The following chemicals were purchased from Beijing Bailingwei Technology Co. Ltd, China; yttrium (III) chloride hexahydrate (YCl₃⋅6H₂O, 99.99%), ytterbium (III) chloride hexahydrate (YbCl₃⋅6H₂O, 99.9%), erbium (III) chloride hexahydrate (ErCl₃⋅6H₂O, 99.9%), oleic acid (OA > 85%), 1-octadecene (1-ODE, 90%), N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC, 99%), N-hydroxysuccinimide (NHS, 98%), zirconium dichloride oxide octahydrate (ZrOCl₂⋅8H₂O, 98%), poly (acrylic acid) [PAA, Molecular weight (MW) = 5,000], bisphenol A (BPA, 96%), 4-cumylphenol (4-CP, 99%), bisphenol B (BPB, 99%), 4-octylphenol (4-OP, 99%) and bisphenol A glycidyl ether (BADGE, 98%).

The following chemicals were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China); sodium hydroxide (NaOH), ammonium fluoride (NH₄F), methanol, benzoic acid (BA), cyclohexane, N, N-dimethylformamide (DMF), and Sodium chloride (NaCl).

The following chemical were purchased from Beijing Huawei Ruike Chemical Co., Ltd., China; Meso-tetra (4-carboxyphenyl) porphine. The following chemical were purchased from Chengdu Cologne Chemical Co. Ltd, China; Trichloromethane.

DNA oligonucleotides were purchased from Sangon Biotech (Shanghai, China) Co. Ltd., at a concentration of 100 nM. The oligonucleotide sequences were:

DNA1 (aptamer of BPA):

5′-NH₂-TTTTTTTTTTCCGGTGGGTGGTCAGGTGGGA TAGCGTTCCGCGTATGGCCCAGCGCATCACGGGTTCGC ACCA-3′.

DNA2 (complementary DNA sequences):

5′-NH₂-TTTTTTTTTTCCCACCTGACCACCCACCGG-3′.

Fluorescence experiments were carried out by F96PRO Fluorespectrophotometer (Shanghai Lingguang Technology Co., Ltd.) with a gain of 8, spectra were recorded at the range of 500–700 nm under 980 nm excitation. UV-vis absorption spectrum were identified with UV-1800 UV-visible spectrophotometer (Shimadzu, Japan) and the sample was placed in 1 cm path length quartz cuvettes. The size of the formed nanomaterial by a dynamic laser light scattering instrument (DLS) using a Malvern Zetasizer nano ZS90 (Malvern Instruments), the samples were dispersed in water and measured for three times under the room temperature. Transmission electron micrographs were taken on a JEOLJEM-2100 transmission electron microscope. Fourier-transform infrared spectroscopy (FTIR) spectra analyses was conducted on a Spectrum GX (Perkin-Elmer, United States).

Mono-dispersed UCNPs were prepared by an established solvothermal method, according to previous studies, but with slight modifications (Tian et al., 2018; Jin et al., 2019). An OA (6 mL), 1-ODE (15 mL) and 1 mmoL rare earth Chloride complexes (comprising 78% Y³⁺, 20% Yb³⁺, and 2% Er³⁺) were added to a 100 mL three-necked flask. The mixture was heated to 160°C under nitrogen, until a clear solution was formed. A 30 mL methanol solution containing NaOH (3.25 mmoL) and NH₄F (3.5 mmoL) was then added drop-wise to this solution, and stirred for an additional 30 min after the reaction cooled to 80°C. To remove the methanol, the solution was stirred at 100°C for 30 min. After this, the solution was heated to 300°C and maintained at a constant temperature, under nitrogen. The solution was then cooled to 25°C after 1 h stirring. An ethanol and cyclohexane mixture in a 1:1 ratio was then added to the solution and centrifuged at 4,500 rpm for 10 min at 25°C. The UCNPs, coated by OA, were washed twice in ethanol, and 2–3 times in water. Then, the UCNPs coated with OA were dispersed in chloroform. After this, a 10 mL chloroform solution containing UCNPs (50 mg) was added to a 50 mL flask. A 20 mL ethanol solution containing PAA (300 mg) was then slowly added to the flask. After this, the solution was stirred for 24 h at 25°C. UCNPs coated in PAA were then obtained by centrifugation, and dispersed in water.

The MOF, PCN-224 was prepared according to a previous method, but with slight modifications (Gong et al., 2019). Approximately 0.1 g H₂TCPP, 0.3 g ZrOCl₂⋅8H₂O, 2.2 g BA and 60 mL DMF were fully dissolved in a 150 mL Erlenmeyer flask. The solution was heated to 90°C, and stirred for 5 h. After cooling to room temperature, PCN-224 was collected by centrifugation, and washed three times in DMF. The “as-prepared PCN-224” was then dispersed in water.

According to a previous study (Raj et al., 2015), 2.53 mg UCNPs were dispersed in 0.79 mL ultra-pure water, and reacted with 100 μL EDC (15 mg/mL). After 15 min stirring, 100 μL NHS (20 mg/mL) was added, and allowed react for 2 h, with continuous stirring. The solution was centrifuged and the UCNPs were dispersed into 0.99 mL ultra-pure water. After this, 10 μL DNA1 (100 nM) was added into the UCNP solution and reacted for 8 h, with continuous stirring. The DNA1-UCNPs were collected by centrifugation, and dispersed in ultra-pure water (1 mL).

DNA2-modificated MOFs were prepared according to a previous study, but with slight modifications (Raj et al., 2015). Briefly, 0.63 mg PCN-224 was dispersed in 0.79 mL ultra-pure water. To this, 100 μL EDC (15 mg/mL) was added, and the solution allowed react for 15 min, with slow stirring. After this, 100 μL NHS (20 mg/mL) was added, and the solution allowed react for 2 h, with continuous stirring. Afterward, the solution was centrifuged and the PCN-224 dispersed into 0.99 mL ultra-pure water. To this, 10 μL DNA2 (100 nM) was added and reacted for 8 h, with continuous stirring. The “as prepared DNA2-PCN-224” was collected by centrifugation and dispersed in ultra-pure water. To avoid electrostatic interactions between UCNPs and MOFs, the “as-prepared DNA2-PCN-224” was modified with Bovine serum albumen (BSA). Briefly, a water solution (10 mL) containing DNA2-PCN-224 (5 mg) was added to 10 mL water containing BSA (10 mg/mL). After 30 min stirring, DNA2-PCN-224@BSA was obtained by centrifugation. DNA2-MOFs were washed three times and dispersed in ultra-pure water. DNA2-PCN-224@BSA was then replaced by DNA2-PCN-224.

For BPA detection, 500 μL 2 nM DNA1-UCNPs were added to a tube, and reacted with 10 μL BPA, in a series of concentrations ranging from 0–1,000 nM. After a 60 min reaction at room temperature, 490 μL of 32 nM DNA2-PCN-224 was added to the solution. This solution was then placed in a micro cuvette after a 60 min incubation. To investigate the effects of BPA on signal recovery, a F96PRO fluoro-spectrophotometer was used to analyze sensor signal intensity at 543 nm. All experiments were repeated three times.

The size distribution, shape and assembly structures of DNA1-UCNPs, DNA2-MOFs, and MOFs-UCNPs were characterized by dynamic light scattering (DLS), and transmission electron microscopy (TEM). To perform assays, DNA1-UCNPs and DNA2-MOFs were formed between nanoparticles and DNA, by the addition of EDC and NHS. As shown (Figures 2A,B), TEM revealed that DNA1-UCNPs and DNA2-MOFs possessed excellent dispersal capacities. Also, the “as prepared DNA1-UCNPs and DNA2-MOFs” had average hydro-diameters of approximately 235 and 76 nm, respectively (Figures 2D,E). The average hydro-diameter of DNA1-UCNPs and DNA2-MOFs were larger than the actual diameters of that, which were similar to previous reports (Dibaba et al., 2018; Zhang et al., 2019). As shown (Figure 2C), MOFs-UCNP assembly was successfully established by the addition of DNA1-UCNPs and DNA2-MOFs. As shown (Figure 2F), following the addition of DNA2-MOFs, the sensor hydro-diameter increased to 416 nm, indicating full MOFs-UCNP assembly.

To demonstrate the feasibility of PCN-224 as an acceptor of the sensor, fluorescence and absorption spectra were gathered. Figure 2G shows the absorption spectrum of MOFs, and the emission spectra of UCNPs. We observed that the broad absorption band (500–700 nm) of MOFs largely overlapped with the emission spectra (543 nm) of UCNPs. This indicated that FRET had occurred between UCNPs and MOFs. It was important to observe the fluorescence intensity of MOFs-UCNP nanostructures before and after assembly, as they had changed considerably (Figure 2H). As the MOFs-UCNP assembly formation progressed and caused fluorescence to disappear, this was attributed to FRET between adjacent plasmonic MOFs and UCNPs.

We used stability assays to assess high-salt food adaptability of the nanosensor. MOFs and UCNP stability was evaluated in NaCl solutions at different concentrations, and compared with AuNPs. Figure 3A shows a graph of MOFs, AuNPs, and UCNP hydrodynamic diameters vs. NaCl solutions at different concentrations (10–500 mM); MOFs displayed a greater stability, with no noticeable size increases after 60 min incubation. This was due to large free –OH groups of the Zr6 cluster. Also, UCNPs possessed considerable colloidal stability, with no obvious changes in size.

Similarly, we also tested traditional acceptors, AuNPs, for stability in high-salt solutions. We observed that AuNP sizes increased considerably in line with increasing NaCl concentrations, specifically in the 50–200 mM range. These data indicated that MOFs and UCNPs possessed considerable colloidal stability at high salt concentrations, ranging from 0–500 mM, and had improved salt-resistance when compared to AuNPs.

To achieve an optimal detection performance, a series of experimental conditions were optimized. First, the influence of MOF concentrations on quenching efficiencies were investigated. This showed that quenching efficiencies increased with increasing MOF concentrations (Figure 3B). When the DNA2-MOFs concentration reached 4 nM, the quenching efficiency increased slowly, and then achieved equilibrium. Subsequently, the quenching efficiency was at 78% when the MOFs-DNA2 concentration reached 16 nM. These data suggested that a lower MOFs-DNA2 concentration could not completely quench the fluorescent intensity of UCNPs, thus inducing unnoticeable fluorescence restoration changes, therefore we selected 16 nM as the optimal MOFs-DNA2 concentration for subsequent assays. We also investigated the influence of nanosensor incubation times on the quenching efficiency (Figure 3C). The quenching efficiency increased with increasing incubation times, and reached a plateau at 50 min. Therefore, this incubation time was adopted for subsequent experiments.

To demonstrate the feasibility of the MOFs-UCNP assembly for BPA detection, we tested assembly responses to different BPA concentrations, in a high-salt solution (500 mM NaCl). As shown (Figures 3D,E) at 543 nm, the fluorescence intensity of the nanoprobe gradually increased with BPA concentration, increasing from 0 to 1,000 nM. A good linear relationship was observed between fluorescence intensity and BPA concentrations, over the 0.1–100 nM range. This method also showed a good correlation coefficient, R² = 0.9869 within the linear detection range 0.1–100 nM, and an LOD of 0.02 nM. These data were in agreement with other methods, such asfluorescence assays (Lee et al., 2017), electrochemistry (Alam and Deen, 2020), enzyme linked immunosorbent assay (ELISA) (Kuang et al., 2014) and high performance liquid chromatography (HPLC) (Ousji et al., 2020).

To study nanosensor feasibility and applicability, it was used to measure BPA levels in a real sample of high ionic strength. Gatorade is an energy drink containing 340 mM NaCl, and was selected as a model beverage for testing. As shown (Table 1), the limit of detection (LOD) of the nanosensor (0.02 nM) was lower than that of the National Food Safety Standard of China at 0.6 mg/kg (2.63 μM) (Gallo et al., 2017). The average recovery of the MOFs-UCNP sensor and the traditional fluorescence sensor, AuNPs-UCNP was 107 and 0%, respectively. These data suggested our novel fluorescence sensor demonstrated an increased high-salt stable when compared to traditional fluorescence sensors, and could be employed as a quantitative tool for BPA detection in high-salt food samples.

MOFs-UCNP assembly specificity was also investigated by comparing fluorescence signal responses for BPA (0.1 nM) with BPA analogs, including 4-OP, 4-CP, BADGE, and BPB at 1 nM. As shown (Figure 3F), the fluorescence intensity recovery of the nanosensor in the presence of BPA analogs was <30%, which was considerably lower that BPA (85–95%). These data indicated the nanosensor exhibited greater specificity and selectivity for BPA alone.