S. mobaraensis smY2109 and smY2019∆tg were used to study TGase and TAP, respectively (Yin et al., 2021). The plasmid pET-22b (+) and Escherichia coli BL21 (DE3) were used for expressing pro-TGase.

The spore culture on the GYM agar medium and seed culture in shake flasks were performed as described in the previous study (Yin et al., 2021). The composition of the basal fermentation medium was as follows: 2% glycerol, 2% peptone, 0.5% yeast extract, 2% soya flour, 0.4% K₂HPO₄, 0.2% KH₂PO₄, and 0.2% MgSO₄. To study the influence of different inorganic nitrogen sources on the TGase fermentation period, NaNO₃, (NH₄)₂SO₄, and NH₄Cl were added to the basal fermentation medium in the same total nitrogen content (30 mM final concentration).

The gene fragment of pro-TGase was amplified from the S. mobaraensis smY2019 genome by PrimeSTAR GXL DNA Polymerase (TaKaRa, Dalian, China) using the primer pair ptg-F (CATGCCATGGGCAGCGGCACCGGGGAAGAGAAGAG)/ptg-R (CCG​CTC​GAG​CGG​CCA​GCC​CTG​TGT​CAC​CTT​GTC​G) and cloned into the Nco I-Xho I sites of pET-22b (+), generating the pro-TGase expression plasmid pET-22b/ptg. The plasmid pET-22b/ptg was introduced into E. coli BL21 (DE3). The recombinant E. coli strain was inoculated into a Luria–Bertani medium containing 100 μg/ml ampicillin for seed culture at 37°C for 12 h. Then, 1-ml seed cultures were transferred into a 50-ml terrific broth (TB) medium containing the same amount of antibiotics and further cultivated at 37°C. At an OD₆₀₀ of 0.8, the cells were induced by adding the inducer isopropyl beta-D-1-thiogalactopyranoside (400 μM, final concentration). Growth was continued at 20°C for up to 40 h. The culture supernatant was subjected to affinity purification using the His-Trap column (GE Healthcare, NY, United States). The pro-TGase was eluted with elution buffer (50 mM Tris-HCl, 50 mM NaCl, and 150 mM imidazole, pH 8.0) and dialyzed against dialysis buffer (50 mM Tris-HCl, pH 8.0). Protein concentration of purified pro-TGase was determined by using the BCA protein assay kit (Beyotime, Shanghai, China). The samples were diluted to 0.5 mg/ml of protein concentrations and used as the substrate for TAP activity measurement.

For detecting the protease activity, the activation reaction was initiated by mixing the purified pro-TGase (0.5 mg/ml) with an equal volume of the culture supernatant of smY2019∆tg. One unit of the TAP toward the pro-TGase was defined as the amount of enzyme needed to generate one unit of mature TGase per hour at 30°C.

The biomass of S. mobaraensis was measured by using the dry cell weight (DCW) method. S. mobaraensis cells were harvested by centrifugation (5,000 × g, 15 min) from 10 ml fermentation broth. After washing with sterile water three times, the cell pellets were dried at 105°C until they had a constant weight.

According to the previous report (Yin et al., 2021), the colorimetric method was conducted to measure TGase activity using N-CBZ-Gln-Gly (Sigma-Aldrich, Shanghai, China) as the substrate. One unit of TGase activity is defined as the amount of enzyme needed to generate 1 μmol of hydroxamate per min at 37°C.

SDS-PAGE analysis was performed to separate proteins on a 10% running gel, which was visualized after staining with Coomassie Brilliant Blue R250.

The logistic function was used to fit the curve of the specific production rate by OriginLab 2018 software (OriginLab Corporation, Northampton, United States). First-order kinetics was applied to calculate the specific production rate as follows: specific production rate =   1 X × dp dt  × 1000 , (1) where X is DCW (g/L); t is culture time (h); and P is TGase activity (U/mL).

All experiments were carried out in triplicate at least.

Nitrogen source is critical for cell growth and product biosynthesis. The ectoine production was improved by optimizing the type and quantity of the nitrogen sources (Zhang et al., 2022). However, previously, there were very few reports on the biosynthesis of TGase using inorganic nitrogen sources. In the present study, based on the basal fermentation medium, we analyzed the effects of three inorganic nitrogen sources at a constant concentration (30 mM) on the production of TGase by the S. mobaraensis smY 2019. As shown in Figure 1A, the cultivation without the inorganic nitrogen sources rapidly accumulated the TGase after 36 h, and the maximal enzyme activity was at 84 h. In the case of (NH₄)₂SO₄ and NH₄Cl, the rapid TGase production started at 24 h, and the peak value of the enzyme activity occurred at 72 h, 12 h earlier than the control. In contrast, NaNO₃ did not affect the TGase biosynthesis (Figure 1A). The cell growth of smY2019 was not significantly affected by adding the inorganic nitrogen sources (Figure 1B), suggesting that the reduced TGase production period is not due to cell growth changes. As we all know, TGase was secreted as inactive pro-TGase and then transformed into active mature TGase (Zotzel et al., 2003a). To understand the reason for the accelerated TGase biosynthesis, the culture supernatant of each condition was taken at 36 h and 72 h and subjected to SDS-PAGE analysis. For the samples taken at 36 h, both pro-TGase (43 kDa) and TGase (38 kDa) bands could be seen in all cases (Figure 1D). The sample with NaNO₃ added had similar protein bands with the control, with thick bands of pro-TGase and thin bands of TGase, while the addition of (NH₄)₂SO₄ or NH₄Cl had more thick bands of TGase. When fermented in the medium with (NH₄)₂SO₄ or NH₄Cl for 72 h, the pro-TGase bands were completely converted into TGase bands. However, in addition to the TGase bands, thin pro-TGase bands were still detected at 72 h in the case of control and NaNO₃ (Figure 1D). After the in vitro activation with dispase, all the samples at 36 h and 72 h shared similar TGase activities (18.6–21.1 U/mL) (Figure 1C). These findings indicated that the addition of (NH₄)₂SO₄ and NH₄Cl significantly influences S. mobaraensis TGase activation instead of pro-TGase expression. However, Na₂SO₄ and NaCl did not improve the TGase activation (data not shown), suggesting the critical role of NH₄ ⁺.

It has shown that the biosynthesis of pro-TGase is simultaneous with its activation at the first half of S. mobaraensis fermentation, and the inactivation of the mature TGase could be seen in the later stage of the fermentation (Figure 1A and Supplementary Figure S1). Therefore, it is hard to characterize TAP activity using S. mobaraensis with TGase production. It is essential to establish a method to measure the TAP activity accurately. The pro-TGase from S. mobaraensis was expressed in E. coli BL21 (DE3) and purified (Supplementary Figure S2A). The TAP activity was measured using the purified pro-TGase as a substrate and indicated by TGase activity. Meanwhile, the previously constructed TGase-deficient strain smY2019∆tg was used as the research host for analyzing TAP activity during fermentation (Yin et al., 2021). smY2019∆tg did not produce TGase under the same cultivation condition, eliminating the interference of its own TGase activity on TAP activity measurement (Figure 2A). Compared with the previous method, this method exclusively reflects the activity of protease that can activate pro-TGase, which was more sensitive and reliable (Zhang et al., 2012).

We here analyzed the TAP activities of smY2019∆tg in the absence and presence of (NH₄)₂SO₄. The TAP activity in smY2019∆tg with 30 mM NH₄ ⁺ addition grew much faster than that of the cultivation without NH₄ ⁺ at the initial 24 h, and the peak value achieved the former reaching 1.74 U/mL, four times higher than that of the latter. Within the next 36 h, the TAP activities under both conditions declined gradually and maintained a very low level (Figure 2B). To further compare the TAP activities, the in vitro activation process of samples taken at 24 h was analyzed. The cultivation with NH₄ ⁺ completely activated the 0.5 mg/ml pro-TGase within 9 h, while that without NH₄ ⁺ did not even activate even after 18 h (Supplementary Figures S2B,C). These results confirmed that NH₄ ⁺ increased the TAP activity at the early stage of fermentation. TAMP (purified from surface colonies on plates) was considered to be involved in TGase activation and regulated by SSTI in S. mobaraensis (Zotzel et al., 2003a; Juettner et al., 2018; Fuchsbauer, 2021). However, the transcript levels of TAMP and SSTI at 24 h were not changed in the presence and absence of NH₄ ⁺ (data not shown). Streptomyces are prodigious producers of proteases. (Chater et al., 2010). Streptomyces coelicolor, a model organism for the study of Streptomyces, contains 56 genes encoding protease, including eight metalloproteinase genes (Bentley et al., 2002). Gene expression often differs when the growth conditions were changed. Adding NH₄ ⁺ may induce the expression of a novel metalloproteinase or relieve the inhibition of this activating protease in the early stage of fermentation.

Then, the concentration and time of NH₄ ⁺ addition were optimized to further improve the TGase activation. When (NH₄)₂SO₄ was added at the beginning of the fermentation, the TAP activity at 24 h increased with the concentration of NH₄ ⁺ from 0 to 60 mM, while further increase in the NH₄ ⁺ concentration (90 mM) reduced the protease activity (Figure 2C). The effect of NH₄ ⁺ addition time on TAP activity was investigated at a constant NH₄ ⁺ concentration (60 mM) during the culture process. After the NH₄ ⁺ addition, the TAP activity showed an initial increase followed by a drop in all addition cases (Figure 2D). When NH₄ ⁺ was added at 0 or 12 h, the TAP activity increased continuously for 24 h. In contrast, the increase phase was reduced to 12 h in the case of the addition at 24 h or 36 h. Finally, the NH₄ ⁺ addition at 12 h achieved the highest TAP activity among the tested addition time. To be noted, SSTI bands at 72 h were smaller than those at 36 h (Figure 1D). Researchers have demonstrated that SSTI is secreted into the fermentation medium in an early cultivation stage and partially degraded by tripeptidyl aminopeptidase in the later stage (Juettner et al., 2020). Generally, partial degradation endows SSTI with full TAP inhibitory activity (Juettner et al., 2020). Thus, SSTI might undergo a similar processing, which may account for the rapid decrease in TAP activity in the later phase of fermentation.

To improve TGase productivity, NH₄ ⁺ (60 mM) was added at 12 h during the fermentation of smY 2019. As shown in Figure 3A, the fermentation with NH₄ ⁺ addition achieved the peak value of TGase activity at 48 h, 36 h earlier than the fermentation without NH₄ ⁺ addition. Accordingly, the peak of the specific production rate also shifted forward when NH₄ ⁺ was added (Figure 3B). As indicated by SDS-PAGE analysis, the pro-TGase band was completely converted into the mature TGase band at 48 h in the case of the NH₄ ⁺ addition, and this band conversion ended at 84 h without NH₄ ⁺ addition (Figure 3C). Moreover, the TGase yield of the former was 18% higher than that of the latter (Figure 3A). Finally, through the NH₄ ⁺ addition, TGase productivity was increased from 0.23 U/(mLh) to 0.48 U/(mLh). In a previous study, MgCl₂ had been shown to have a positive effect on the activation of pro-TGase (Zhang et al., 2012). It is noteworthy that this activation was investigated in the context of a small amount of zymogen. For smY 2019, a high-yielding pro-TGase mutant, the activation effect was not improved after optimizing the amount of MgCl₂ (Supplementary Figure S3). Excessive addition of MgCl₂ could even be deleterious for the growth of S. mobaraensis (Zhang et al., 2012). As a nitrogen source, NH₄ ⁺ was harmless to cell growth and was a more appropriate activator of pro-TGase.

To be noted, NH₄ ⁺ addition improved the storage stability of the crude TGase solution of smY 2019. When treated at room temperature for 40 h, the TGase activity of the culture supernatant from the 48-h culture broth with NH₄ ⁺ addition retained 82% of initial activity, while that from 84-h culture broth without NH₄ ⁺ only obtained 65% residual activity (Figure 3D). This is probably due to the fact that a lot of proteases were produced at the later stage of S. mobaraensis, resulting in proteolytic degradation of TGase (Fuchsbauer, 2021). Therefore, the reduced fermentation period could not only increase the economy of the TGase but also its storage stability.