NCI-H441 human distal lung epithelial cells (ATCC HTB-174) were purchased from LGC Standards (Teddington, United Kingdom). Human alveolar type 2 epithelial (AT2) cells were isolated from non-tumor lung tissue obtained from patients undergoing lung surgery according to a previously published protocol (Daum et al., 2012). The freshly isolated AT2 cells were either used directly for RNA and protein isolation or left for 2 days to attach on collagen/fibronectin coated surfaces. Alternatively, cells were cultured for 8–10 days to undergo transdifferentiation into an alveolar type 1-like (AT1-like) phenotype. Primary cell culture was performed using small airways growth medium (SAGM, Lonza, Verviers, Belgium) supplemented with penicillin (100 U/ml), streptomycin (100 μg/ml), and 1% fetal bovine serum (all purchased from Sigma-Aldrich, Dublin, Ireland). Where indicated, 10 ng/ml keratinocyte growth factor (KGF, ProSpec-Tany TechnoGene, Ltd., Rehovot, Israel) was added to the culture medium to inhibit differentiation of AT2 cells into an AT1-like phenotype. The use of human tissue specimens was approved by Saarland State Medical Board (Saarbrücken, Germany). All cell types were cultured in a humidified atmosphere at 37°C in 5% CO₂ as described in more detail by Nickel et al. (2017).

The smoke of two University of Kentucky research cigarettes (3R4F) was bubbled into 20 ml of RPMI 1640 medium (Biosciences, Dublin, Ireland) using a vacuum pump to generate 100% CSE. The latter was sterile filtered to remove any particulate matter and further diluted with RPMI medium to prepare 5 and 10% CSE which was used for exposure studies. Human AT1-like and NCI-H441 cells were exposed to either freshly prepared or aged CSE, which was prepared and stored at room temperature for 14 days, to investigate their effect on MRP1 abundance and activity.

RNA was isolated from freshly isolated AT2 cells, which were cultured for 8–10 days to transdifferentiate into the AT1-like phenotype and NCI-H441 cells grown in six-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany) using Tri-Reagent (Sigma-Aldrich) according to the manufacturer’s instructions and as described in a previously published protocol (Nickel et al., 2017). Semi-quantitative, one-step real time PCR (q-PCR) was carried out on a 7500 Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, United States) as described previously (Nickel et al., 2017) using KiCqStart predesigned primers [(Sigma-Aldrich) for ACTB (forward GACGACATGGAGAAAATCTG; reverse ATGATCTGGGTCATCTTCTC) and ABCC1 (forward AGC AGAAAAATGTGTTAGGG; reverse TACCCACTGGTAATA CTTGG)].

Western blotting was carried out to investigate MRP1 abundance in AT2, AT1-like and in NCI-H441 cells. It was also used to assess the influence of different cell culture conditions [i.e., whether growing cells under air-interfaced culture (AIC) or liquid-covered culture (LCC)] on MRP1 protein level in NCI-H441 cells. In addition, the analysis was used to determine the effect of CSE, budesonide and salbutamol sulfate on MRP1 abundance in NCI-H441 cells. Cells were grown in presence of 5 or 10 μM budesonide (Mundipharma Pharmaceuticals Limited, Dublin, Ireland) or 100 μM salbutamol sulfate (Sigma-Aldrich) for up to 6 days and compared with the negative control (medium alone) or incubated with the solvent [i.e., dimethyl sulfoxide (DMSO)] when appropriate.

Confluent cell monolayers were washed twice with ice cold phosphate buffered saline (PBS) and lysed with cell extraction buffer (Life Technologies, Eugene, OR, United States) supplemented with protease inhibitor cocktail (Roche, Mannheim, Germany). Subsequently, samples were sonicated and centrifuged at 12,000 × g for 15 min at 4°C. The total protein amount was determined by Pierce BCA protein assay kit (Thermo Fisher Scientific, Waltham, MA, United States) according to the manufacturer’s instructions. Polyacrylamide gel electrophoresis was carried out as described previously (Nickel et al., 2017). Following transfer onto immunoblot polyvinylidine fluoride membranes, blots were blocked with washing buffer [PBS containing 0.05% Tween 20 (PBST)] supplemented with 3% (w/v) bovine serum albumin (BSA) for at least 1 h at room temperature before being incubated overnight at 4°C with rat monoclonal anti-MRP1 Ab (clone MRPr1, GTX13368, GeneTex, Inc., Irvine, CA, United States, 1:50) in PBST supplemented with 1% (w/v) BSA. The following day, membranes were washed three times and incubated with secondary anti-rat antibody (1:5000; Santa Cruz, Dallas, TX, United States) for 1 h at room temperature. Peroxidase activity was detected with Immobilon Western Chemiluminescent HRP substrate (Millipore, Carrigtwohill, Ireland). Signals were documented using a ChemiDoc system (Bio-Rad Laboratories, Hercules, CA, United States).

Cell surface protein biotinylation was carried out to determine whether MRP1 is localized at the apical or basolateral membranes of polarized AT1-like and NCI-H441 cells. The analysis was not carried out in freshly isolated AT2 cells due to their unpolarized phenotype. Apical or basolateral membrane proteins of confluent, Transwell-grown cell monolayers were labeled with sulpho-NHS-biotin (Thermo Fisher Scientific), isolated and analyzed as described in a previously published protocol (Schwagerus et al., 2015).

NCI-H441, AT2, and AT1-like cells cultured in Lab-Tek chamber slides (Nunc A/S, Roskilde, Denmark) or on Transwell Clear inserts (either 12 mm or 6.5 mm in diameter, 0.4 μm pore size, Corning, Bedford, MA, United States) were used and processed for immunocytochemistry, as described previously (Nickel et al., 2017). Cells were fixed with 2% paraformaldehyde, incubated with 50 mM aqueous NH₄Cl and then permeabilized with 0.1% Triton X-100. Monolayers were blocked with 2% BSA in PBS and incubated overnight with rat monoclonal anti-MRP1 Ab (1:50 dilution). The following day, cell monolayers were washed twice and incubated with Alexa Fluor 488-conjugated goat anti-rat secondary antibody (ab150165, abcam, Cambridge, United Kingdom, 1:100) for 1 h at room temperature, followed by 5 min incubation with a Hoechst 33342 solution (1 μg/ml) to counterstain nuclei. Samples were visualized on a Leica SP8 confocal laser scanning microscope (Leica Microsystems, Wetzlar, Germany) with a 63× oil immersion objective, a 488 nm diode laser and 520 nm Alexa Fluor 488 detection filter (green antibody signal) and a 405 nm diode laser in combination with a Hoechst 33342 detection filter (blue nucleic signal).

Multidrug resistance-associated protein-1 activity in vitro was determined by carrying out bidirectional transport studies of the MRP1 substrate 5(6)-carboxyfluorescein (CF) across polarized monolayers of AT1-like and NCI-H441 cells as described by Salomon et al. (2014). CF is formed intracellularly from the cleavage of its non-fluorescent diacetate conjugate (CFDA) which diffuses passively into the cells. Due to their unpolarized phenotype, transport studies could not be carried out in freshly isolated AT2 cells. Cells were grown in Transwell Clear inserts and studies were carried out only across monolayers with transepithelial electrical resistance (TEER) values exceeding 500 Ω × cm². Monolayers were washed twice with pre-warmed Krebs-Ringer buffer (KRB; 116.4 mM NaCl, 5.4 mM KCl, 0.78 mM NaH₂PO₄, 25 mM NaHCO₃, 5.55 mM glucose, 15 mM HEPES, 1.8 mM CaCl₂, and 0.81 mM MgSO₄; pH 7.4) and then pre-equilibrated with the buffer solution for 1 h in the presence or absence of the MRP1 inhibitor MK-571 (20 μM, Santa Cruz). Permeation studies were initiated by replacing the buffer solution in the donor chambers with 100 μM CFDA solution (Applied BioProbes, Rockville, MD, United States) with or without the inhibitor compound. Cells were maintained at 37°C and 200 μl samples were collected from the receptor chambers after 0, 15, 30, 45, 60, 75, and 90 min and replaced with the same volume of buffer solution. Fluorescence intensity was analyzed using an automated plate reader (FLUOstar Optima, BMG LABTECH, Offenburg, Germany) at excitation and emission wavelengths of 485 and 520 nm, respectively. TEER values were measured before and after the study to verify cell monolayer integrity. The apparent permeability coefficient (P_app) was calculated using the following equation:

where ΔQ is the change in the amount of CF over the designated period of time (Δt), A is the nominal surface area of the growth supports (i.e., 1.13 and 0.33 cm² in case of 3460 and 3470 Transwell inserts, respectively), and C₀ is the initial concentration of CFDA in the donor fluid.

Bidirectional CF efflux studies were carried out on polarized AT1-like and NCI-H441 cell monolayers grown in Transwell Clear inserts. Cell monolayers were washed twice and then incubated with KRB alone or supplemented with MK-571 (20 μM) for 1 h. Afterward, cells were loaded with 100 μM CFDA solutions (± MK-571) by adding 0.5 and 1.5 ml into the apical and basolateral chambers, respectively. Following 1 h incubation, monolayers were washed twice, and the donor solutions were replaced with the same volumes of fresh KRB alone or supplemented with the inhibitor compound. Afterward, 200 μl samples were collected from both apical and basolateral chambers every 15 min and up to 90 min and replaced with the same volumes of fresh KRB. At the end of experiments, TEER values were measured to confirm cell monolayers integrity.

Carboxyfluorescein efflux studies from AT-like and NCI-H441 cell monolayers grown in 24-well plates (Greiner Bio-One) were carried out to determine the effect of a series of inhaled drugs and CSE on MRP1 activity in vitro. As described above, cell monolayers were loaded with CFDA solution alone or containing either budesonide (5 or 10 μM), beclomethasone dipropionate (50 μM, Sigma-Aldrich), salbutamol sulfate (100 μM), salbutamol base (100 μM, Sigma-Aldrich), R-salbutamol HCl (100 μM, Sunovion Pharmaceuticals, Marlborough, MA, United States), S-salbutamol HCl, (100 μM, Sunovion Pharmaceuticals), terbutaline (100 μM, Sunovion Pharmaceuticals), formoterol fumarate (100 μM, Santa Cruz), L-sulforaphane (10 μM, Cayman Chemical, Ann Arbor, MI, United States), 5 or 10% CSE or the solvent [i.e., dimethyl sulfoxide (DMSO)] when appropriate. Following 1 h incubation, CFDA solutions were replaced with fresh KRB alone or supplemented with one of the above compounds and CF efflux was assessed by collecting 200 μl samples every 15 min. After 90 min, cell monolayers were washed twice with ice cold KRB and lysed in cell extraction buffer and fluorescence intensity was analyzed as described above. For standardization, the total protein concentration of whole cell lysate was determined by Pierce BCA assay (Thermo Fischer Scientific) according to the manufacturer’s instructions and the amount of CF effluxed per μg of protein was calculated.

Results are expressed as means ± SD. The significance of differences between mean values was determined either by unpaired, two-tailed Student’s t-test or one-way ANOVA followed by Bonferroni’s post hoc comparisons test. P ≤ 0.05 was considered significant. All experiments were carried out at least in triplicate using cells from three different passages or donors.

Semi-quantitative real-time PCR analysis revealed ABCC1 mRNA expression at similar levels in freshly isolated AT2 cells and cells differentiated into an AT1-like phenotype (Figure 1A). Analysis of immunoblot data, however, revealed significantly (P ≤ 0.01) lower MRP1 protein abundance in freshly isolated AT2 cells than in AT1-like cells from the same donors (Figures 1B,C). To exclude the probability that the lower protein levels observed in freshly isolated AT2 cells was an artifact due to cleavage of MRP1 protein by enzymes used for cell isolation, AT2 cells from the same donors were cultured in the presence or absence of 10 ng/ml KGF for at least 8 days. The growth factor has been shown to inhibit differentiation of AT2 cells into AT-like phenotype in primary culture (Demling et al., 2006). MRP1 abundance was, again, significantly (P ≤ 0.01) lower in cells which retained their AT2 characteristics than in cells differentiated into an AT1-like phenotype (Figures 1D,E). CLSM analysis was inconclusive in terms of MRP1 localization in unpolarized AT2 cells (Figure 1F), but MRP1 signals were primarily localized to the basolateral cell membranes of AT1-like cells grown to monolayers for at least 8 days (Figure 1G). The localization of MRP1 in the basolateral membranes of AT1-like cells was further confirmed by cell surface protein biotinylation and subsequent analysis by Western blotting (Figure 2A).

Semi-quantitative real-time PCR and Western blot analyses showed stable MRP1/ABCC1 expression across several passages of NCI-H441 cells. Neither passage number nor cell culture conditions (i.e., whether cells were grown in LCC or AIC conditions) had an influence on MRP1 abundance (Figures 3A–C). Protein levels of the transporter in the NCI-H441 cell line were comparable to AT1-like cells (Figures 3D,E). CLSM analysis of MRP1 in NCI-H441 cells grown under AIC (Figure 3F) and LCC (Figure 3G) conditions showed MRP1 signals mainly along the basolateral membranes. Cell surface protein biotinylation of Transwell-grown NCI-H441 monolayers further confirmed the basolateral localization of the protein (Figure 2A).

Multidrug resistance-associated protein-1 activity was studied in vitro by bidirectional transport and efflux studies of CF in polarized, Transwell-grown AT1-like and NCI-H441 monolayers, respectively. Data obtained were consistent with a basolateral localization of the transporter. A significantly (P = 0.001) higher amount of CF was effluxed into the basolateral receiver chamber than the apical receiver chamber from human AT1-like (Figure 2B) as well as NCI-H441 (Figure 2C) monolayers. The CF efflux was sensitive to inhibition by MK-571. Likewise, bidirectional transport studies showed MK-571-sensitive, net apical-to-basolateral transport of CF across both cell types (Figures 4A,B).

Carboxyfluorescein efflux studies were carried out to assess the effect of a set of commonly prescribed inhaled drugs on MRP1 activity in vitro. Budesonide (5 or 10 μM) decreased CF efflux from AT1-like and NCI-H441 cell monolayers in a dose-dependent manner (Figure 5A and Table 1). Similarly, beclomethasone dipropionate (50 μM) and salbutamol sulfate (100 μM) resulted in a significant reduction of CF efflux from NCI-H441 cells. Other tested bronchodilator compounds had no such effect (Table 1).

Immunoblot analysis of NCI-H441 cells grown in the presence of either 5 or 10 μM budesonide or 100 μM salbutamol sulfate for up to 6 days showed no influence of the drugs on MRP1 abundance (Figure 5B).

Carboxyfluorescein efflux studies and immunoblot analysis were used to determine the influence of CSE on MRP1 activity and abundance in AT1-like and NCI-H441 cells. Twenty-four hours exposure to freshly prepared 10% CSE caused a significant (P ≤ 0.01) reduction in CF efflux from AT1-like and NCI-H441 cell monolayers (Figures 6A,B). The effect of the freshly prepared CSE was dose-dependent and more pronounced than that of aged CSE in NCI-H441 cells (Figure 6A). Interestingly, CSE exposure resulted in a significant increase in MRP1 abundance in NCI-H441 cells (Figures 6C,D).

The nuclear factor erythroid 2 related factor 2 (Nrf2)-antioxidant response elements (ARE) pathway has been previously suggested to be involved in the regulation of MRP1 expression (Ji et al., 2013). CF efflux studies were, therefore, carried out in the presence of the Nrf2 activator, sulforaphane to determine if it can improve MRP1 activity. The compound increased CF efflux from AT1-like cell monolayers (Figure 6B) but it had no influence on MRP1 activity in NCI-H441 cells (data not shown).