<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="research-article" dtd-version="2.3" xml:lang="EN" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Bioeng. Biotechnol.</journal-id>
<journal-title>Frontiers in Bioengineering and Biotechnology</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Bioeng. Biotechnol.</abbrev-journal-title>
<issn pub-type="epub">2296-4185</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="publisher-id">844517</article-id>
<article-id pub-id-type="doi">10.3389/fbioe.2022.844517</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Bioengineering and Biotechnology</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>The Biosynthesis of D-1,2,4-Butanetriol From <sc>d</sc>-Arabinose With an Engineered <italic>Escherichia coli</italic>
</article-title>
<alt-title alt-title-type="left-running-head">Wang et&#x20;al.</alt-title>
<alt-title alt-title-type="right-running-head">Biosynthesis of D-1,2,4-Butanetriol from <sc>d</sc>-Arabinose</alt-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name>
<surname>Wang</surname>
<given-names>Jing</given-names>
</name>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Qiaoyu</given-names>
</name>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Wang</surname>
<given-names>Xin</given-names>
</name>
<xref ref-type="corresp" rid="c001">&#x2a;</xref>
<uri xlink:href="https://loop.frontiersin.org/people/573529/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Chen</surname>
<given-names>Kequan</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/349303/overview"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ouyang</surname>
<given-names>Pingkai</given-names>
</name>
<uri xlink:href="https://loop.frontiersin.org/people/573324/overview"/>
</contrib>
</contrib-group>
<aff>
<institution>State Key Laboratory of Materials-Oriented Chemical Engineering</institution>, <institution>College of Biotechnology and Pharmaceutical Engineering</institution>, <institution>Nanjing Tech University</institution>, <addr-line>Nanjing</addr-line>, <country>China</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>
<bold>Edited by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/230164/overview">Joseph Boudrant</ext-link>, Centre National de la Recherche Scientifique (CNRS), France</p>
</fn>
<fn fn-type="edited-by">
<p>
<bold>Reviewed by:</bold> <ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/1267045/overview">Meijuan Xu</ext-link>, Jiangnan University, China</p>
<p>
<ext-link ext-link-type="uri" xlink:href="https://loop.frontiersin.org/people/152922/overview">Dae-Hee Lee</ext-link>, Korea Research Institute of Bioscience and Biotechnology (KRIBB), South&#x20;Korea</p>
</fn>
<corresp id="c001">&#x2a;Correspondence: Xin Wang, <email>xinwang1988@njtech.edu.cn</email>
</corresp>
<fn fn-type="other">
<p>This article was submitted to Bioprocess Engineering, a section of the journal Frontiers in Bioengineering and Biotechnology</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>24</day>
<month>03</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="collection">
<year>2022</year>
</pub-date>
<volume>10</volume>
<elocation-id>844517</elocation-id>
<history>
<date date-type="received">
<day>28</day>
<month>12</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>02</month>
<year>2022</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2022 Wang, Chen, Wang, Chen and Ouyang.</copyright-statement>
<copyright-year>2022</copyright-year>
<copyright-holder>Wang, Chen, Wang, Chen and Ouyang</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these&#x20;terms.</p>
</license>
</permissions>
<abstract>
<p>D-1,2,4-Butanetriol (BT) has attracted much attention for its various applications in energetic materials and the pharmaceutical industry. Here, a synthetic pathway for the biosynthesis of BT from <sc>d</sc>-arabinose was constructed and optimized in <italic>Escherichia coli</italic>. First, <italic>E.&#x20;coli</italic> Trans1-T1 was selected for the synthesis of BT. Considering the different performance of the enzymes from different organisms when expressed in <italic>E.&#x20;coli</italic>, the synthetic pathway was optimized. After screening two <sc>d</sc>-arabinose dehydrogenases (ARAs), two <sc>d</sc>-arabinonate dehydratases (ADs), four 2-keto acid decarboxylases (ADXs), and three aldehyde reductases (ALRs), ADG from <italic>Burkholderia sp</italic>., AraD from <italic>Sulfolobus solfataricus</italic>, KivD from <italic>Lactococcus lactis</italic> IFPL730, and AdhP from <italic>E.&#x20;coli</italic> were selected for the bio-production of BT. After 48&#xa0;h of catalysis, 0.88&#xa0;g/L BT was produced by the recombinant strain BT5. Once the enzymes were selected for the pathway, metabolic engineering strategy was conducted for further improvement. The final strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> produced 1.13&#xa0;g/L BT after catalyzing for 48&#xa0;h. Finally, the fermentation conditions and characteristics of BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> were also evaluated, and then 2.24&#xa0;g/L BT was obtained after 48&#xa0;h of catalysis under the optimized conditions. Our work was the first report on the biosynthesis of BT from <sc>d</sc>-arabinose which provided a potential for the large-scale production of <sc>d</sc>-glucose-based&#x20;BT.</p>
</abstract>
<kwd-group>
<kwd>D-1,2,4-butanetriol</kwd>
<kwd>D-arabinose</kwd>
<kwd>biosynthesis</kwd>
<kwd>metabolic engineering</kwd>
<kwd>bioengineering</kwd>
</kwd-group>
<contract-num rid="cn001">Grant No. 2021YFC2100800</contract-num>
<contract-num rid="cn002">2020M681570</contract-num>
<contract-sponsor id="cn001">National Key Research and Development Program of China<named-content content-type="fundref-id">10.13039/501100012166</named-content>
</contract-sponsor>
<contract-sponsor id="cn002">China Postdoctoral Science Foundation<named-content content-type="fundref-id">10.13039/501100002858</named-content>
</contract-sponsor>
</article-meta>
</front>
<body>
<sec id="s1">
<title>Introduction</title>
<p>D-1,2,4-Butanetriol (BT) is a straight-chain non-natural four-carbon polyol with wide applications. In the military context, BT is the precursor of D-1,2,4-butanetriol trinitrate (BTTN) which can be used as a propellant and an energetic plasticizer (<xref ref-type="bibr" rid="B23">Niu et&#x20;al., 2003</xref>). Compared to traditional nitroglycerine, BTTN is less hazardous, less shock-sensitive, less volatile, and more thermally stable (<xref ref-type="bibr" rid="B23">Niu et&#x20;al., 2003</xref>). BT is also an important building block for the synthesis of several drugs with high value (<xref ref-type="bibr" rid="B34">Yamada-Onodera et&#x20;al., 2007</xref>). It can be used as the precursor of a retardant that can control the release of a drug (<xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>) and it can also be dehydrated to 3-hydroxytetrahydrofuran, a key component for the HIV drug <italic>amprenavir</italic> (<xref ref-type="bibr" rid="B20">Mandava et&#x20;al., 2011</xref>). Currently, BT is mainly produced by the reduction of malic acid using NaBH<sub>4</sub> as a reducing agent. This process will produce a large number of borate salts as by-products (<xref ref-type="bibr" rid="B22">Monteith et&#x20;al., 1998</xref>). Besides this, the chemically synthesized butanetriol has two isomers that will limit its applications.</p>
<p>Due to the problems of the traditional chemical strategy, the microbial synthesis of BT was selected as an alternative route (<xref ref-type="bibr" rid="B18">Lu et&#x20;al., 2016</xref>). In 2003, Niu et&#x20;al. made the first report on the microbial synthesis of BT from <sc>d</sc>-xylose. By expressing <sc>d</sc>-xylose dehydrogenase, <sc>d</sc>-xylonate dehydratase, benzoylformate decarboxylase, and aldehyde reductase in <italic>E.&#x20;coli</italic>, 1.6&#xa0;g/L BT was obtained (<xref ref-type="bibr" rid="B23">Niu et&#x20;al., 2003</xref>). After that, a series of strategies including screening enzymes with high activities; improving the activity of the rate-limiting enzyme; knocking out the branch pathway and so on, were applied to improve the conversion rate and concentration of BT. Jing et&#x20;al. screened four decarboxylases from different organisms and the recombinant strain harboring the <italic>kivD</italic> gene produced 10.03&#xa0;g/L BT (<xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>); Sun et&#x20;al. conducted systematic fine-tuning of the expression level of the enzymes and BT production was increased by 4.3-fold (1.58&#xa0;g/L) from the prototype strain (<xref ref-type="bibr" rid="B28">Sun et&#x20;al., 2016</xref>). Bamba et&#x20;al. modified the metabolism of Fe<sup>2&#x2b;</sup> in <italic>Saccharomyces cerevisiae</italic> to improve the activity of <sc>d</sc>-xylonate dehydratase (XylD) which was considered as the rate-limiting enzyme, to enhance the synthesis of BT. Eventually, 1.7&#xa0;g/L of 1,2,4-butanetriol was produced from 10&#xa0;g/L xylose with a molar yield of 24.5% (<xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>). Metabolic engineering strategy was also conducted to disrupt the endogenous competitive pathways such as <sc>d</sc>-xylose isomerization pathway and 2-keto acid aldol pathway, for further improvement of the yield of BT from <sc>d</sc>-xylose in the past years (<xref ref-type="bibr" rid="B25">San et&#x20;al., 2002</xref>; <xref ref-type="bibr" rid="B1">Abdel-Ghany et&#x20;al., 2013</xref>; <xref ref-type="bibr" rid="B37">Zhang et&#x20;al., 2016</xref>). The application of these strategies has made some progress in the biosynthesis of BT from <sc>d</sc>-xylose in these years. Besides the method mentioned above, BT can also be produced from <sc>d</sc>-glucose. In 2014, Li et&#x20;al. reported a novel pathway for the biosynthesis of BT from <sc>d</sc>-glucose. <sc>d</sc>-glucose was first utilized by <italic>E.&#x20;coli</italic> to produce malate which shares a similar structure with BT. Then, after six steps of catalysis, BT was successfully produced from malate. Finally, 120&#xa0;ng/L BT was produced by <italic>E.&#x20;coli</italic> using <sc>d</sc>-glucose as the sole carbon source (<xref ref-type="bibr" rid="B16">Li et&#x20;al., 2014</xref>).</p>
<p>
<sc>d</sc>-Glucose has been used for the industrial production of various bulk chemicals successfully (<xref ref-type="bibr" rid="B35">Yim et&#x20;al., 2011</xref>; <xref ref-type="bibr" rid="B38">Zhang et&#x20;al., 2011</xref>; <xref ref-type="bibr" rid="B27">Song et&#x20;al., 2013</xref>). There is no doubt that achieving the production of BT from <sc>d</sc>-glucose is meaningful. However, the following obstacles make it hard to achieve the large-scale production of BT from <sc>d</sc>-glucose directly: First, the difficulty to achieve the perfect balance between cell growth, protein expression, and BT production; second, malyl CoA and 2,4-dihydeoxybutyryl CoA (two intermediates of the synthetic pathway from malate to BT) are not the natural substrates of succinate semialdehyde dehydrogenase (SucD) and Coenzyme A acylating aldehyde dehydrogenase (Ald). The metabolic flux is low; third, each molecule of BT needs to consume six molecules of cofactor (four NADH molecules and two ATP molecules) (<xref ref-type="bibr" rid="B16">Li et&#x20;al., 2014</xref>). Thus, developing a more efficient method for the biosynthesis of <sc>d</sc>-glucose-derived BT is urgently needed. After screening various derivatives of <sc>d</sc>-glucose, <sc>d</sc>-arabinose attracted our attention as its structure is similar to <sc>d</sc>-xylose. <sc>d</sc>-Arabinose can be obtained by oxidizing <sc>d</sc>-gluconate with Fenton reagent (<xref ref-type="bibr" rid="B19">Maletzky and Bauer, 1998</xref>; <xref ref-type="bibr" rid="B32">Wang and Lemley, 2002</xref>), while <sc>d</sc>-gluconate has been produced in large quantities from <sc>d</sc>-glucose via a fermentation process (<xref ref-type="bibr" rid="B40">Znad et&#x20;al., 2004</xref>). These reasons inspired us to develop a synthetic pathway to produce BT from <sc>d</sc>-arabinose, which can provide the production of <sc>d</sc>-glucose-derived BT with a biochemical method.</p>
<p>In this study, a synthetic pathway consisted of <sc>d</sc>-arabinose dehydrogenase (AraDH), <sc>d</sc>-arabinonate dehydratase (AraD), 2-keto acid decarboxylase (MdlC), and aldehyde reductase (AdhP) was designed and established in <italic>E.&#x20;coli</italic> for the bio-production of BT from <sc>d</sc>-arabinose (<xref ref-type="fig" rid="F1">Figure&#x20;1A</xref>). The host suitable for the pathway assembly with a higher activity of BT synthesis was first identified. Then, two ARAs, two ADs, four ADXs, and three ALRs from different organisms were evaluated to improve the production of BT. After that, the effect of by-product pathways on the biosynthesis of BT was also investigated. Under the optimized conditions, 2.24&#xa0;g/L BT was produced after 48&#xa0;h of bioconversion.</p>
<fig id="F1" position="float">
<label>FIGURE 1</label>
<caption>
<p>The BT biosynthetic pathway from <sc>d</sc>-arabinose in recombinant <italic>E.&#x20;coli</italic>. <bold>(A)</bold> The dashed lines represent the synthetic method from <sc>d</sc>-glucose to <sc>d</sc>-arabinose. The synthetic pathway of BT and branch pathways are marked by solid lines. The red Xs indicate that the genes are knocked out and enzymes shown in red indicate that these enzymes have been chosen for the production of BT from <sc>d</sc>-arabinose after screening. Symbols: AraDH/ADG, <sc>d</sc>-arabinose dehydrogenase; AraD/ADT, <sc>d</sc>-arabinonate dehydratase; MdlC/KivD/KdcA/Aro10, 2-keto acid decarboxylase; AdhP/BdhA/ADH2, aldehyde reductase; <italic>fucI</italic> encoding <sc>l</sc>-fucose isomerase; <italic>yiaE</italic>/<italic>ycdW</italic> encoding glyoxylate reductase; <italic>yagE</italic>/<italic>yjhH</italic> encoding 2-keto-3-deoxy-<sc>d</sc>-arabinonate aldolase; PPP, pentose phosphate pathway; TCA, tricarboxylic acid cycle. <bold>(B)</bold> The structure of <sc>d</sc>-arabinose and <sc>d</sc>-xylose.</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g001.tif"/>
</fig>
</sec>
<sec sec-type="results|discussion" id="s2">
<title>Results and Discussion</title>
<sec id="s2-1">
<title>Designing a Novel Biosynthetic Pathway for BT Production in <italic>E.&#x20;coli</italic>
</title>
<p>At present, the <italic>de novo</italic> production of BT from <sc>d</sc>-glucose was achieved (<xref ref-type="bibr" rid="B16">Li et&#x20;al., 2014</xref>). However, the imbalance between the cell growth, protein expression, and BT production, low enzyme activity, and huge demand for cofactors have resulted in the low BT production (120&#xa0;ng/L) from <sc>d</sc>-glucose. <sc>d</sc>-Arabinose, the derivative of <sc>d</sc>-glucose, was used here to develop an alternative way to produce BT from <sc>d</sc>-glucose (<xref ref-type="fig" rid="F1">Figure&#x20;1B</xref>). In previous studies (<xref ref-type="bibr" rid="B17">Liu et&#x20;al., 2012</xref>; <xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>; <xref ref-type="bibr" rid="B18">Lu et&#x20;al., 2016</xref>; <xref ref-type="bibr" rid="B28">Sun et&#x20;al., 2016</xref>; <xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>), BT was mainly obtained from <sc>d</sc>-xylose through a four-step catalytic reaction: dehydrogenation, dehydration, decarboxylation, and reduction (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>; <xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B10">Gao et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B39">Zhao et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B36">Yukawa et&#x20;al., 2021</xref>). As the structure of <sc>d</sc>-arabinose is similar with <sc>d</sc>-xylose, a four-step synthetic pathway consisted of <sc>d</sc>-arabinose dehydrogenase, <sc>d</sc>-arabinonate dehydratase, 2-keto acid decarboxylase, and aldehyde reductase was accordingly conducted here to produce BT from <sc>d</sc>-arabinose (<xref ref-type="fig" rid="F1">Figure&#x20;1A</xref>).</p>
<p>
<italic>E.&#x20;coli</italic>, the most widely used host for the production of various chemicals (<xref ref-type="bibr" rid="B14">Kaur et&#x20;al., 2018</xref>), was used here for BT biosynthesis. AraDH (ARA from <italic>S</italic>. <italic>solfataricus</italic>) (<xref ref-type="bibr" rid="B7">Brouns et&#x20;al., 2006</xref>), AraD (AD from <italic>S</italic>. <italic>solfataricus</italic>) (<xref ref-type="bibr" rid="B7">Brouns et&#x20;al., 2006</xref>), MdlC (ADX from <italic>P</italic>. <italic>putida</italic>) (<xref ref-type="bibr" rid="B29">Tsou et&#x20;al., 1990</xref>), and AdhP (ALR from <italic>E.&#x20;coli</italic>) (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>) were over-expressed in the <italic>E.&#x20;coli</italic> strain BL21, BL21 (DE3), and Trans1-T1, respectively, to assemble the BT synthetic pathway from <sc>d</sc>-arabinose (<xref ref-type="fig" rid="F1">Figure&#x20;1A</xref>). Then, these three strains were cultivated in LB medium and induced with 2&#xa0;mM IPTG when OD<sub>600nm</sub> of the culture reached 0.6. After incubating for 12 h, cells were harvested and used for the biosynthesis of BT from <sc>d</sc>-arabinose. After 24 h, 0.13&#xa0;g/L BT was detected in the reaction mixture catalyzed by the whole-cells of BT1 (<xref ref-type="fig" rid="F2">Figures 2A&#x2013;C</xref>). Many factors affect the final yield of desired products in cells for the bioproduction process, especially for the unnatural product. There is no universal strategy to obtain a high yield directly. However, the screening of different hosts is a common, simple, and effective strategy for the successful production of unnatural product (<xref ref-type="bibr" rid="B31">Vuralhan et&#x20;al., 2005</xref>; <xref ref-type="bibr" rid="B9">Falcioni et&#x20;al., 2013</xref>; <xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>). The reasons why the different host has a significant effect on the production of different product remains difficult to explain. The expression difference of heterologous proteins in different hosts might be one of potential factors. <italic>E.&#x20;coli</italic> Trans1-T1 has been successfully used in the biosynthesis of various chemicals (<xref ref-type="bibr" rid="B21">Meng et&#x20;al., 2015</xref>) and thus it was also used as a candidate here. As shown in <xref ref-type="fig" rid="F2">Figure&#x20;2A</xref>, BT production was only successfully detected when <italic>E.&#x20;coli</italic> Trans1-T1was used as the host. While none of BT was detected using the whole-cells of BL21-1 and BL21 (DE3)-1. SDS-PAGE analysis (<xref ref-type="sec" rid="s10">Supplementary Figure S1</xref>) exhibited that insoluble expression of the <sc>d</sc>-arabinonate dehydratase (AraD) was found in <italic>E coli</italic> BL21-1 and BL21 (DE3)-1, which might be related with their failure on BT production. Hence, it was used for further research. Finally, a time-course of the bio-conversion was also conducted (<xref ref-type="fig" rid="F2">Figure&#x20;2D</xref>), and the recombinant strain BT1 produced 0.42&#xa0;g/L BT after 48&#xa0;h of catalysis.</p>
<fig id="F2" position="float">
<label>FIGURE 2</label>
<caption>
<p>HPLC and GC-MS analysis for proof of the novel synthetic pathway for the production of BT from <sc>d</sc>-arabinose. <bold>(A)</bold> BT1 represents the strain <italic>E.&#x20;coli</italic> Trans1-T1/pTrc99a-MdlC-AraDH, pCWJ-AraD-AdhP; BL21-1 represents the strain <italic>E.&#x20;coli</italic> BL21/pTrc99a-MdlC-AraDH, pCWJ-AraD-AdhP; BL21 (DE3)-1 represents the strain <italic>E.&#x20;coli</italic> BL21 (DE3)/pTrc99a-MdlC-AraDH, pCWJ-AraD-AdhP. The bioconversion process was carried out at 33&#xb0;C on a rotatory shaker (200&#xa0;rpm). <bold>(B)</bold> HPLC analysis for proof of the novel synthetic pathway to produce BT from <sc>d</sc>-arabinose. The solid line represents the abundance of standard BT and the dashed line represents the abundance of the sample. Retention time of BT was 14.08&#xa0;min. <bold>(C)</bold> GC-MS analysis of the BT produced by strain BT1. <bold>(D)</bold> The time-course of the bio-conversion process catalyzed by the strain BT1. Bio-catalysis of <sc>d</sc>-arabinose to BT was conducted in a 100-ml Erlenmeyer flask which contains a 20-ml reaction mixture. OD<sub>600nm</sub> of the reaction mixture was 60. The concentration of <sc>d</sc>-arabinose was 20&#xa0;g/L. The titer of Mg<sup>2&#x2b;</sup> was 10&#xa0;mM. The reaction mixture was incubated at 33&#xb0;C on a rotatory shaker (200&#xa0;rpm). Error bars represent SD (<italic>n</italic>&#x20;&#x3d; 3).</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g002.tif"/>
</fig>
</sec>
<sec id="s2-2">
<title>Screening Enzymes for Improved BT Production</title>
<p>The BT biosynthetic pathway from <sc>d</sc>-arabinose consisted of four enzyme catalysis (dehydrogenation, dehydration, decarboxylation, and reduction). Considering that enzymes from various organisms may have different performances in BT production (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>), we evaluated the effect of enzyme sources on the pathway efficiency. The pH value (pH 7.0) of the whole-cells of BT1 almost had no change during the production of BT. This may result from the low activity of the <sc>d</sc>-arabinose dehydrogenase encoded by <italic>araDH</italic>. Thus, ADG from <italic>Burkholderia sp</italic>. was over-expressed in BT2, compared with BT1 (0.42&#xa0;g/L), the titer of BT catalyzed by whole-cells of BT2 reached 0.61&#xa0;g/L improving 45%. In some reports focusing on the synthesis of BT from <sc>d</sc>-xylose, <sc>d</sc>-xylonate always accumulated and the dehydration reaction was considered as the rate-limiting step (<xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B5">Ba&#xf1;ares et&#x20;al., 2019</xref>). Thus, we replaced AraD with ADT from <italic>P</italic>. <italic>fluorescens</italic> and constructed the recombinant strain BT3 for evaluating the effect of AD in the bio-production of BT. After 48 h, only 0.08&#xa0;g/L BT was detected (<xref ref-type="fig" rid="F3">Figure&#x20;3</xref>), which was only 13% of the activity of BT2. This result indicated that the activity of the <sc>d</sc>-arabinonate dehydratase was particularly important for the production of BT and AraD was more suitable than ADT in the synthesis of&#x20;BT.</p>
<fig id="F3" position="float">
<label>FIGURE 3</label>
<caption>
<p>Screening enzymes for improved production of BT. BT1 and BT2 are used to evaluate the effect of ARA and enzyme names are shown in red; BT2 and BT3 are used to evaluate the effect of AD and enzyme names are shown in blue; BT2, BT4, BT5, and BT6 are used to evaluate the effect of ADX and enzyme names are shown in magenta; BT5, BT7, and BT8 are used to evaluate the effect of ALR and enzyme names are shown in green. Four enzymes expressed in each strain are listed in the table. Error bars represent SD (<italic>n</italic>&#x20;&#x3d; 3).</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g003.tif"/>
</fig>
<p>The third step of the synthetic pathway was catalyzed by 2-keto acid decarboxylase, a vital group of enzymes crucial to the production of keto acid derived alcohols (<xref ref-type="bibr" rid="B3">Atsumi et&#x20;al., 2008</xref>). Thus, we applied another three ADXs: Aro10 from <italic>S. cerevisiae</italic>, KivD from <italic>L</italic>. <italic>lactis</italic> IFPL730, and KdcA from <italic>L</italic>. <italic>lactis</italic> B1157 to the biosynthesis of BT, respectively. As shown in <xref ref-type="fig" rid="F3">Figure&#x20;3</xref>, recombinant strain BT5 expressing KivD produced 0.88&#xa0;g/L BT which was 40% higher than that of BT2 expressing MdlC, proving that KivD was the most suitable ADX here. This result was consistent with the conclusion drawn by Jing et&#x20;al. after screening four 2-keto acid decarboxylases in the production of BT from <sc>d</sc>-xylose (<xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>). However, Wang et&#x20;al. reported that KdcA from <italic>L. lactis</italic> B1157 performed best in the synthesis of BT (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>). Different expression hosts and other enzymes used in the synthetic pathway may be responsible for this difference. The same situation happened in the evaluation of ALRs. In this research, BT5 expressing AdhP from <italic>E.&#x20;coli</italic> performed better BT synthesis activity compared to BT7 expressing BdhA from <italic>Bacillus subtilis</italic> WB800N and BT8 expressing ADH2 from <italic>S. cerevisiae</italic> in the synthesis of BT (<xref ref-type="fig" rid="F3">Figure&#x20;3</xref>). Although, Biswas et&#x20;al. reported that overexpressing BdhA improved the production of 2,3-butanediol (<xref ref-type="bibr" rid="B6">Biswas et&#x20;al., 2012</xref>), ADH2 was proved to perform well in the production of BT (<xref ref-type="bibr" rid="B37">Zhang et&#x20;al., 2016</xref>). Wang et&#x20;al. proved that AdhP was more suitable for the synthesis of BT after evaluating six ALRs (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>). Here, the strain BT5&#x20;over-expressing ADG, AraD, KivD, and AdhP exhibited the best activity in the synthesis of BT from <sc>d</sc>-arabinose and the BT (0.86&#xa0;g/L) production improved 105% compared to that of BT1 (0.42&#xa0;g/L).</p>
</sec>
<sec id="s2-3">
<title>The Effect of the By-Product Pathway on BT Synthesis</title>
<p>In the pathway to produce D-1,2,4-butanetriol from <sc>d</sc>-xylose, the substrate and intermediates can be consumed by endogenous enzymes in <italic>E.&#x20;coli</italic> (<xref ref-type="bibr" rid="B28">Sun et&#x20;al., 2016</xref>; <xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>; <xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>). Therefore, the engineering of byproduct pathway to improve the conversion yield of <sc>d</sc>-xylose to D-1,2,4-butanetriol has gained much attentions recently (<xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>; <xref ref-type="bibr" rid="B4">Bamba et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B5">Ba&#xf1;ares et&#x20;al., 2019</xref>; <xref ref-type="bibr" rid="B10">Gao et&#x20;al., 2019</xref>). The <sc>d</sc>-arabinose isomerase encoded by <italic>fucI</italic> of <italic>E.&#x20;coli</italic> can catalyze the isomerization of <sc>d</sc>-arabinose to <sc>d</sc>-ribulose which may reduce the flux toward BT. Thus, the strain BT5&#x394;<italic>fucI</italic> was constructed. After 48&#xa0;h catalyzed by the whole-cells of BT5&#x394;<italic>fucI</italic>, 0.87&#xa0;g/L BT was produced which was almost the same as that of BT5 (<xref ref-type="fig" rid="F4">Figure&#x20;4</xref>). This result was different from previous reports where disrupting the <sc>d</sc>-xylose isomerization pathway in <italic>E.&#x20;coli</italic> improved the yield of BT (<xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>; <xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>). This difference might be associated with the fact that the <italic>E.&#x20;coli</italic> host metabolizes <sc>d</sc>-xylose faster than <sc>d</sc>-arabinose (<xref ref-type="sec" rid="s10">Supplementary Figure S2</xref>). Leblanc and Mortlock also reported that at least 5&#x20;days were needed before the growth of <italic>E.&#x20;coli</italic> 1000 could be detected on <sc>d</sc>-arabinose (<xref ref-type="bibr" rid="B15">LeBlanc and Mortlock, 1971</xref>). The low consumption of <sc>d</sc>-arabinose by <italic>E.&#x20;coli</italic> is undoubtedly beneficial for the synthesis of BT. After that, the gene <italic>yiaE</italic> and <italic>ycdW</italic> encoding the 2-keto acid reductase which was reported to catalyze the reduction of 2-keto acid (<xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>) were knocked out, yielding the mutant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>. As the results show in <xref ref-type="fig" rid="F4">Figure&#x20;4</xref>, the strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic> produced 0.93&#xa0;g/L BT, which was 7% higher than that of BT5. In addition, 2-keto acid could also be converted to pyruvate and glycolaldehyde by native aldolase encoded by <italic>yagE</italic> and <italic>yjhH</italic> of <italic>E.&#x20;coli</italic> (<xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>). The strain BT5&#x394;<italic>yagE</italic> was constructed to evaluate its effect on the synthesis of BT from <sc>d</sc>-arabinose. After bioconversion of 48 h, 1.0&#xa0;g/L BT was produced by the whole-cells of BT5&#x394;<italic>yagE</italic> with a 10% increase compared to that of BT5 (<xref ref-type="fig" rid="F4">Figure&#x20;4</xref>). Afterward, we knocked out both <italic>yagE</italic> and <italic>yjhH</italic> genes to completely disrupt this branched pathway yielding the recombinant strain BT5&#x394;<italic>yagE</italic>&#x394;<italic>yjhH</italic>. Unfortunately, less BT (0.73&#xa0;g/L) was produced by this strain. This was different from a previous report, simultaneously disrupting <italic>yagE</italic> and <italic>yjhH</italic> which encode the 2-keto acid aldolase promoted the synthesis of BT (<xref ref-type="bibr" rid="B30">Valdehuesa et&#x20;al., 2014</xref>). As shown in <xref ref-type="sec" rid="s10">Supplementary Figure S3</xref>, the cell density of the reaction conducted by the whole-cells of BT5&#x394;<italic>yagE</italic>&#x394;<italic>yjhH</italic> decreased faster than other groups within 24&#xa0;h. This suggested that the reaction to generate pyruvate catalyzed by YagE and YjhH might be important to maintain the stability of the cells. Completely blocking the production of pyruvate was not conducive to the synthesis of BT. The final strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> produced 1.13&#xa0;g/L BT after 48&#xa0;h of catalysis.</p>
<fig id="F4" position="float">
<label>FIGURE 4</label>
<caption>
<p>The BT produced by the metabolic engineered T1 series strains after catalyzing for 48&#xa0;h. All of these six strains harbored the plasmid pCWJ-AraD-AdhP and pTrc99a-KivD-ADG. Statistical analysis was performed using Student&#x2019;s t-test (two-tailed; &#x2a;<italic>p</italic>&#x20;&#x3c; 0.05; &#x2a;&#x2a;<italic>p</italic>&#x20;&#x3c; 0.01; &#x2a;&#x2a;&#x2a;<italic>p</italic>&#x20;&#x3c; 0.005; &#x2a;&#x2a;&#x2a;&#x2a;<italic>p</italic>&#x20;&#x3c; 0.001; ns, no significant difference). Error bars represent SD (<italic>n</italic>&#x20;&#x3d; 3).</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g004.tif"/>
</fig>
</sec>
<sec id="s2-4">
<title>Optimizing Cultivation and Biotransformation Conditions for Improving BT Production</title>
<p>It is well known that cultivation conditions contribute greatly to the recombinant pathway performance in <italic>E.&#x20;coli</italic> and the production of <sc>d</sc>-xylose-derived BT had been increased after optimizing the fermentation conditions (<xref ref-type="bibr" rid="B33">Wang et&#x20;al., 2018</xref>). Thus, the fermentation conditions including induction temperature, IPTG concentration, and induction OD<sub>600nm</sub> were investigated to improve BT production. For the original fermentation condition, the IPTG concentration was 2&#xa0;mM, the induction temperature was 33&#xb0;C, and the induction OD<sub>600nm</sub> was 2. As shown in <xref ref-type="fig" rid="F5">Figure&#x20;5A</xref>, BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> was incubating at a temperature ranging from 15 to 33&#xb0;C, and the maximum BT production was achieved when the strain was incubating at 20&#xb0;C. After catalyzing for 48 h, 1.62&#xa0;g/L BT was obtained, which improved 40% compared to that of the strain incubated at 33&#xb0;C. The highest BT synthesis ability of BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> was gained when the induction OD<sub>600nm</sub> was 2 (<xref ref-type="fig" rid="F5">Figure&#x20;5B</xref>). Induction conducted at the middle phase of logarithmic growth reduced the damage caused by the over-expression of four enzymes (<xref ref-type="sec" rid="s10">Supplementary Figure S4</xref>). Finally, the effect of the IPTG concentration was investigated by varying the titer from 0.5 to 2.5&#xa0;mM. When adding 2&#xa0;mM IPTG (final concentration), the strain exhibited the best catalytic activity and 1.13&#xa0;g/L BT was achieved (<xref ref-type="fig" rid="F5">Figure&#x20;5C</xref>). Compared to the strain induced with 0.5&#xa0;mM IPTG, the activity increased by about 60%. Overall, under the optimal fermentation conditions (induction temperature was 20&#xb0;C; induction OD<sub>600nm</sub> was 2; IPTG concentration was 2&#xa0;mM), the production of BT reached 1.62&#xa0;g/L.</p>
<fig id="F5" position="float">
<label>FIGURE 5</label>
<caption>
<p>Optimizing the fermentation conditions to produce BT. <bold>(A)</bold> The optimum induction temperature. <bold>(B)</bold> The optimum induction OD<sub>600nm</sub>. <bold>(C)</bold> The optimum IPTG concentration. The original fermentation conditions: induction temperature was 33&#xb0;C; induction OD<sub>600nm</sub> was 2; IPTG concentration was 2&#xa0;mM. Each experiment only changes a single variable. Error bars represent SD (<italic>n</italic>&#x20;&#x3d; 3).</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g005.tif"/>
</fig>
<p>To further improve BT production, we also evaluated the bioconversion conditions by the recombinant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic>. Here, substrate concentration, catalytic temperature, and initial reaction pH were optimized for improved BT production. The initial reaction conditions were as follows: 20&#xa0;g/L <sc>d</sc>-arabinose, pH 7.0, and 33&#xb0;C. To determine the optimal reaction temperature, the reaction was carried out at 20&#xb0;C, 25&#xb0;C, 30&#xb0;C, 33&#xb0;C, 37&#xb0;C, or 40&#xb0;C, respectively (<xref ref-type="fig" rid="F6">Figure&#x20;6A</xref>). From 20 to 37&#xb0;C, the activity increased with the temperature rising and reached the maximum at 37&#xb0;C, which was consistent with the result reported by Gao et&#x20;al., in 2019 (<xref ref-type="bibr" rid="B10">Gao et&#x20;al., 2019</xref>). As described in <xref ref-type="fig" rid="F6">Figure&#x20;6B</xref>, the BT titer reached the highest level when the concentration of <sc>d</sc>-arabinose reached 20&#xa0;g/L. The optimum initial reaction pH was 7.0 (<xref ref-type="fig" rid="F6">Figure&#x20;6C</xref>), which was very close to the optimum pH for AraD (<xref ref-type="bibr" rid="B7">Brouns et&#x20;al., 2006</xref>). Andberg et&#x20;al. also reported this phenomenon (<xref ref-type="bibr" rid="B2">Andberg et&#x20;al., 2016</xref>), and this result suggested that the dehydration reaction may be the vital point in the synthesis of BT. Under the optimal catalytic conditions, the production of BT reached 2.24&#xa0;g/L. As mentioned earlier, during the production of BT from <sc>d</sc>-arabinose, the pH of the reaction mixture remained stable. This avoids the detrimental effect of a large pH drop when producing BT from <sc>d</sc>-xylose (<xref ref-type="bibr" rid="B5">Ba&#xf1;ares et&#x20;al., 2019</xref>). Compared with the recent reports on the biosynthesis of BT from <sc>d</sc>-xylose, the BT titer and yield produced from <sc>d</sc>-arabinose are not high enough (<xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>; <xref ref-type="bibr" rid="B36">Yukawa et&#x20;al., 2021</xref>). There are still many aspects that need to be improved to further improve the production of BT from <sc>d</sc>-arabinose: screening for more active dehydrogenases and dehydratases, fine-tuning the expression levels of each enzyme, and balancing the ratio of NAD(P)<sup>&#x2b;</sup>/NAD(P)H.</p>
<fig id="F6" position="float">
<label>FIGURE 6</label>
<caption>
<p>Characterization of the recombinant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE.</italic> <bold>(A)</bold> The optimum catalytic temperature. <bold>(B)</bold> The optimum substrate concentration. <bold>(C)</bold> The optimum original reaction pH. The original catalytic conditions: reaction temperature was 33&#xb0;C; substrate concentration was 20&#xa0;g/L; reaction pH was 7.0. Each experiment only changes a single variable. Error bars represent SD (<italic>n</italic>&#x20;&#x3d; 3).</p>
</caption>
<graphic xlink:href="fbioe-10-844517-g006.tif"/>
</fig>
<p>The production of the by-products was also detected (<xref ref-type="sec" rid="s10">Supplementary Figure S5</xref>). We found that the recombinant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> produced 0.45&#xa0;mM pyruvate, 27.8&#xa0;mM acetate, and 7.9&#xa0;mM ethylene glycol after bioconversion of 48&#xa0;h. In the meantime, 50&#xa0;mM <sc>d</sc>-arabinose remained in the reaction solution. This result indicated that acetate was the main by-product. In addition, the mass balance revealed that approximate 30&#xa0;mM of <sc>d</sc>-arabinose was missed. This part of the substrate may exist as the intermediate product, or it may be consumed by the strain through an unreported metabolic pathway. Further research to evaluate the effect of blocking the acetate synthesis pathway on the production of BT or the metabolic process of <sc>d</sc>-arabinose in <italic>E.&#x20;coli</italic> might be worthy to improve BT production.</p>
</sec>
</sec>
<sec sec-type="conclusion" id="s3">
<title>Conclusion</title>
<p>Here, the synthetic pathway for the biosynthesis of BT from <sc>d</sc>-arabinose was conducted in <italic>E.&#x20;coli</italic> Trans1-T1. After screening two ARAs, two ADs, four ADXs, and three ALRs, ADG from <italic>Burkholderia sp</italic>., AraD from <italic>S</italic>. <italic>solfataricus</italic>, KivD from <italic>L. lactis</italic> IFPL730, and AdhP from <italic>E.&#x20;coli</italic> were selected. After 48&#xa0;h of catalysis, 0.88&#xa0;g/L BT was produced by the strain BT5 expressing these four enzymes. Besides this, a metabolic engineering strategy was also employed in this work, the recombinant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> produced 1.13&#xa0;g/L BT after catalyzing for 48&#xa0;h. Finally, fermentation conditions were optimized, and the recombinant strain BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> was also characterized. Under the optimized conditions, BT5&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>&#x394;<italic>yagE</italic> produced 2.24&#xa0;g/L BT after catalyzing for 48&#xa0;h. Compared with <sc>d</sc>-xylose, <italic>E.&#x20;coli</italic> consumes <sc>d</sc>-arabinose more slowly, which indicates that a higher conversion rate may be possible in the future. During the catalytic process, the catalytic rate of the substrate is slow, which may be caused by insufficient dehydrogenase activity. In the follow-up study, further screening of dehydrogenase is needed. Of course, in such a multi-enzyme catalyzed reaction process, the matching of the reaction rates of each step is also very important. A large and rapid synthesis of acid will cause a rapid drop in pH value, which is disadvantageous in the production of BT (<xref ref-type="bibr" rid="B5">Ba&#xf1;ares et&#x20;al., 2019</xref>). Acetate was found as the main by-product, and subsequent studies can evaluate the effect of the acetate synthesis pathway on the biosynthesis of BT. Overall, the work presented here offered an alternative biosynthesis pathway for the bio-production of BT. This paper was the first report on the biosynthesis of BT from <sc>d</sc>-arabinose and supplied a potential for the large-scale production of <sc>d</sc>-glucose-based&#x20;BT.</p>
</sec>
<sec sec-type="methods" id="s4">
<title>Methods</title>
<sec id="s4-1">
<title>Strains and Media</title>
<p>All the strains constructed in this study are listed in <xref ref-type="table" rid="T1">Table&#x20;1</xref>. The <italic>E.&#x20;coli</italic> strain was cultured in Luria Bertani medium (tryptone 10&#xa0;g/L, yeast extract 5&#xa0;g/L, and NaCl 10&#xa0;g/L) containing 50&#xa0;mg/L Ampicillin and 50&#xa0;mg/L Chloramphenicol. BT, &#x3b2;-d-1-thiogalactopyranoside (IPTG), MgSO<sub>4</sub>&#x2219;7H<sub>2</sub>O, Na<sub>2</sub>HPO<sub>4</sub>, KH<sub>2</sub>PO<sub>4</sub>, <sc>d</sc>-xylose, and <sc>d</sc>-arabinose were purchased from Aladdin Ind. Co., Ltd. (China).</p>
<table-wrap id="T1" position="float">
<label>TABLE 1</label>
<caption>
<p>Strains used in this&#x20;study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Strains</th>
<th align="center">Descriptions</th>
<th align="center">References</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">Trans1-T1</td>
<td align="left">F<sup>&#x2212;</sup>&#x3c6;80 (<italic>lac</italic>Z)&#x394;M15&#x394;<italic>lac</italic>X74&#x20;<italic>hsd</italic>R (r<sub>k</sub>
<sup>&#x2212;</sup>, m<sub>k</sub>
<sup>&#x2b;</sup>)&#x394;<italic>rec</italic>A1398<italic>end</italic>A1t<italic>on</italic>A</td>
<td align="left">TransGen</td>
</tr>
<tr>
<td align="left">BL21</td>
<td align="left">
<italic>E.&#x20;coli</italic> B F<sup>&#x2212;</sup> <italic>dcm omp</italic>T <italic>hsd</italic>S (r<sub>B</sub>
<sup>-</sup>m<sub>B</sub>
<sup>-</sup>) <italic>gal</italic> [<italic>mal</italic>B<sup>&#x2b;</sup>]<sub>K-12</sub> (&#x3bb;<sup>S</sup>)</td>
<td align="left">TransGen</td>
</tr>
<tr>
<td align="left">BL21 (DE3)</td>
<td align="left">F<sup>&#x2212;</sup> <italic>omp</italic>T <italic>hsd</italic>S (r<sub>B</sub>
<sup>-</sup>m<sub>B</sub>
<sup>-</sup>) <italic>gal dcm</italic> (DE3)</td>
<td align="left">TransGen</td>
</tr>
<tr>
<td align="left">T1-1</td>
<td align="left">Trans1-T1&#x394;<italic>fucI</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">T1-2</td>
<td align="left">Trans1-T1&#x394;<italic>ycdW</italic>&#x394;<italic>yiaE</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">T1-3</td>
<td align="left">Trans1-T1&#x394;<italic>yagE</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">T1-4</td>
<td align="left">Trans1-T1&#x394;<italic>yagE</italic>&#x394;<italic>yjhH</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">T1-5</td>
<td align="left">Trans1-T1&#x394;<italic>ycdW</italic>&#x394;<italic>yiaE</italic>&#x394;<italic>yagE</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BL21-1</td>
<td align="left">BL21 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-MdlC-AraDH</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BL21 (DE3)-1</td>
<td align="left">BL21 (DE3) harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-MdlC-AraDH</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT1</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-MdlC-AraDH</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT2</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-MdlC-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT3</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-ADT-AdhP &#x26; pTrc99a-MdlC-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT4</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-Aro10-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT5</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-KivD-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT6</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-AdhP &#x26; pTrc99a-KdcA-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT7</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-BdhA &#x26; pTrc99a-KivD-ADG</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">BT8</td>
<td align="left">Trans1-T1 harboring plasmid pCWJ-AraD-ADH2 &#x26; pTrc99a-KivD-ADG</td>
<td align="left">This study</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s4-2">
<title>Construction of Plasmids</title>
<p>All the plasmids constructed in this study are listed in <xref ref-type="table" rid="T2">Table&#x20;2</xref> and all primers used in this work are listed in <xref ref-type="table" rid="T3">Table&#x20;3</xref>. The genes: <italic>araDH</italic> and <italic>araD</italic> from <italic>Sulfolobus solfataricus</italic>, <italic>aDG</italic> from <italic>Burkholderia sp</italic>., <italic>aDT</italic> from <italic>Pseudomonas fluorescens</italic>, <italic>bdhA</italic> from <italic>Bacillus subtilis</italic> WB800N, and <italic>aDH</italic>2 from <italic>Saccharomyces cerevisiae</italic> were codon-optimized and synthesized by Sprin GenBioTech Co., Ltd. (Nanjing, China), respectively. The DNA fragment of <italic>araDH</italic> was inserted into <italic>Nco</italic>I/<italic>Bam</italic>HI sites of pTrc99a to yield the plasmid pTrc99a-AraDH. The DNA fragment of <italic>araD</italic>, <italic>aDG</italic>, and <italic>aDT</italic> was inserted into <italic>Nco</italic>I/<italic>Bam</italic>HI sites of pCWJ producing the plasmid pCWJ-AraD, pCWJ-ADG, and pCWJ-ADT, respectively. The fragment of <italic>bdhA</italic> and <italic>aDH</italic>2 was inserted between the <italic>Nco</italic>I and <italic>Hind</italic>III sites by in-fusion clone to generate the plasmid pCWJ-BdhA and pCWJ-ADH2. Then, the Trc-<italic>araDH</italic> fragment amplified from pTrc99a-AraDH with primer P1 and P2 was inserted into <italic>Sac</italic>I/<italic>Bam</italic>HI sites of pTrc99a-MdlC-XylB producing the plasmid pTrc99a-MdlC-AraDH. Primer P3 and P4 were used to amplify Trc-<italic>araD</italic> fragment and it was inserted into <italic>Spe</italic>I/<italic>Kpn</italic>I sites of pCWJ-YjhG-AdhP yielding the plasmid pCWJ-AraD-AdhP.</p>
<table-wrap id="T2" position="float">
<label>TABLE 2</label>
<caption>
<p>Plasmids used in this&#x20;study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">
<italic>E.&#x20;coli</italic> plasmids</th>
<th align="center">Descriptions</th>
<th align="center">References</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">pCWJ</td>
<td align="left">Cm<sup>r</sup>, P<sub>trc</sub>, ori (RSF)</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTrc99a</td>
<td align="left">Ap<sup>r</sup>, P<sub>trc</sub>, ori (pBR322)</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pCas</td>
<td align="left">Kan<sup>r</sup>, P<sub>araB</sub>-<italic>Red</italic>, P<sub>cas</sub>-<italic>Cas9</italic>, repA101, ori (pSC101), P<sub>lacIq</sub>, <italic>lacI</italic>, P<sub>trc</sub>-sgRNA-pMB1</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTarget</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA, pMB1, <italic>aadA</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pCWJ-YjhG-AdhP</td>
<td align="left">Cm<sup>r</sup>, pCWJ harboring <italic>yjhG</italic> &#x26; <italic>adhP</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pCWJ-AraD-AdhP</td>
<td align="left">Cm<sup>r</sup>, pCWJ harboring <italic>araD</italic> &#x26; <italic>adhP</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pCWJ-ADT-AdhP</td>
<td align="left">Cm<sup>r</sup>, pCWJ harboring <italic>aDT</italic> &#x26; <italic>adhP</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pCWJ-AraD-BdhA</td>
<td align="left">Cm<sup>r</sup>, pCWJ harboring <italic>araD</italic> &#x26; <italic>bdhA</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pCWJ-AraD-ADH2</td>
<td align="left">Cm<sup>r</sup>, pCWJ harboring <italic>araD</italic> &#x26; <italic>aDH2</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTrc99a-MdlC-XylB</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>mdlC</italic> &#x26; <italic>xylB</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTrc99a-KivD-XylB</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>kivD</italic> &#x26; <italic>xylB</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTrc99a-KdcA-XylB</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>kdcA</italic> &#x26; <italic>xylB</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTrc99a-Aro10-XylB</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>aro10</italic> &#x26; <italic>xylB</italic>
</td>
<td align="left">Lab stock</td>
</tr>
<tr>
<td align="left">pTrc99a-MdlC-AraDH</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>mdlC</italic> &#x26; <italic>araDH</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTrc99a-MdlC-ADG</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>mdlC</italic> &#x26; <italic>aDG</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTrc99a-Aro10-ADG</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>aro10</italic> &#x26; <italic>aDG</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTrc99a-KivD-ADG</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>kivD</italic> &#x26; <italic>aDG</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTrc99a-KdcA-ADG</td>
<td align="left">Ap<sup>r</sup>, pTrc99a harboring <italic>kdcA</italic> &#x26; <italic>aDG</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTarget-&#x394;fucI</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA-<italic>fucI</italic>, pMB1, <italic>aadA</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTarget-&#x394;yiaE</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA-<italic>yiaE</italic>, pMB1, <italic>aadA</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTarget-&#x394;ycdW</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA-<italic>ycdW</italic>, pMB1, <italic>aadA</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTarget-&#x394;yagE</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA-<italic>yagE</italic>, pMB1, <italic>aadA</italic>
</td>
<td align="left">This study</td>
</tr>
<tr>
<td align="left">pTarget-&#x394;yjhH</td>
<td align="left">Spe<sup>r</sup>, pJ23119, sgRNA-<italic>yjhH</italic>, pMB1, <italic>aadA</italic>
</td>
<td align="left">This study</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>sgRNA-<italic>fucI</italic>, sgRNA with an N20 sequence for targeting the <italic>fucI</italic> locus; sgRNA-<italic>yiaE</italic>, sgRNA with an N20 sequence for targeting the <italic>yiaE</italic> locus; sgRNA-<italic>ycdW</italic>, sgRNA with an N20 sequence for targeting the <italic>ycdW</italic> locus; sgRNA-<italic>yagE</italic>, sgRNA with an N20 sequence for targeting the <italic>yagE</italic> locus; sgRNA-<italic>yjhH</italic>, sgRNA with an N20 sequence for targeting the <italic>yjhH</italic>&#x20;locus.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T3" position="float">
<label>TABLE 3</label>
<caption>
<p>Primers used in this&#x20;study.</p>
</caption>
<table>
<thead valign="top">
<tr>
<th align="left">Name</th>
<th align="center">Primers</th>
<th align="center">Sequences (5&#x2019; - 3&#x2032;)</th>
</tr>
</thead>
<tbody valign="top">
<tr>
<td align="left">P1</td>
<td align="left">Trc-SacI-F</td>
<td align="left">CGA&#x200b;GCT&#x200b;CTT&#x200b;GAC&#x200b;AAT&#x200b;TAA&#x200b;TCA&#x200b;TCC&#x200b;GGC&#x200b;TCG</td>
</tr>
<tr>
<td align="left">P2</td>
<td align="left">AraDH-BamHI-R</td>
<td align="left">CGG&#x200b;GAT&#x200b;CCT&#x200b;TAC&#x200b;GGG&#x200b;GTG&#x200b;ATA&#x200b;A</td>
</tr>
<tr>
<td align="left">P3</td>
<td align="left">Trc-SpeI-F</td>
<td align="left">CTA&#x200b;GAC&#x200b;TAG&#x200b;TTT&#x200b;GAC&#x200b;AAT&#x200b;TAA&#x200b;TCA&#x200b;TCC&#x200b;GGC&#x200b;TCG</td>
</tr>
<tr>
<td align="left">P4</td>
<td align="left">AraD-KpnI-R</td>
<td align="left">GGG&#x200b;GTA&#x200b;CCT&#x200b;TAA&#x200b;GAT&#x200b;TTG&#x200b;CAT&#x200b;TTG&#x200b;TAT&#x200b;TCT&#x200b;TCG</td>
</tr>
<tr>
<td align="left">P5</td>
<td align="left">Trc-ADG-F</td>
<td align="left">TTT&#x200b;CTC&#x200b;CGG&#x200b;TTA&#x200b;AAT&#x200b;AAG&#x200b;TCT&#x200b;CCC&#x200b;TTA&#x200b;TGC&#x200b;GAC&#x200b;TCC&#x200b;TGC&#x200b;ATT&#x200b;AGG</td>
</tr>
<tr>
<td align="left">P6</td>
<td align="left">Trc-ADG-R</td>
<td align="left">GGT&#x200b;CGA&#x200b;CTC&#x200b;TAG&#x200b;AGG&#x200b;ATC&#x200b;GGA&#x200b;TCC&#x200b;TTA&#x200b;ACG</td>
</tr>
<tr>
<td align="left">P7</td>
<td align="left">Trc-ADG-SacI-F</td>
<td align="left">CGA&#x200b;GCT&#x200b;CTT&#x200b;ATG&#x200b;CGA&#x200b;CTC&#x200b;CTG&#x200b;CAT&#x200b;TAG&#x200b;GAA&#x200b;ATA&#x200b;CT</td>
</tr>
<tr>
<td align="left">P8</td>
<td align="left">Trc-ADG-BamHI-R</td>
<td align="left">CGG&#x200b;GAT&#x200b;CCT&#x200b;TAA&#x200b;CGA&#x200b;CCG&#x200b;AAA&#x200b;GCG&#x200b;TCA&#x200b;GTA&#x200b;CC</td>
</tr>
<tr>
<td align="left">P9</td>
<td align="left">Trc-ADT-F</td>
<td align="left">TGC&#x200b;ATT&#x200b;AGG&#x200b;AAA&#x200b;TAC&#x200b;TAG&#x200b;ACT&#x200b;CCT&#x200b;GCA&#x200b;TTA&#x200b;GGA&#x200b;AAT&#x200b;ACT&#x200b;AGT&#x200b;TTG&#x200b;ACA&#x200b;AT</td>
</tr>
<tr>
<td align="left">P10</td>
<td align="left">Trc-ADT-R</td>
<td align="left">GGA&#x200b;TGA&#x200b;TTA&#x200b;ATT&#x200b;GTC&#x200b;AAG&#x200b;TTA&#x200b;GTG&#x200b;AGA&#x200b;GTG&#x200b;ACG&#x200b;CGG&#x200b;AAC&#x200b;TTC&#x200b;AG</td>
</tr>
<tr>
<td align="left">P11</td>
<td align="left">Trc-bdhA-KpnI-F</td>
<td align="left">GGG&#x200b;GTA&#x200b;CCT&#x200b;TGA&#x200b;CAA&#x200b;TTA&#x200b;ATC&#x200b;ATC&#x200b;CGG&#x200b;CTC&#x200b;G</td>
</tr>
<tr>
<td align="left">P12</td>
<td align="left">Trc-bdhA-SalI-R</td>
<td align="left">ACG&#x200b;CGT&#x200b;CGA&#x200b;CAT&#x200b;TTG&#x200b;TCC&#x200b;TAC&#x200b;TCA&#x200b;GGA&#x200b;GAG&#x200b;C</td>
</tr>
<tr>
<td align="left">P13</td>
<td align="left">Trc-ADH2-KpnI-F</td>
<td align="left">GGG&#x200b;GTA&#x200b;CCT&#x200b;TGA&#x200b;CAA&#x200b;TTA&#x200b;ATC&#x200b;ATC&#x200b;CGG&#x200b;CTC&#x200b;GTA</td>
</tr>
<tr>
<td align="left">P14</td>
<td align="left">Trc-ADH2-SalI-R</td>
<td align="left">GCG&#x200b;TCG&#x200b;ACA&#x200b;TTT&#x200b;GTC&#x200b;CTA&#x200b;CTC&#x200b;AGG&#x200b;AGA&#x200b;GCG&#x200b;T</td>
</tr>
<tr>
<td align="left">P15</td>
<td align="left">Target-fucI-F</td>
<td align="left">
<underline>ATGTGCGTACCTACTGGTCA</underline>GTTTTAGAGCTAGAAATAGCAAGTT </td>
</tr>
<tr>
<td align="left">P16</td>
<td align="left">Target-fucI-R</td>
<td align="left">
<underline>TGACCAGTAGGTACGCACAT</underline>ACTAGTATTATACCTAGGACTGAGC</td>
</tr>
<tr>
<td align="left">P17</td>
<td align="left">Target-yiaE-F</td>
<td align="left">
<underline>TAC&#x200b;CGC&#x200b;TCG&#x200b;TCG&#x200b;GGT&#x200b;TGT&#x200b;GG</underline>GTT&#x200b;TTA&#x200b;GAG&#x200b;CTA&#x200b;GAA&#x200b;ATA&#x200b;GCA&#x200b;AGT</td>
</tr>
<tr>
<td align="left">P18</td>
<td align="left">Target-yiaE-R</td>
<td align="left">
<underline>CCACAACCCGACGAGCGGTA</underline>ACTAGTATTATACACTAGTATTATACCTAGGACTGAGC</td>
</tr>
<tr>
<td align="left">P19</td>
<td align="left">Target-ycdW-F</td>
<td align="left">
<underline>ACGCGTGGATGTTGCCAGAG</underline>GTTTTAGAGCTAGGTTTTAGAGCTAGAAATAGCAAGT</td>
</tr>
<tr>
<td align="left">P20</td>
<td align="left">Target-ycdW-R</td>
<td align="left">
<underline>CTCTGGCAACATCCACGCGT</underline>ACTAGTATTATACCACTAGTATTATACCTAGGACTGAGC</td>
</tr>
<tr>
<td align="left">P21</td>
<td align="left">Target-yagE-F</td>
<td align="left">
<underline>CATGCTGCGCAGGTGGGCGA</underline>GTTTTAGAGCTAGTTTTAGAGCTAGAAATAGCAAGT</td>
</tr>
<tr>
<td align="left">P22</td>
<td align="left">Target-yagE-R</td>
<td align="left">
<underline>TCGCCCACCTGCGCAGCATG</underline>ACTAGTATTATACACTAGTATTATACCTAGGACTGAGC</td>
</tr>
<tr>
<td align="left">P23</td>
<td align="left">Target-yjhH-F</td>
<td align="left">
<underline>CCGCAGAATACCGAAAACGA</underline>GTTTTAGAGCTAGTTTTAGAGCTAGAAATAGCAAGT</td>
</tr>
<tr>
<td align="left">P24</td>
<td align="left">Target-yjhH-R</td>
<td align="left">
<underline>TCGTTTTCGGTATTCTGCGG</underline>ACTAGTATTATACCACTAGTATTATACCTAGGACTGAGC</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>The underlined part indicates the N20 sequence.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Plasmid pTrc99a-MdlC-AraDH was digested with <italic>Bam</italic>HI and <italic>Sac</italic>I and it was ligated with the fragment Trc-<italic>aDG</italic> which was amplified using the primer P5 and P6, by in-fusion clone, constructing the plasmid pTrc99a-MdlC-ADG. The fragment Trc-<italic>araD</italic> was removed from the plasmid pCWJ-AraD-AdhP after digestion with <italic>Spe</italic>I and <italic>Kpn</italic>I. After that, the vector part was ligated with Trc-<italic>aDT</italic> amplified with the primer P7 and P8 to generate the plasmid pCWJ-ADT-AdhP. The plasmid pTrc99a-Aro10-XylB, pTrc99a-kivD-xylB, and pTrc99a-KdcA-XylB was digested with <italic>Sac</italic>I and <italic>Bam</italic>HI, respectively, to remove the Trc-<italic>xylB</italic> sequence. Then, these linearized vector fragments were used to ligate with the Trc-<italic>aDG</italic> fragment amplified with the primer P9 and P10, respectively, to produce the plasmid pTrc99a-Aro10-ADG, pTrc99a-KivD-ADG, and pTrc99a-KdcA-ADG. Primer P11 and P12 were used to clone Trc-<italic>bdhA</italic> and this fragment was inserted into <italic>Kpn</italic>I/<italic>Sal</italic>I sites of pCWJ-AraD-AdhP yielding the plasmid pCWJ-AraD-BdhA. DNA fragment Trc-<italic>aDH2</italic> was amplified with primer P13 and P14, and the plasmid pCWJ-AraD-ADH2 was constructed in the same way. Primers P15/P16, P17/P18, P19/P20, P21/P22, and P23/P24 were used to amplify the pTarget series plasmid, respectively, yielding the plasmid: pTarget-&#x394;fucI, pTarget-&#x394;yiaE, pTarget-&#x394;ycdW, pTarget-&#x394;yagE, and pTarget-&#x394;yjhH.</p>
</sec>
<sec id="s4-3">
<title>Construction of the Mutant <italic>E.&#x20;coli</italic> Strains</title>
<p>
<italic>E.&#x20;coli</italic>/Trans1-T1 (T1) competent cells harboring Cas9 were prepared as described (<xref ref-type="bibr" rid="B24">Pujol and Kado, 2000</xref>; <xref ref-type="bibr" rid="B26">Sharan et&#x20;al., 2009</xref>). <sc>l</sc>-arabinose (10&#xa0;mM final concentration) was added to induce the production of &#x3bb;-Red and the electroporation process was conducted as described (<xref ref-type="bibr" rid="B12">Jiang et&#x20;al., 2015</xref>). Primers used for the amplification of donor DNA were shown in <xref ref-type="sec" rid="s10">Supplementary Table S1</xref>. Plasmid pTarget-&#x394;<italic>fucI</italic>, pTarget-&#x394;<italic>yiaE</italic>, and pTarget-&#x394;<italic>yagE</italic> were electroporated into T1 competent cells with corresponding donor DNA, respectively, yielding the mutant strain: T1&#x394;<italic>fucI</italic>, T1&#x394;<italic>yiaE</italic>, and T1&#x394;<italic>yagE</italic>. The elimination of pCas and pTarget series plasmids was conducted as described (<xref ref-type="bibr" rid="B8">Datsenko and Wanner, 2000</xref>). After curing pTarget and pCas series plasmids, mutant strain T1-1 and T1-3 were obtained. Then, the strain T1&#x394;<italic>yiaE</italic> was made into competent cells after the plasmid pTarget-&#x394;<italic>yiaE</italic> was cured. After that, the plasmid pTarget-&#x394;<italic>ycdW</italic> was co-transformed into the cells with donor DNA yielding the mutant strain T1&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic>. The mutant strain T1-2 was obtained after eliminating the plasmid pTarget-&#x394;<italic>ycdW</italic> and pCas. After curing the plasmid pTarget-&#x394;<italic>yagE</italic>, plasmid pTarget-&#x394;<italic>yjhH</italic> was co-transformed with donor DNA into strain T1&#x394;<italic>yagE</italic> harboring Cas9 and &#x3bb;-Red yielding the mutant strain T1&#x394;<italic>yagE</italic>&#x394;<italic>yjhH</italic>. Mutant strain T1-4 was gained after curing pTarget and pCas series plasmids. Plasmid pTarget-&#x394;<italic>yjhH</italic> was also co-electroporated with donor DNA into T1&#x394;<italic>yiaE</italic>&#x394;<italic>ycdW</italic> competent cells containing Cas9 and &#x3bb;-Red for the construction of strain T1&#x394;5 with gene <italic>yiaE</italic>, <italic>ycdW,</italic> and <italic>yagE</italic> disrupted.</p>
</sec>
<sec id="s4-4">
<title>Culture Conditions</title>
<p>
<italic>E.&#x20;coli</italic>/Trans1-T1 series strains containing the plasmid of interest were cultured in 500&#xa0;ml of LB medium added with 0.1&#xa0;mM Ampicillin and 0.1&#xa0;mM Chloramphenicol at 37&#xb0;C on a rotatory shaker (200&#xa0;rpm). When the optical density at 600&#xa0;nm of the culture medium reached 0.6, IPTG (2&#xa0;mM final concentration) and Mg<sup>2&#x2b;</sup> (10&#xa0;mM final concentration) were added. After incubating at 33&#xb0;C on a rotatory shaker (200&#xa0;rpm) for 12 h, cells were harvested by centrifugation (6000&#xa0;rpm for 15&#xa0;min) and washed two times with deionized&#x20;water.</p>
</sec>
<sec id="s4-5">
<title>Biotransformation Conditions</title>
<p>Biocatalysis of <sc>d</sc>-arabinose to BT was conducted in a 20-ml phosphate buffer solution (pH 7.0, 12&#xa0;g/L Na<sub>2</sub>HPO<sub>4</sub>, 3&#xa0;g/L KH<sub>2</sub>PO<sub>4</sub>), which contained 20&#xa0;g/L <sc>d</sc>-arabinose and recombinant <italic>E.&#x20;coli</italic> cells (OD<sub>600nm</sub>: 60). The reaction mixture was incubated at 33&#xb0;C on a rotatory shaker (200&#xa0;rpm) for 48&#xa0;h. After that, the reaction mixture was incubated at 33&#xb0;C on a rotatory shaker (200&#xa0;rpm) for 48&#xa0;h. Samples were boiled for 5&#xa0;min to stop the reaction and proteins were removed by centrifugation (12,000&#xa0;rpm, 5&#xa0;min). Finally, the supernatant was used for high-performance liquid chromatography analysis.</p>
</sec>
<sec id="s4-6">
<title>Analytic Methods</title>
<p>The concentrations of <sc>d</sc>-arabinose and BT were analyzed as described (<xref ref-type="bibr" rid="B13">Jing et&#x20;al., 2018</xref>). The detection of BT was conducted by gas chromatography-mass spectrometry (GC-MS, ISQ 7000, Thermo Fisher Scientific, Waltham, MA) equipped with a TG-5MS GC column (30&#xa0;m &#xd7; 0.25&#xa0;mm &#xd7; 0.25&#xa0;&#x3bc;m), using the method described as follows. Five milliliters reaction mixture was centrifuged (12,000&#xa0;rpm) for 5&#xa0;min and the supernatant was pretreated at &#x2212;80&#xb0;C for 1&#xa0;h. Then the sample was dried in a vacuum freeze dryer (0.12 mbar, &#x2212;40&#xb0;C) and washed by 1&#xa0;ml methanol. After centrifuging (12,000&#xa0;rpm) for 5&#xa0;min, the supernatant was used for GC-MS analysis. A total of 0.2&#xa0;&#x3bc;L sample was injected and the flow ratio was 100 using helium as the carrier gas. The inlet temperature, split flow, and purge flow was set at 300&#xb0;C, 100&#xa0;ml/min, and 5&#xa0;ml/min, respectively. The oven temperature gradient program was set as follows: initially held at 50&#xb0;C for 5&#xa0;min, raised by 10&#xb0;C/min to 200&#xb0;C (held for 0&#xa0;min), and finally increased to 300&#xb0;C at 20&#xb0;C/min (held for 5&#xa0;min). The total run time was about 30&#xa0;min. The MS conditions for identification of BT were as follows: full scan mode, 29&#x2013;350&#xa0;m/z mass-range. The ion source temperature was 280&#xb0;C and EI was ionized at 70&#xa0;eV.</p>
</sec>
</sec>
</body>
<back>
<sec id="s5">
<title>Data Availability Statement</title>
<p>The original contributions presented in the study are included in the article/<xref ref-type="sec" rid="s10">Supplementary Material</xref>, further inquiries can be directed to the corresponding author.</p>
</sec>
<sec id="s6">
<title>Author Contributions</title>
<p>XW, KC, and PO conceived and designed research. JW and QC conducted experiments. JW and XW analyzed data. JW wrote the manuscript. All authors read and approved the manuscript.</p>
</sec>
<sec id="s7">
<title>Funding</title>
<p>This work was supported by the National Key Research and Development Program of China (Grant No. 2021YFC2100800), and China Postdoctoral Science Foundation (No. 2020M681570).</p>
</sec>
<sec sec-type="COI-statement" id="s8">
<title>Conflict of Interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec sec-type="disclaimer" id="s9">
<title>Publisher&#x2019;s Note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<sec id="s10">
<title>Supplementary Material</title>
<p>The Supplementary Material for this article can be found online at: <ext-link ext-link-type="uri" xlink:href="https://www.frontiersin.org/articles/10.3389/fbioe.2022.844517/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fbioe.2022.844517/full&#x23;supplementary-material</ext-link>
</p>
<supplementary-material xlink:href="DataSheet1.docx" id="SM1" mimetype="application/docx" xmlns:xlink="http://www.w3.org/1999/xlink"/>
</sec>
<sec id="s11">
<title>Abbreviations</title>
<p>ARA, <sc>d</sc>-arabinose dehydrogenase; AD, <sc>d</sc>-arabinonate dehydratase; ADX, 2-keto acid decarboxylase; ALR, aldehyde reductase; BT, D-1,2,4-butanetriol.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Abdel-Ghany</surname>
<given-names>S. E.</given-names>
</name>
<name>
<surname>Day</surname>
<given-names>I.</given-names>
</name>
<name>
<surname>Heuberger</surname>
<given-names>A. L.</given-names>
</name>
<name>
<surname>Broeckling</surname>
<given-names>C. D.</given-names>
</name>
<name>
<surname>Reddy</surname>
<given-names>A. S. N.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Metabolic Engineering of <italic>Arabidopsis</italic> for Butanetriol Production Using Bacterial Genes</article-title>. <source>Metab. Eng.</source> <volume>20</volume>, <fpage>109</fpage>&#x2013;<lpage>120</lpage>. <pub-id pub-id-type="doi">10.1016/j.ymben.2013.10.003</pub-id> </citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Andberg</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Aro-K&#xe4;rkk&#xe4;inen</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Carlson</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Oja</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Bozonnet</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Toivari</surname>
<given-names>M.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Characterization and Mutagenesis of Two Novel Iron-sulphur Cluster Pentonate Dehydratases</article-title>. <source>Appl. Microbiol. Biotechnol.</source> <volume>100</volume> (<issue>17</issue>), <fpage>7549</fpage>&#x2013;<lpage>7563</lpage>. <pub-id pub-id-type="doi">10.1007/s00253-016-7530-8</pub-id> </citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Atsumi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Hanai</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Liao</surname>
<given-names>J.&#x20;C.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Non-fermentative Pathways for Synthesis of Branched-Chain Higher Alcohols as Biofuels</article-title>. <source>Nature</source> <volume>451</volume> (<issue>7174</issue>), <fpage>86</fpage>&#x2013;<lpage>89</lpage>. <pub-id pub-id-type="doi">10.1038/nature06450</pub-id> </citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bamba</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yukawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Guirimand</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Inokuma</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Sasaki</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Hasunuma</surname>
<given-names>T.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>Production of 1,2,4-butanetriol from Xylose by <italic>Saccharomyces cerevisiae</italic> through Fe Metabolic Engineering</article-title>. <source>Metab. Eng.</source> <volume>56</volume>, <fpage>17</fpage>&#x2013;<lpage>27</lpage>. <pub-id pub-id-type="doi">10.1016/j.ymben.2019.08.012</pub-id> </citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ba&#xf1;ares</surname>
<given-names>A. B.</given-names>
</name>
<name>
<surname>Valdehuesa</surname>
<given-names>K. N. G.</given-names>
</name>
<name>
<surname>Ramos</surname>
<given-names>K. R. M.</given-names>
</name>
<name>
<surname>Nisola</surname>
<given-names>G. M.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>W. K.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>W. J.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Discovering a Novel D-Xylonate-Responsive Promoter: the PyjhI-Driven Genetic Switch towards Better 1,2,4-butanetriol Production</article-title>. <source>Appl. Microbiol. Biotechnol.</source> <volume>103</volume> (<issue>19</issue>), <fpage>8063</fpage>&#x2013;<lpage>8074</lpage>. <pub-id pub-id-type="doi">10.1007/s00253-019-10073-0</pub-id> </citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Biswas</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yamaoka</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Nakayama</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Kondo</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Yoshida</surname>
<given-names>K.-i.</given-names>
</name>
<name>
<surname>Bisaria</surname>
<given-names>V. S.</given-names>
</name>
<etal/>
</person-group> (<year>2012</year>). <article-title>Enhanced Production of 2,3-butanediol by Engineered Bacillus Subtilis</article-title>. <source>Appl. Microbiol. Biotechnol.</source> <volume>94</volume> (<issue>3</issue>), <fpage>651</fpage>&#x2013;<lpage>658</lpage>. <pub-id pub-id-type="doi">10.1007/s00253-011-3774-5</pub-id> </citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brouns</surname>
<given-names>S. J.&#x20;J.</given-names>
</name>
<name>
<surname>Walther</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Snijders</surname>
<given-names>A. P. L.</given-names>
</name>
<name>
<surname>van de Werken</surname>
<given-names>H. J.&#x20;G.</given-names>
</name>
<name>
<surname>Willemen</surname>
<given-names>H. L. D. M.</given-names>
</name>
<name>
<surname>Worm</surname>
<given-names>P.</given-names>
</name>
<etal/>
</person-group> (<year>2006</year>). <article-title>Identification of the Missing Links in Prokaryotic Pentose Oxidation Pathways</article-title>. <source>J.&#x20;Biol. Chem.</source> <volume>281</volume> (<issue>37</issue>), <fpage>27378</fpage>&#x2013;<lpage>27388</lpage>. <pub-id pub-id-type="doi">10.1074/jbc.m605549200</pub-id> </citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Datsenko</surname>
<given-names>K. A.</given-names>
</name>
<name>
<surname>Wanner</surname>
<given-names>B. L.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>One-step Inactivation of Chromosomal Genes in <italic>Escherichia coli</italic> K-12 Using PCR Products</article-title>. <source>Proc. Natl. Acad. Sci.</source> <volume>97</volume> (<issue>12</issue>), <fpage>6640</fpage>&#x2013;<lpage>6645</lpage>. <pub-id pub-id-type="doi">10.1073/pnas.120163297</pub-id> </citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Falcioni</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Blank</surname>
<given-names>L. M.</given-names>
</name>
<name>
<surname>Frick</surname>
<given-names>O.</given-names>
</name>
<name>
<surname>Karau</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>B&#xfc;hler</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Schmid</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Proline Availability Regulates Proline-4-Hydroxylase Synthesis and Substrate Uptake in Proline-Hydroxylating Recombinant <italic>Escherichia coli</italic>
</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>79</volume> (<issue>9</issue>), <fpage>3091</fpage>&#x2013;<lpage>3100</lpage>. <pub-id pub-id-type="doi">10.1128/aem.03640-12</pub-id> </citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Jiang</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Ma</surname>
<given-names>C.</given-names>
</name>
<etal/>
</person-group> (<year>2019</year>). <article-title>High-yield Production of D-1,2,4-Butanetriol from Lignocellulose-Derived Xylose by Using a Synthetic Enzyme cascade in a Cell-free System</article-title>. <source>J.&#x20;Biotechnol.</source> <volume>292</volume>, <fpage>76</fpage>&#x2013;<lpage>83</lpage>. <pub-id pub-id-type="doi">10.1016/j.jbiotec.2019.01.004</pub-id> </citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gouranlou</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Kohsary</surname>
<given-names>I.</given-names>
</name>
</person-group> (<year>2010</year>). <article-title>Synthesis and Characterization of 1, 2, 4-butanetrioltrinitrate</article-title>. <source>Asian J.&#x20;Chem.</source> <volume>22</volume> (<issue>6</issue>), <fpage>4221</fpage>. <comment>
<ext-link ext-link-type="uri" xlink:href="https://asianjournalofchemistry.co.in/User/ViewFreeArticle.aspx&#x003F;ArticleID=22_6_5&#x0026;fileType=HTML">https://asianjournalofchemistry.co.in/User/ViewFreeArticle.aspx&#x003F;ArticleID&#x003D;22_6_5&#x0026;fileType&#x003D;HTML</ext-link>
</comment> </citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jiang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Duan</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>B.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>S.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Multigene Editing in the <italic>Escherichia coli</italic> Genome via the CRISPR-Cas9 System</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>81</volume> (<issue>7</issue>), <fpage>2506</fpage>&#x2013;<lpage>2514</lpage>. <pub-id pub-id-type="doi">10.1128/aem.04023-14</pub-id> </citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jing</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Cao</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhuge</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Modification of an Engineered <italic>Escherichia coli</italic> by a Combined Strategy of Deleting branch Pathway, fine-tuning Xylose Isomerase Expression, and Substituting Decarboxylase to Improve 1,2,4-butanetriol Production</article-title>. <source>J.&#x20;Biosci. Bioeng.</source> <volume>126</volume> (<issue>5</issue>), <fpage>547</fpage>&#x2013;<lpage>552</lpage>. <pub-id pub-id-type="doi">10.1016/j.jbiosc.2018.05.019</pub-id> </citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kaur</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Kumar</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kaur</surname>
<given-names>J.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Strategies for Optimization of Heterologous Protein Expression in <italic>E.&#x20;coli</italic>: Roadblocks and Reinforcements</article-title>. <source>Int. J.&#x20;Biol. Macromolecules</source> <volume>106</volume>, <fpage>803</fpage>&#x2013;<lpage>822</lpage>. <pub-id pub-id-type="doi">10.1016/j.ijbiomac.2017.08.080</pub-id> </citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>LeBlanc</surname>
<given-names>D. J.</given-names>
</name>
<name>
<surname>Mortlock</surname>
<given-names>R. P.</given-names>
</name>
</person-group> (<year>1971</year>). <article-title>Metabolism of D -Arabinose: a New Pathway in <italic>Escherichia coli</italic>
</article-title>. <source>J.&#x20;Bacteriol.</source> <volume>106</volume> (<issue>1</issue>), <fpage>90</fpage>&#x2013;<lpage>96</lpage>. <pub-id pub-id-type="doi">10.1128/jb.106.1.90-96.1971</pub-id> </citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Cai</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2014</year>). <article-title>Design and Construction of a Non-natural Malate to 1,2,4-Butanetriol Pathway Creates Possibility to Produce 1,2,4-Butanetriol from Glucose</article-title>. <source>Sci. Rep.</source> <volume>4</volume>, <fpage>5541</fpage>. <pub-id pub-id-type="doi">10.1038/srep05541</pub-id> </citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Valdehuesa</surname>
<given-names>K. N. G.</given-names>
</name>
<name>
<surname>Nisola</surname>
<given-names>G. M.</given-names>
</name>
<name>
<surname>Ramos</surname>
<given-names>K. R. M.</given-names>
</name>
<name>
<surname>Chung</surname>
<given-names>W.-J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>High Yield Production of D-Xylonic Acid from D-Xylose Using Engineered <italic>Escherichia coli</italic>
</article-title>. <source>Bioresour. Tech.</source> <volume>115</volume>, <fpage>244</fpage>&#x2013;<lpage>248</lpage>. <pub-id pub-id-type="doi">10.1016/j.biortech.2011.08.065</pub-id> </citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>He</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Zong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Song</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Zhuge</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Improved 1, 2, 4-butanetriol Production from an Engineered <italic>Escherichia coli</italic> by Co-expression of Different Chaperone Proteins</article-title>. <source>World J.&#x20;Microbiol. Biotechnol.</source> <volume>32</volume> (<issue>9</issue>), <fpage>149</fpage>. <pub-id pub-id-type="doi">10.1007/s11274-016-2085-5</pub-id> </citation>
</ref>
<ref id="B19">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Maletzky</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Bauer</surname>
<given-names>R.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>The Photo-Fenton Method - Degradation of Nitrogen Containing Organic Compounds</article-title>. <source>Chemosphere</source> <volume>37</volume> (<issue>5</issue>), <fpage>899</fpage>&#x2013;<lpage>909</lpage>. <pub-id pub-id-type="doi">10.1016/s0045-6535(98)00093-9</pub-id> </citation>
</ref>
<ref id="B20">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Mandava</surname>
<given-names>V. N. B. R.</given-names>
</name>
<name>
<surname>Cherukupally</surname>
<given-names>P.</given-names>
</name>
<name>
<surname>Varanasi</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Areveli</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Vempati</surname>
<given-names>C. S.</given-names>
</name>
<name>
<surname>Narayana</surname>
<given-names>R. R.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <source>Preparation of Fosamprenavir Calcium</source>. <comment>Google Patents</comment>. </citation>
</ref>
<ref id="B21">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Meng</surname>
<given-names>D.-C.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>L.-P.</given-names>
</name>
<name>
<surname>Shen</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Chen</surname>
<given-names>J.-C.</given-names>
</name>
<name>
<surname>Wu</surname>
<given-names>Q.</given-names>
</name>
<etal/>
</person-group> (<year>2015</year>). <article-title>Production of Poly(3-Hydroxypropionate) and Poly(3-Hydroxybutyrate-Co-3-Hydroxypropionate) from Glucose by Engineering <italic>Escherichia coli</italic>
</article-title>. <source>Metab. Eng.</source> <volume>29</volume>, <fpage>189</fpage>&#x2013;<lpage>195</lpage>. <pub-id pub-id-type="doi">10.1016/j.ymben.2015.03.015</pub-id> </citation>
</ref>
<ref id="B22">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Monteith</surname>
<given-names>M. J.</given-names>
</name>
<name>
<surname>Schofield</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Bailey</surname>
<given-names>M.</given-names>
</name>
</person-group> (<year>1998</year>). <article-title>Process for the Preparation of Butane Triols</article-title>. <source>Bull. Mater. Sci.</source> <volume>15</volume> (<issue>15</issue>), <fpage>449</fpage>&#x2013;<lpage>452</lpage>. </citation>
</ref>
<ref id="B23">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Niu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Molefe</surname>
<given-names>M. N.</given-names>
</name>
<name>
<surname>Frost</surname>
<given-names>J.&#x20;W.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Microbial Synthesis of the Energetic Material Precursor 1,2,4-Butanetriol</article-title>. <source>J.&#x20;Am. Chem. Soc.</source> <volume>125</volume> (<issue>43</issue>), <fpage>12998</fpage>&#x2013;<lpage>12999</lpage>. <pub-id pub-id-type="doi">10.1021/ja036391&#x2b;</pub-id> </citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Pujol</surname>
<given-names>C. J.</given-names>
</name>
<name>
<surname>Kado</surname>
<given-names>C. I.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>Genetic and Biochemical Characterization of the Pathway in <italic>Pantoea Citrea</italic> Leading to Pink Disease of Pineapple</article-title>. <source>J.&#x20;Bacteriol.</source> <volume>182</volume> (<issue>8</issue>), <fpage>2230</fpage>&#x2013;<lpage>2237</lpage>. <pub-id pub-id-type="doi">10.1128/jb.182.8.2230-2237.2000</pub-id> </citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>San</surname>
<given-names>K.-Y.</given-names>
</name>
<name>
<surname>Bennett</surname>
<given-names>G. N.</given-names>
</name>
<name>
<surname>Berr&#x00ED;os-Rivera</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Vadali</surname>
<given-names>R. V.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>Y.-T.</given-names>
</name>
<name>
<surname>Horton</surname>
<given-names>E.</given-names>
</name>
<etal/>
</person-group> (<year>2002</year>). <article-title>Metabolic Engineering through Cofactor Manipulation and its Effects on Metabolic Flux Redistribution in <italic>Escherichia coli</italic>
</article-title>. <source>Metab. Eng.</source> <volume>4</volume> (<issue>2</issue>), <fpage>182</fpage>&#x2013;<lpage>192</lpage>. <pub-id pub-id-type="doi">10.1006/mben.2001.0220</pub-id> </citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sharan</surname>
<given-names>S. K.</given-names>
</name>
<name>
<surname>Thomason</surname>
<given-names>L. C.</given-names>
</name>
<name>
<surname>Kuznetsov</surname>
<given-names>S. G.</given-names>
</name>
<name>
<surname>Court</surname>
<given-names>D. L.</given-names>
</name>
</person-group> (<year>2009</year>). <article-title>Recombineering: a Homologous Recombination-Based Method of Genetic Engineering</article-title>. <source>Nat. Protoc.</source> <volume>4</volume> (<issue>2</issue>), <fpage>206</fpage>&#x2013;<lpage>223</lpage>. <pub-id pub-id-type="doi">10.1038/nprot.2008.227</pub-id> </citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Song</surname>
<given-names>C. W.</given-names>
</name>
<name>
<surname>Kim</surname>
<given-names>D. I.</given-names>
</name>
<name>
<surname>Choi</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Jang</surname>
<given-names>J.&#x20;W.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>S. Y.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Metabolic Engineering ofEscherichia Colifor the Production of Fumaric Acid</article-title>. <source>Biotechnol. Bioeng.</source> <volume>110</volume> (<issue>7</issue>), <fpage>2025</fpage>&#x2013;<lpage>2034</lpage>. <pub-id pub-id-type="doi">10.1002/bit.24868</pub-id> </citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sun</surname>
<given-names>L.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>F.</given-names>
</name>
<name>
<surname>Sun</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhu</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Li</surname>
<given-names>Y.</given-names>
</name>
<etal/>
</person-group> (<year>2016</year>). <article-title>Synthetic Pathway Optimization for Improved 1,2,4-butanetriol Production</article-title>. <source>J.&#x20;Ind. Microbiol. Biotechnol.</source> <volume>43</volume> (<issue>1</issue>), <fpage>67</fpage>&#x2013;<lpage>78</lpage>. <pub-id pub-id-type="doi">10.1007/s10295-015-1693-7</pub-id> </citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tsou</surname>
<given-names>A. Y.</given-names>
</name>
<name>
<surname>Ransom</surname>
<given-names>S. C.</given-names>
</name>
<name>
<surname>Gerlt</surname>
<given-names>J.&#x20;A.</given-names>
</name>
<name>
<surname>Buechter</surname>
<given-names>D. D.</given-names>
</name>
<name>
<surname>Babbitt</surname>
<given-names>P. C.</given-names>
</name>
<name>
<surname>Kenyon</surname>
<given-names>G. L.</given-names>
</name>
</person-group> (<year>1990</year>). <article-title>Mandelate Pathway of Pseudomonas Putida: Sequence Relationships Involving Mandelate Racemase, (S)-mandelate Dehydrogenase, and Benzoylformate Decarboxylase and Expression of Benzoylformate Decarboxylase in <italic>Escherichia coli</italic>
</article-title>. <source>Biochemistry</source> <volume>29</volume> (<issue>42</issue>), <fpage>9856</fpage>&#x2013;<lpage>9862</lpage>. <pub-id pub-id-type="doi">10.1021/bi00494a015</pub-id> </citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Valdehuesa</surname>
<given-names>K. N. G.</given-names>
</name>
<name>
<surname>Liu</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Ramos</surname>
<given-names>K. R. M.</given-names>
</name>
<name>
<surname>Park</surname>
<given-names>S. J.</given-names>
</name>
<name>
<surname>Nisola</surname>
<given-names>G. M.</given-names>
</name>
<name>
<surname>Lee</surname>
<given-names>W.-K.</given-names>
</name>
<etal/>
</person-group> (<year>2014</year>). <article-title>Direct Bioconversion of D-Xylose to 1,2,4-butanetriol in an Engineered <italic>Escherichia coli</italic>
</article-title>. <source>Process Biochem.</source> <volume>49</volume> (<issue>1</issue>), <fpage>25</fpage>&#x2013;<lpage>32</lpage>. <pub-id pub-id-type="doi">10.1016/j.procbio.2013.10.002</pub-id> </citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Vuralhan</surname>
<given-names>Z.</given-names>
</name>
<name>
<surname>Luttik</surname>
<given-names>M. A. H.</given-names>
</name>
<name>
<surname>Tai</surname>
<given-names>S. L.</given-names>
</name>
<name>
<surname>Boer</surname>
<given-names>V. M.</given-names>
</name>
<name>
<surname>Morais</surname>
<given-names>M. A.</given-names>
</name>
<name>
<surname>Schipper</surname>
<given-names>D.</given-names>
</name>
<etal/>
</person-group> (<year>2005</year>). <article-title>Physiological Characterization of the ARO10 -Dependent, Broad-Substrate-Specificity 2-Oxo Acid Decarboxylase Activity of <italic>Saccharomyces cerevisiae</italic>
</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>71</volume> (<issue>6</issue>), <fpage>3276</fpage>&#x2013;<lpage>3284</lpage>. <pub-id pub-id-type="doi">10.1128/aem.71.6.3276-3284.2005</pub-id> </citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Lemley</surname>
<given-names>A. T.</given-names>
</name>
</person-group> (<year>2002</year>). <article-title>Oxidation of Diazinon by Anodic Fenton Treatment</article-title>. <source>Water Res.</source> <volume>36</volume> (<issue>13</issue>), <fpage>3237</fpage>&#x2013;<lpage>3244</lpage>. <pub-id pub-id-type="doi">10.1016/s0043-1354(02)00041-6</pub-id> </citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Hu</surname>
<given-names>S.</given-names>
</name>
<name>
<surname>Yang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>Q.</given-names>
</name>
<name>
<surname>Xu</surname>
<given-names>S.</given-names>
</name>
<etal/>
</person-group> (<year>2018</year>). <article-title>d-1,2,4-Butanetriol Production from Renewable Biomass with Optimization of Synthetic Pathway in Engineered <italic>Escherichia coli</italic>
</article-title>. <source>Bioresour. Technol.</source> <volume>250</volume>, <fpage>406</fpage>&#x2013;<lpage>412</lpage>. <pub-id pub-id-type="doi">10.1016/j.biortech.2017.11.062</pub-id> </citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yamada-Onodera</surname>
<given-names>K.</given-names>
</name>
<name>
<surname>Norimoto</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Kawada</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Furuya</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Yamamoto</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Tani</surname>
<given-names>Y.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>Production of Optically Active 1,2,4-butanetriol from Corresponding Racemate by Microbial Stereoinversion</article-title>. <source>J.&#x20;Biosci. Bioeng.</source> <volume>103</volume> (<issue>5</issue>), <fpage>494</fpage>&#x2013;<lpage>496</lpage>. <pub-id pub-id-type="doi">10.1263/jbb.103.494</pub-id> </citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yim</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Haselbeck</surname>
<given-names>R.</given-names>
</name>
<name>
<surname>Niu</surname>
<given-names>W.</given-names>
</name>
<name>
<surname>Pujol-Baxley</surname>
<given-names>C.</given-names>
</name>
<name>
<surname>Burgard</surname>
<given-names>A.</given-names>
</name>
<name>
<surname>Boldt</surname>
<given-names>J.</given-names>
</name>
<etal/>
</person-group> (<year>2011</year>). <article-title>Metabolic Engineering of <italic>Escherichia coli</italic> for Direct Production of 1,4-butanediol</article-title>. <source>Nat. Chem. Biol.</source> <volume>7</volume> (<issue>7</issue>), <fpage>445</fpage>&#x2013;<lpage>452</lpage>. <pub-id pub-id-type="doi">10.1038/nchembio.580</pub-id> </citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yukawa</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Bamba</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Guirimand</surname>
<given-names>G.</given-names>
</name>
<name>
<surname>Matsuda</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Hasunuma</surname>
<given-names>T.</given-names>
</name>
<name>
<surname>Kondo</surname>
<given-names>A.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Optimization of 1, 2, 4&#x2010;butanetriol Production from Xylose in <italic>Saccharomyces cerevisiae</italic> by Metabolic Engineering of NADH/NADPH Balance</article-title>. <source>Biotech. Bioeng.</source> <volume>118</volume> (<issue>1</issue>), <fpage>175</fpage>&#x2013;<lpage>185</lpage>. </citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>N.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Zhang</surname>
<given-names>Y.</given-names>
</name>
<name>
<surname>Gao</surname>
<given-names>H.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Metabolic Pathway Optimization for Biosynthesis of 1,2,4-butanetriol from Xylose by Engineered <italic>Escherichia coli</italic>
</article-title>. <source>Enzyme Microb. Technol.</source> <volume>93-94</volume>, <fpage>51</fpage>&#x2013;<lpage>58</lpage>. <pub-id pub-id-type="doi">10.1016/j.enzmictec.2016.07.007</pub-id> </citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Shanmugam</surname>
<given-names>K. T.</given-names>
</name>
<name>
<surname>Ingram</surname>
<given-names>L. O.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>l -Malate Production by Metabolically Engineered <italic>Escherichia coli</italic>
</article-title>. <source>Appl. Environ. Microbiol.</source> <volume>77</volume> (<issue>2</issue>), <fpage>427</fpage>&#x2013;<lpage>434</lpage>. <pub-id pub-id-type="doi">10.1128/aem.01971-10</pub-id> </citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhao</surname>
<given-names>M.</given-names>
</name>
<name>
<surname>Shi</surname>
<given-names>D.</given-names>
</name>
<name>
<surname>Lu</surname>
<given-names>X.</given-names>
</name>
<name>
<surname>Zong</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Zhuge</surname>
<given-names>B.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Co-production of 1,2,4-butantriol and Ethanol from Lignocellulose Hydrolysates</article-title>. <source>Bioresour. Technol.</source> <volume>282</volume>, <fpage>433</fpage>&#x2013;<lpage>438</lpage>. <pub-id pub-id-type="doi">10.1016/j.biortech.2019.03.057</pub-id> </citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Znad</surname>
<given-names>H.</given-names>
</name>
<name>
<surname>Marko&#x161;</surname>
<given-names>J.</given-names>
</name>
<name>
<surname>Bale&#x161;</surname>
<given-names>V.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Production of Gluconic Acid from Glucose by <italic>Aspergillus niger</italic>: Growth and Non-growth Conditions</article-title>. <source>Process Biochem.</source> <volume>39</volume> (<issue>11</issue>), <fpage>1341</fpage>&#x2013;<lpage>1345</lpage>. <pub-id pub-id-type="doi">10.1016/s0032-9592(03)00270-x</pub-id> </citation>
</ref>
</ref-list>
</back>
</article>