heterogeneous yeast terminators in Pichia pastoris to tune mRNA stability and gene expression</article-title>. <source>Nucleic Acids Res.</source> <volume>48</volume> (<issue>22</issue>), <fpage>13000</fpage>&#x2013;<lpage>13012</lpage>. <pub-id pub-id-type="doi">10.1093/nar/gkaa1066</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jackson</surname>
<given-names>N. A. C.</given-names>
</name>
<name>
<surname>Kester</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Casimiro</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Gurunathan</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>DeRosa</surname>
<given-names>F.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The promise of mRNA vaccines: a biotech and industrial perspective</article-title>. <source>NPJ Vaccines</source> <volume>5</volume>, <fpage>11</fpage>. <pub-id pub-id-type="doi">10.1038/s41541-020-0159-8</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jackson</surname>
<given-names>R. J.</given-names>
</name>
<name>
<surname>Hellen</surname>
<given-names>C. U. T.</given-names>
</name>
<name>
<surname>Pestova</surname>
<given-names>T. V.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>The mechanism of eukaryotic translation initiation and principles of its regulation</article-title>. <source>Nat. Rev. Mol. Cell Biol.</source> <volume>11</volume> (<issue>2</issue>), <fpage>113</fpage>&#x2013;<lpage>127</lpage>. <pub-id pub-id-type="doi">10.1038/nrm2838</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>X. S.</given-names>
</name>
<name>
<surname>Russell</surname>
<given-names>J. E.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>A nucleolin-binding 3&#x2032; untranslated region element stabilizes &#x3b2;-globin mRNA <italic>in vivo</italic>
</article-title>. <source>Mol. Cell Biol.</source> <volume>26</volume> (<issue>6</issue>), <fpage>2419</fpage>&#x2013;<lpage>2429</lpage>. <pub-id pub-id-type="doi">10.1128/mcb.26.6.2419-2429.2006</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Johnson</surname>
<given-names>A. G.</given-names>
</name>
<name>
<surname>Grosely</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Petrov</surname>
<given-names>A. N.</given-names>
</name>
<name>
<surname>Puglisi</surname>
<given-names>J. D.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Dynamics of IRES-mediated translation</article-title>. <source>Philos. Trans. R. Soc. Lond B Biol. Sci.</source> <volume>372</volume>, <fpage>20160177</fpage>. <pub-id pub-id-type="doi">10.1098/rstb.2016.0177(1716)</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Karik&#xf3;</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Kuo</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Barnathan</surname>
<given-names>E.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Overexpression of urokinase receptor in mammalian cells following administration of the <italic>in vitro</italic> transcribed encoding mRNA</article-title>. <source>Gene Ther.</source> <volume>6</volume> (<issue>6</issue>), <fpage>1092</fpage>&#x2013;<lpage>1100</lpage>. <pub-id pub-id-type="doi">10.1038/sj.gt.3300930</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kesik-Brodacka</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Progress in biopharmaceutical development</article-title>. <source>Biotechnol. Appl. Biochem.</source> <volume>65</volume> (<issue>3</issue>), <fpage>306</fpage>&#x2013;<lpage>322</lpage>. <pub-id pub-id-type="doi">10.1002/bab.1617</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Ilic</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Shrestha</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zou</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Kamburov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Systematic functional interrogation of rare cancer variants identifies oncogenic alleles</article-title>. <source>Cancer Discov.</source> <volume>6</volume> (<issue>7</issue>), <fpage>714</fpage>&#x2013;<lpage>726</lpage>. <pub-id pub-id-type="doi">10.1158/2159-8290.cd-16-0160</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kirshina</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Vasileva</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Kunyk</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Seregina</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Muslimov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ivanov</surname>
<given-names>R.</given-names>
</name>
<etal/>
</person-group> (<year>2023</year>). <article-title>Effects of combinations of untranslated-region sequences on translation of mRNA</article-title>. <source>Biomolecules</source> <volume>13</volume> (<issue>11</issue>), <fpage>1677</fpage>. <pub-id pub-id-type="doi">10.3390/biom13111677</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kosuge</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Nagatoishi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Kiyoshi</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ishii-Watabe</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Tanaka</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Terao</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Highly sensitive HPLC analysis and biophysical characterization of N-glycans of IgG-Fc domain in comparison between CHO and 293 cells using Fc&#x3b3;RIIIa ligand</article-title>. <source>Biotechnol. Prog.</source> <volume>36</volume> (<issue>6</issue>), <fpage>e3016</fpage>. <pub-id pub-id-type="doi">10.1002/btpr.3016</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Krasniqi</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Barchiesi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Pizzuti</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Mazzotta</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Venuti</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Maugeri-Sacc&#xe0;</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Immunotherapy in HER2-positive breast cancer: state of the art and future perspectives</article-title>. <source>J. Hematol. Oncol.</source> <volume>12</volume> (<issue>1</issue>), <fpage>111</fpage>. <pub-id pub-id-type="doi">10.1186/s13045-019-0798-2</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Leppek</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Byeon</surname>
<given-names>G. W.</given-names>
</name>
<name>
<surname>Kladwang</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Wayment-Steele</surname>
<given-names>H. K.</given-names>
</name>
<name>
<surname>Kerr</surname>
<given-names>C. H.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>A. F.</given-names>
</name>
<etal/>
</person-group> (<year>2022</year>). <article-title>Combinatorial optimization of mRNA structure, stability, and translation for RNA-based therapeutics</article-title>. <source>Nat. Commun.</source> <volume>13</volume> (<issue>1</issue>), <fpage>1536</fpage>. <pub-id pub-id-type="doi">10.1038/s41467-022-28776-w</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lorentzen</surname>
<given-names>C. L.</given-names>
</name>
<name>
<surname>Haanen</surname>
<given-names>J. B.</given-names>
</name>
<name>
<surname>Met</surname>
<given-names>&#xd6;.</given-names>
</name>
<name>
<surname>Svane</surname>
<given-names>I. M.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Clinical advances and ongoing trials of mRNA vaccines for cancer treatment</article-title>. <source>Lancet Oncol.</source> <volume>23</volume> (<issue>10</issue>), <fpage>e450</fpage>&#x2013;<lpage>e458</lpage>. <pub-id pub-id-type="doi">10.1016/s1470-2045(22)00372-2</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Matoulkova</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Michalova</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Vojtesek</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Hrstka</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The role of the 3&#x27; untranslated region in post-transcriptional regulation of protein expression in mammalian cells</article-title>. <source>RNA Biol.</source> <volume>9</volume> (<issue>5</issue>), <fpage>563</fpage>&#x2013;<lpage>576</lpage>. <pub-id pub-id-type="doi">10.4161/rna.20231</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mayr</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>Regulation by 3&#x27;-untranslated regions</article-title>. <source>Annu. Rev. Genet.</source> <volume>51</volume>, <fpage>171</fpage>&#x2013;<lpage>194</lpage>. <pub-id pub-id-type="doi">10.1146/annurev-genet-120116-024704</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mayr</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>What are 3&#x27; UTRs doing?</article-title> <source>Cold Spring Harb. Perspect. Biol.</source> <volume>11</volume> (<issue>10</issue>), <fpage>a034728</fpage>. <pub-id pub-id-type="doi">10.1101/cshperspect.a034728</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Miao</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Huang</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>mRNA vaccine for cancer immunotherapy</article-title>. <source>Mol. Cancer</source> <volume>20</volume> (<issue>1</issue>), <fpage>41</fpage>. <pub-id pub-id-type="doi">10.1186/s12943-021-01335-5</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moreira</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Takagaki</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Brackenridge</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Wollerton</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Manley</surname>
<given-names>J. L.</given-names>
</name>
<name>
<surname>Proudfoot</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>The upstream sequence element of the C2 complement poly(A) signal activates mRNA 3&#x27; end formation by two distinct mechanisms</article-title>. <source>Genes Dev.</source> <volume>12</volume> (<issue>16</issue>), <fpage>2522</fpage>&#x2013;<lpage>2534</lpage>. <pub-id pub-id-type="doi">10.1101/gad.12.16.2522</pub-id>
</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Moreira</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Wollerton</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Monks</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Proudfoot</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>1995</year>). <article-title>Upstream sequence elements enhance poly(A) site efficiency of the C2 complement gene and are phylogenetically conserved</article-title>. <source>Embo J.</source> <volume>14</volume> (<issue>15</issue>), <fpage>3809</fpage>&#x2013;<lpage>3819</lpage>. <pub-id pub-id-type="doi">10.1002/j.1460-2075.1995.tb00050.x</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>O&#x27;Flaherty</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Bergin</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Flampouri</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Mota</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Obaidi</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Quigley</surname>
<given-names>A.</given-names>
</name>
<etal/>
</person-group> (<year>2020</year>). <article-title>Mammalian cell culture for production of recombinant proteins: a review of the critical steps in their biomanufacturing</article-title>. <source>Biotechnol. Adv.</source> <volume>43</volume>, <fpage>107552</fpage>. <pub-id pub-id-type="doi">10.1016/j.biotechadv.2020.107552</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Oliveira</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Ana</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Freitas</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Moreira</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Ribeiro</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Carlos</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2020</year>). <source>Nucleic acid to activate gene expression and protein production</source>. <comment>
<bold>WO/2020/076174</bold>
</comment>.</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Oliveira</surname>
<given-names>M. S.</given-names>
</name>
<name>
<surname>Freitas</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pinto</surname>
<given-names>P. A. B.</given-names>
</name>
<name>
<surname>de Jesus</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Tavares</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Pinho</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Cell cycle kinase polo is controlled by a widespread 3&#x27; untranslated region regulatory sequence in <italic>Drosophila melanogaster</italic>
</article-title>. <source>Mol. Cell Biol.</source> <volume>39</volume> (<issue>15</issue>), <fpage>e00581</fpage>-. <pub-id pub-id-type="doi">10.1128/mcb.00581-18</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Orlandini von Niessen</surname>
<given-names>A. G.</given-names>
</name>
<name>
<surname>Poleganov</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Rechner</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Plaschke</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kranz</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Fesser</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Improving mRNA-based therapeutic gene delivery by expression-augmenting 3&#x27; UTRs identified by cellular library screening</article-title>. <source>Mol. Ther.</source> <volume>27</volume> (<issue>4</issue>), <fpage>824</fpage>&#x2013;<lpage>836</lpage>. <pub-id pub-id-type="doi">10.1016/j.ymthe.2018.12.011</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Papachristofilou</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Hipp</surname>
<given-names>M. M.</given-names>
</name>
<name>
<surname>Klinkhardt</surname>
<given-names>U.</given-names>
</name>
<name>
<surname>Fr&#xfc;h</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Sebastian</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Weiss</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Phase Ib evaluation of a self-adjuvanted protamine formulated mRNA-based active cancer immunotherapy, BI1361849 (CV9202), combined with local radiation treatment in patients with stage IV non-small cell lung cancer</article-title>. <source>J. Immunother. Cancer</source> <volume>7</volume> (<issue>1</issue>), <fpage>38</fpage>. <pub-id pub-id-type="doi">10.1186/s40425-019-0520-5</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pardi</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hogan</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Porter</surname>
<given-names>F. W.</given-names>
</name>
<name>
<surname>Weissman</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>mRNA vaccines - a new era in vaccinology</article-title>. <source>Nat. Rev. Drug Discov.</source> <volume>17</volume> (<issue>4</issue>), <fpage>261</fpage>&#x2013;<lpage>279</lpage>. <pub-id pub-id-type="doi">10.1038/nrd.2017.243</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pearson</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Khazaipoul</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Optun</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Pryme</surname>
<given-names>I. F.</given-names>
</name>
<name>
<surname>Stern</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Hesketh</surname>
<given-names>J. E.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Albumin 3&#x27;untranslated region facilitates increased recombinant protein production from Chinese hamster ovary cells</article-title>. <source>Biotechnol. J.</source> <volume>7</volume> (<issue>11</issue>), <fpage>1405</fpage>&#x2013;<lpage>1411</lpage>. <pub-id pub-id-type="doi">10.1002/biot.201200044</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pereira-Castro</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Moreira</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>On the function and relevance of alternative 3&#x27;-UTRs in gene expression regulation</article-title>. <source>Wiley Interdiscip. Rev. RNA</source> <volume>12</volume> (<issue>5</issue>), <fpage>e1653</fpage>. <pub-id pub-id-type="doi">10.1002/wrna.1653</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pfaffl</surname>
<given-names>M. W.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>A new mathematical model for relative quantification in real-time RT-PCR</article-title>. <source>Nucleic Acids Res.</source> <volume>29</volume> (<issue>9</issue>), <fpage>e45</fpage>&#x2013;<lpage>e45</lpage>. <pub-id pub-id-type="doi">10.1093/nar/29.9.e45</pub-id>
</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pinto</surname>
<given-names>P. A.</given-names>
</name>
<name>
<surname>Henriques</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Freitas</surname>
<given-names>M. O.</given-names>
</name>
<name>
<surname>Martins</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Domingues</surname>
<given-names>R. G.</given-names>
</name>
<name>
<surname>Wyrzykowska</surname>
<given-names>P. S.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>RNA polymerase II kinetics in polo polyadenylation signal selection</article-title>. <source>Embo J.</source> <volume>30</volume> (<issue>12</issue>), <fpage>2431</fpage>&#x2013;<lpage>2444</lpage>. <pub-id pub-id-type="doi">10.1038/emboj.2011.156</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Proudfoot</surname>
<given-names>N. J.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Ending the message: poly(A) signals then and now</article-title>. <source>Genes Dev.</source> <volume>25</volume> (<issue>17</issue>), <fpage>1770</fpage>&#x2013;<lpage>1782</lpage>. <pub-id pub-id-type="doi">10.1101/gad.17268411</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Rauch</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jasny</surname>
<given-names>E.</given-names>
</name>
<name>
<surname>Schmidt</surname>
<given-names>K. E.</given-names>
</name>
<name>
<surname>Petsch</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>New vaccine technologies to combat outbreak situations</article-title>. <source>Front. Immunol.</source> <volume>9</volume>, <fpage>1963</fpage>. <pub-id pub-id-type="doi">10.3389/fimmu.2018.01963</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Russnak</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Ganem</surname>
<given-names>D.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Sequences 5&#x27; to the polyadenylation signal mediate differential poly(A) site use in hepatitis B viruses</article-title>. <source>Genes Dev.</source> <volume>4</volume> (<issue>5</issue>), <fpage>764</fpage>&#x2013;<lpage>776</lpage>. <pub-id pub-id-type="doi">10.1101/gad.4.5.764</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sample</surname>
<given-names>P. J.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Reid</surname>
<given-names>D. W.</given-names>
</name>
<name>
<surname>Presnyak</surname>
<given-names>V.</given-names>
</name>
<name>
<surname>McFadyen</surname>
<given-names>I. J.</given-names>
</name>
<name>
<surname>Morris</surname>
<given-names>D. R.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Human 5&#x27; UTR design and variant effect prediction from a massively parallel translation assay</article-title>. <source>Nat. Biotechnol.</source> <volume>37</volume> (<issue>7</issue>), <fpage>803</fpage>&#x2013;<lpage>809</lpage>. <pub-id pub-id-type="doi">10.1038/s41587-019-0164-5</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Savinov</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Brandsen</surname>
<given-names>B. M.</given-names>
</name>
<name>
<surname>Angell</surname>
<given-names>B. E.</given-names>
</name>
<name>
<surname>Cuperus</surname>
<given-names>J. T.</given-names>
</name>
<name>
<surname>Fields</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Effects of sequence motifs in the yeast 3&#x27; untranslated region determined from massively parallel assays of random sequences</article-title>. <source>Genome Biol.</source> <volume>22</volume> (<issue>1</issue>), <fpage>293</fpage>. <pub-id pub-id-type="doi">10.1186/s13059-021-02509-6</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schambach</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Galla</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Maetzig</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Loew</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Baum</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Improving transcriptional termination of self-inactivating gamma-retroviral and lentiviral vectors</article-title>. <source>Mol. Ther.</source> <volume>15</volume> (<issue>6</issue>), <fpage>1167</fpage>&#x2013;<lpage>1173</lpage>. <pub-id pub-id-type="doi">10.1038/sj.mt.6300152</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sebastian</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Schr&#xf6;der</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Scheel</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Hong</surname>
<given-names>H. S.</given-names>
</name>
<name>
<surname>Muth</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>von Boehmer</surname>
<given-names>L.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>A phase I/IIa study of the mRNA-based cancer immunotherapy CV9201 in patients with stage IIIB/IV non-small cell lung cancer</article-title>. <source>Cancer Immunol. Immunother.</source> <volume>68</volume> (<issue>5</issue>), <fpage>799</fpage>&#x2013;<lpage>812</lpage>. <pub-id pub-id-type="doi">10.1007/s00262-019-02315-x</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Shalgi</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Lapidot</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shamir</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Pilpel</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2005</year>). <article-title>A catalog of stability-associated sequence elements in 3&#x27; UTRs of yeast mRNAs</article-title>. <source>Genome Biol.</source> <volume>6</volume> (<issue>10</issue>), <fpage>R86</fpage>. <pub-id pub-id-type="doi">10.1186/gb-2005-6-10-r86</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Syed</surname>
<given-names>A. M.</given-names>
</name>
<name>
<surname>Taha</surname>
<given-names>T. Y.</given-names>
</name>
<name>
<surname>Tabata</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>I. P.</given-names>
</name>
<name>
<surname>Ciling</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Khalid</surname>
<given-names>M. M.</given-names>
</name>
<etal/>
</person-group> (<year>2021</year>). <article-title>Rapid assessment of SARS-CoV-2-evolved variants using virus-like particles</article-title>. <source>Science</source> <volume>374</volume> (<issue>6575</issue>), <fpage>1626</fpage>&#x2013;<lpage>1632</lpage>. <pub-id pub-id-type="doi">10.1126/science.abl6184</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tihanyi</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Nyitray</surname>
<given-names>L.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Recent advances in CHO cell line development for recombinant protein production</article-title>. <source>Drug Discov. Today Technol.</source> <volume>38</volume>, <fpage>25</fpage>&#x2013;<lpage>34</lpage>. <pub-id pub-id-type="doi">10.1016/j.ddtec.2021.02.003</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vallazza</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Petri</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Poleganov</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Eberle</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Kuhn</surname>
<given-names>A. N.</given-names>
</name>
<name>
<surname>Sahin</surname>
<given-names>U.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Recombinant messenger RNA technology and its application in cancer immunotherapy, transcript replacement therapies, pluripotent stem cell induction, and beyond</article-title>. <source>Wiley Interdiscip. Rev. RNA</source> <volume>6</volume> (<issue>5</issue>), <fpage>471</fpage>&#x2013;<lpage>499</lpage>. <pub-id pub-id-type="doi">10.1002/wrna.1288</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Valsamakis</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Zeichner</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Carswell</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Alwine</surname>
<given-names>J. C.</given-names>
</name>
</person-group> (<year>1991</year>). <article-title>The human immunodeficiency virus type 1 polyadenylylation signal: a 3&#x27; long terminal repeat element upstream of the AAUAAA necessary for efficient polyadenylylation</article-title>. <source>Proc. Natl. Acad. Sci. U. S. A.</source> <volume>88</volume> (<issue>6</issue>), <fpage>2108</fpage>&#x2013;<lpage>2112</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.88.6.2108</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Walsh</surname>
<given-names>G.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Biopharmaceutical benchmarks 2018</article-title>. <source>Nat. Biotechnol.</source> <volume>36</volume> (<issue>12</issue>), <fpage>1136</fpage>&#x2013;<lpage>1145</lpage>. <pub-id pub-id-type="doi">10.1038/nbt.4305</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xia</surname>
<given-names>X.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Detailed dissection and critical evaluation of the pfizer/BioNTech and Moderna mRNA vaccines</article-title>. <source>Vaccines (Basel)</source> <volume>9</volume> (<issue>7</issue>), <fpage>734</fpage>. <pub-id pub-id-type="doi">10.3390/vaccines9070734</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Hyman</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Moore</surname>
<given-names>C.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Formation of mRNA 3&#x27; ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis</article-title>. <source>Microbiol. Mol. Biol. Rev.</source> <volume>63</volume> (<issue>2</issue>), <fpage>405</fpage>&#x2013;<lpage>445</lpage>. <pub-id pub-id-type="doi">10.1128/mmbr.63.2.405-445.1999</pub-id>
</citation>
</ref>
<ref id="B68">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zufferey</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Donello</surname>
<given-names>J. E.</given-names>
</name>
<name>
<surname>Trono</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Hope</surname>
<given-names>T. J.</given-names>
</name>
</person-group> (<year>1999</year>). <article-title>Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors</article-title>. <source>J. Virol.</source> <volume>73</volume> (<issue>4</issue>), <fpage>2886</fpage>&#x2013;<lpage>2892</lpage>. <pub-id pub-id-type="doi">10.1128/jvi.73.4.2886-2892.1999</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>