Homer1a^+/+, Homer1a^+/-, and Homer1a^-/- mice (on a mixed C57BL/6J × 129Xi/SvJ background; see Hu et al., 2010 for details), as well as Homer1^+/+ and Homer1^-/- mice (on a mixed BALB/cJ × C57BL/6J × 129Xi/SvJ background; see Yuan et al., 2003 for details) were bred in-house at UCSB from mating of heterozygous breeder pairs and both male and female littermates were employed in all studies. The primers for genotyping Homer1a^-/- mice are: H1F: CACCCGATGTGACACAGAAC, H1cR: CCAGTAATGCCACGGTACG, H1aR298: CACTGCTTCACATTGGCAGT. Wild-type band (H1F/H1cR) is at 602 bp and KO band (H1F/H1aR298) is at 211 bp. The primers for genotyping Homer1^-/- mice are: 84: CAATGCATGCAATTCCTGAG, 85: CGAGAAACTTACATATATCCGCAAA, 86: GAACTTCGCGCTATAACTTCG. Wild-type band (H1F/H1cR) is at 602 bp and KO band (H1F/H1aR298) is at 211 bp. To reduce litter confounds, mice were selected from a minimum of four different litters within each replicate and testing began when mice were 7–8 weeks of age. Animals were group-housed in polyethylene cages in a temperature (25°) and humidity (71%) controlled vivarium under a 12 h dark/light cycle (lights off: 7:00 A.M.) with food and water available ad libitum. Experimental protocols, as well as housing and animal care, were consistent with the guidelines provided by the National Institute of Health (NIH) Guide for Care and Use of Laboratory Animals. All experiments were approved by the Institutional Animal Care and Use Committee of University of California, Santa Barbara.

Male and female Homer1a^+/+, Homer1a^+/-, Homer1a^-/- littermates were subjected to a behavioral test battery consisting of various conventional paradigms to assay anxiety-like behavior (elevated plus maze, reactivity to a novel object), depressive-like behavior (Porsolt swim test, saccharin preference), spatial learning and memory (Morris water maze), and sensorimotor processing/gating (acoustic startle and pre-pulse inhibition of acoustic startle/PPI). With the exception of the saccharin preference test, the procedures for each of these paradigms are detailed in our published work (see Szumlinski et al., 2004, 2005a; Lominac et al., 2005; Ary et al., 2013; Lee et al., 2015; Guo et al., 2016).

In brief, for the elevated plus maze, mice were placed on the center intersection of the maze with two white open arms and two black-walled arms 24 cm high. Each arm measured 123 cm long by 5 cm wide. Behavior in the apparatus was monitored for a 5 min trial (Lee et al., 2015; Guo et al., 2016). For the reactivity to a novel object test, mice were placed into a black Plexiglas (40 cm × 40 cm × 30 cm) open-field arena, containing an inedible object in the center. Mice were allowed to explore the arena for 2 min and the amount of time spent investigating the object, as well as the number of object contacts were recorded (Ary et al., 2013; Lee et al., 2015). For the Porsolt swim test, mice were placed into Plexiglas buckets (23 cm × 24 cm × 22 cm) and the behavior of the mice was scored in 30-s intervals using a checklist for swimming or floating over a 15-min period (Lominac et al., 2005; Szumlinski et al., 2005a; Ary et al., 2013; Guo et al., 2016). For the saccharin preference test, mice were presented with two 50 ml sipper tubes, one containing tap water and the other containing a 0.16% w/v saccharin solution for 24 h in the home cage. Bottle weights before and after the 24-h drinking period gauged the volume consumed and were used to calculate the preference for the saccharin solution. For the Morris water maze, we employed a stainless steel circular tank (200 cm in diameter, 60 cm in height; painted white on the inside and filled with room temperature water to a depth of 40 cm), with salient extra maze cues located on all four walls of the room in which the maze was located. A clear platform was placed in the tank and its location remained fixed throughout the course of the experiment. For 4 days, mice were trained four times a day (once at each compass point) to locate the hidden platform. During each trial, mice were randomly placed in the pool at one of the four compass points and swimming was recorded digitally by a video camera mounted on the ceiling directly above the pool (ANY-Maze, Stoelting). Training sessions were 120 s in duration; if the mice were unable to locate the platform during the allotted time, they were guided to the platform where they remained for 30 s. At 24 h after the last training trial, a 120-s memory probe test was performed in which the platform was removed and the amount of time taken by the mouse to swim toward the platform location and the time spent swimming in the platform quadrant was recorded (Lominac et al., 2005; Ary et al., 2013). For the acoustic startle/PPI experiment, we presented six different trial types: startle pulse (st110, 110 dB/40 ms), low prepulse stimulus given alone (st74, 74 dB/20 ms), high prepulse stimulus given alone (st90, 90 dB/20 ms), st74 or st90 given 100 ms before the onset of the startle pulse (pp74 and pp90, respectively), and no acoustic stimulus (i.e., only background noise was presented; st0). St100, st0, pp74, and pp90 trials were applied 10 times, st74 and st90 trials were applied five times, with trials randomly administered [average intertrial interval was 15 s (10–20 s)]. The background noise of each chamber was 70 dB. The data for startle amplitude were averaged across stimulus trials and the percent inhibition of the 110 dB startle by the 74 and 90 dB prepulse intensities was calculated for each animal to index PPI (Szumlinski et al., 2005a; Guo et al., 2016).

For studies of Homer1a^+/+,+/-,-/- mice, behavioral testing occurred across days, with several tests conducted per day, spaced 4–6 h apart. The order of testing was the same for each cohort of animals: Day 1: PPI, reactivity to novel objects, Day 2: elevated plus-maze, and Porsolt swim test. Mice were then allowed 2–3 days recovery from the Porsolt swim test and then tested for their ability to habituate to repeated placement within a novel activity chamber (30 cm × 30 cm × 45 cm; 30 min sessions over 5 days). As the Porsolt swim test was predicted to reduce performance in a Morris water maze, a separate cohort of Homer1a^+/+,+/-,-/- mice were trained (4, 2-min trials/day for 4 days) and then tested in the Morris water maze (2-min test) (see Lominac et al., 2005). Acoustic acuity was also assayed in a distinct cohort of male Homer1a^+/+,+/-,-/- mice by randomly presenting acoustic stimuli ranging in intensity from 0 to 125 dB within the acoustic startle chambers during a 20-min session. Following this session, this cohort of animals were assayed for saccharin preference by presenting mice with two 50 ml sipper tubes in the home cage (water vs. 0.125% w/v saccharin) under continuous-access procedures over the course of 8 days. With the exception of this last cohort of mice, all behavioral experiments included approximately equal numbers of male and female subjects (minimum n = 6/sex/genotype) and sex was included as a between-subjects variable during data analysis by analyses of variance (ANOVA). However, with the exception of the novel object test, no sex differences in behavior were observed and thus, the data are presented collapsed across sex for the majority of the experiments.

For behavioral paradigms in which genotypic differences were observed, the experiment was replicated in Homer1a^+/+ and Homer1a^-/- mice infused intra-NAC with an AAV carrying Homer1a cDNA (AAV-Homer1a) or a scrambled control (AAV-control; see section 2.4) to confirm an active role for this IEG isoform in regulating behavior. For these follow-up studies, behavioral testing commenced a minimum of 3 weeks following AAV infusion and mice were assayed for acoustic startle/PPI, followed by the Porsolt swim test. As behavior in the Morris Water Maze test relies heavily upon hippocampal, rather than accumbens, function, AAV-infused mice were not tested in this assay.

A separate cohort of male and female Homer1a^+/+,+/-,-/- mice were used to index for genotypic differences in cocaine-conditioned reward using cocaine-induced place-conditioning. The procedures to elicit place-conditioning were identical to those described previously by our group (e.g., Ary et al., 2013), with separate groups of mice injected with intraperitoneal (i.p.) injections of 3, 10, or 30 mg/kg cocaine (National Institute on Drug Abuse, Bethesda, MD, United States). Animals were habituated to both compartments of the two-compartment apparatus for 15 min during a pre-conditioning testing (PreTest) and then were subjected to daily, 15-min, conditioning sessions, alternating between cocaine and saline, over the course of 8 days. The day following the last conditioning session, animals were allowed free-access to both compartments in a post-conditioning test. The behavior of the mice was recorded throughout the experiment using a digital video-tracking system and ANYMaze software (Stoelting, Co., Wood Dale, IL, United States). The difference in the time spent in the cocaine- versus saline-paired compartment on a post-conditioning test served to index cocaine reward/aversion (Conditioned Place-Preference Score or CPP Score). The data were analyzed using a Genotype (+/+, +/-, -/-) × Sex × Dose (3, 10, and 30 mg/kg cocaine) × Side (paired vs. unpaired) ANOVA, with repeated measures on the Side factor. The data for locomotor activity during the PreTest and cocaine-induced locomotion were published previously in Park et al. (2013). A follow-up study employed identical place-conditioning procedures to assay the effects of intra-NAC AAV-Homer1a infusion upon genotypic differences in novelty-induced locomotion during the PreTest, habituation of locomotor activity (changes in saline-induced locomotion observed during the four saline-conditioning sessions), sensitization of cocaine-induced locomotor hyperactivity (changes in locomotor activity observed during the four cocaine-conditioning sessions; 10 mg/kg) and cocaine-conditioned reward (CPP Score following conditioning).

The rat Homer1a coding sequence was amplified using whole-brain cDNA, and the PCR was product expressed as an N-terminal fusion protein with the hemagglutinin (HA)-tag in a rAAV backbone containing the 1.1 kb CMV enhancer/chicken-actin (CBA) promoter, 800 bp human interferon scaffold attachment region inserted 5_ of the promoter, the woodchuck post-transcriptional regulatory element (WPRE), and the bovine growth hormone polyA flanked by inverted terminal repeats (AAV-Homer1a, AAV-Homer1c). The same AAV-CBA-WPRE-bGH backbone encoding the enhanced green fluorescent protein (EGFP) was used as control (AAV-GFP). As described previously (Hauck et al., 2003), AAV pseudotyped vectors virions containing a 1:1 ratio of AAV1 and AAV2 capsid proteins with AAV2 intertrigeminal regions were generated. For this, human embryonic kidney 293 cells were transfected with the AAV cisplasmid, the AAV1 (pH21) and AAV2 (pRV1) helper plasmids (pF6), and the adenovirus helper plasmid by standard calcium phosphate transfection methods. Cells were harvested at 48 h after transfection, and the vector purified using heparin affinity columns as described previously (During et al., 2003). As also described previously (Clark et al., 1999), genomic titers were determined using the Prism 7700 sequence detector system (Applied Biosystems, Foster City, CA, United States) with primers designed to WPRE.

The NAC is a limbic structure implicated in both the psychomotor-activing and rewarding/reinforcing properties of drugs of abuse (e.g., Morein-Zamir and Robbins, 2015; Scofield et al., 2016). Homer1a is induced within the NAC by various drugs of abuse (Szumlinski et al., 2008a; Marton et al., 2015) and Homer1a^-/- mice exhibit impaired cocaine-induced neurochemical sensitization within this region (Park et al., 2013). Thus, under isoflurane anesthesia, we conducted craniotomies to implant bilateral guide cannulae (20-gauge; 10-mm long), 2 mm above the NAC of mice (see Lominac et al., 2005; Cozzoli et al., 2009; Ary et al., 2013), for the purposes of conducting in vivo microdialysis measurement of glutamate and dopamine (see section 2.6 below) and/or infusing AAVs carrying either cDNA for Homer1a (AAV-Homer1a) or a scrambled DNA sequence as a control (AAV-control) to determine an active role for NAC Homer1a expression in regulating neurochemistry and behavior (see Lominac et al., 2005; Cozzoli et al., 2009 for AAV details). A Kopf stereotaxic device held the animal’s head level and holes were drilled based on coordinates from bregma: (AP: +1.3 mm; ML: ±1.0 mm; DV: -2.3 mm) (Paxinos and Franklin, 2013). Guide cannulae were fixed to the skull with dental resin, surgical incisions were closed with a tissue adhesive.

For AAV-naïve mice undergoing microdialysis procedures, dummy cannulae (24 gauge; length equivalent to guide cannulae) was then placed inside the guide cannulae to prevent contamination or blockade and animals were allowed a minimum of 5 days recovery prior to neurochemical testing. Our AAVs are considered BSL1 and thus, standard protective personal equipment were employed during AAV infusion. For animals receiving AAV infusions, microinjectors (33-gauge, 12 mm long) where then lowered down the guide cannulae and the AAVs infused at a rate of 0.05 μl/min for 5 min (total volume/side = 0.25 μl). Microinjectors were left in place for an additional 5 min to allow for diffusion away from the microinjector tip prior to removal and occlusion of the guide cannulae. AAV-infused mice were allowed a minimum of 3 weeks recovery to achieve maximal neuronal transduction (Klugmann and Szumlinski, 2008). AAV transduction within the NAC was verified using standard immunohistochemical staining procedures for the hemagglutanin (HA) tag using a mouse anti-HA primary antibody (Covance, Princeton, NJ, United States), and straining visualized using a M.O.M. Detection Kit (Vector Laboratories, Burlingame, CA, United States), as conducted previously (Szumlinski et al., 2004, 2005b, 2017; Lominac et al., 2005; Cozzoli et al., 2009; Ary et al., 2013).

Homer1a^-/- mice do not exhibit cocaine-induced dopamine or glutamate sensitization in the NAC (Park et al., 2013). Thus, a series of in vivo microdialysis experiments were conducted to relate this sensitization-resistant phenotype to biochemical indices of neuronal function within this region. For all in vivo microdialysis experiments, a microdialysis probe (24 gauge; 12 mm in length with ∼1.0 mm active membrane) was lowered unilaterally into one of the guide cannulae and perfused with artificial CSF (146 nM NaCl, 1.2 mM CaCl₂, 2.7 mM KCl, 1.0 mM MgCl₂, pH = 7.4) at a rate of 2 μl/min. Dialysate collection began after 3 h of probe equilibration and occurred in 20 min intervals into vials containing 10 μl of preservative [10% methanol (v/v), 15% acetonitrile (v/v), 150 mM NaPO₄, 4.76 mM citric acid, 3 mM SDS, 50 mM EDTA, pH = 5.6]. Dialysate was stored at -80°C until analysis by HPLC (see section 2.6 below). Microdialysis probe localization within the NAC was verified using standard cresyl violet staining procedures (for AAV-naïve mice) or upon immunohistochemical localization of AAV transduction (see above), followed by examination of tissue under light microscope. In nearly all subjects, microdialysis probes were localized primarily to the shell subregion or to the interface between the shell and core subregions (see section 3).

The high pressure liquid chromatography (HPLC) system and procedures for the electrochemical detection of glutamate and dopamine in the dialysate of mice, as well as the chromatographic analysis of the data, were identical to those described previously by our group (Lominac et al., 2012, 2014; Ary et al., 2013; Szumlinski et al., 2017). Each HPLC system consisted of a Coularray detector, a Model 542 autosampler and two Model 582 solvent delivery systems (ESA/Thermo-Fisher), with a detection limit of 0.01 fg/sample (20 μl/sample onto column). For analysis of dopamine, the MD-TM mobile phase was employed (ESA/Thermo-Fisher), and neurotransmitters in 30 μl from each 50 μl sample were separated using a MD-150 mm × 3.2 mm column (ESA/Thermo-Fisher). An ESA/Thermo-Fisher 5014B analytical cell was used for the detection of monoamines (oxidation and reduction electrode potentials of +220 and -150 mV, respectively). For glutamate, the mobile phase consisted of 3.5% acetonitrile (v/v), 22% methanol (v/v), 100 mM NaPO₄, pH = 6.75. A reversed phase column (50 mm × 3.0 mm Capcell PAK; Shiseido, Tokyo, Japan) was used to separate the amino acids, and precolumn derivatization with o-phthaladehyde (2.7 mg/ml) of the 20 μl from each 50 μl sample was performed using an ESA Model 540 autosampler (ESA/Thermo-Fisher). Glutamate was detected using an electrochemical analytical cell with an oxidizing potential of +550 mV. Glutamate and dopamine content in each sample were analyzed by peak height and compared with an external standard curve for quantification (glutamate standards: 2.5, 5.0, 10 mM; dopamine standards: 1.25, 2.5, 5 nM).

As detailed above, the majority of data were analyzed using ANOVAs, with repeated measures as appropriate for the experimental design. Significant interactions were deconstructed along the relevant factors, and significant main effects were followed by least significant differences (LSDs) post hoc tests or t-tests, as appropriate for the number of comparisons. α = 0.05 for all analyses.

Exposure to a novel environment induces Homer1a expression within forebrain (Vazdarjanova et al., 2002) and pan-Homer1 KO mice exhibit robust signs of hyper-emotionality across a variety of behavioral paradigms (Szumlinski et al., 2004, 2005a; Lominac et al., 2005). Thus, we first assayed Homer1a^+/+ and Homer1a^-/- mice for behavioral signs of negative affect using a comparable behavioral test battery as that employed in our previous work. As detailed below, the results do not support a consistent role for Homer1a induction in the manifestation of anxiety- or depressive-like behaviors in mice.

Pan-Homer1 knock-out mice exhibit marked deficits in sensorimotor-gating (Szumlinski et al., 2004, 2005a; Lominac et al., 2005). Thus, we determined the effects of Homer1a deletion upon acoustic startle and pre-pulse inhibition of acoustic startle (PPI). Again, we failed to detect a sex difference in behavior (for all variables, no Sex effect or interactions, p > 0.30), thus, the data were collapsed across sex for presentation.

Pan-Homer1 deletion markedly impairs learning and memory on several assays (Lominac et al., 2005; Szumlinski et al., 2005a; Gerstein et al., 2012) and intracranial manipulations of Homer1a expression affect spatial memory (e.g., Klugmann et al., 2005; Celikel et al., 2007; Gerstein et al., 2012, p. 213). Thus, we trained male mice to locate a hidden platform in a Morris water maze task and then assessed for long-term spatial memory in a probe trial, conducted 24 h following the 4th acquisition session. Surprisingly, genotypic differences in behavior were not detected during the acquisition phase of testing, either across trials within days, or across days of training (Figure 2D) [distance to locate platform, Trial effect: F(3,225) = 5.18, p = 0.003; Day effect: F(3,225) = 33.50, p < 0.0001; no main effect of, or interactions with the Genotype factor; data not shown for time taken to locate platform, Trial effect: F(3,225) = 7.87, p < 0.0001; Day effect: F(3,225) = 34.46, p < 0.0001; no main effect of, or interaction with, the Genotype factor]. In contrast to the data for maze acquisition, marked genotypic differences were observed regarding recall of the platform location, when tested 24 h later (Figure 2E), with both Homer1a^+/- and Homer1a^-/- mice exhibiting impaired recall, as indicated by lower percent total distance and percent time spent in the SW quadrant, which formerly contained the hidden platform [for % Distance: Genotype effect: F(2,27) = 6.79, p = 0.004; for % Time: Genotype effect: F(2,27) = 5.82, p = 0.008; post hoc tests]. No genotypic difference in the distance swam (Figure 2E; p = 0.65) argues that the recall impairment exhibited by Homer1a mutants was unrelated to swimming ability.

Pan-Homer1 deletion increases sensitivity to the conditioned rewarding properties of cocaine (Szumlinski et al., 2004; Lominac et al., 2005). Thus, we characterized the dose-response function for cocaine-induced place-conditioning in male and female Homer1a^+/+,+/-,-/- mice. No sex differences were observed for cocaine-induced place-conditioning [Side effect: F(1,167) = 223.67, p < 0.000; Dose × Side: F(2,167) = 11.36, p < 0.0001; Sex effect and interactions, p’s > 0.10] and so, the data were collapsed across sex for presentation. Despite the large sample sizes employed in this experiment, we did not detect an effect of Homer1a deletion upon the dose-response function for cocaine-induced place-preference (Figure 3; no Genotype effect or Genotype × Side interactions, p’s > 0.35). These data argue little role for Homer1a induction in either the associative learning/memory or incentive motivational processes involved in the development and expression of cocaine-conditioned reward.

Although it appeared as if Homer1a deletion elevated baseline glutamate in the study of DHPG-induced glutamate release (Figure 4A; DHPG = 0 μM), the genotypic difference was not significant (t-test: p = 0.19). However, Homer1a deletion prevented the capacity of DHPG to stimulate glutamate release within NAC (Figure 4A) [Genotype × Dose: F(3,36) = 26.02, p < 0.0001]. DHPG dose-dependently elevated glutamate in Homer1a^+/+ mice [DHPG effect: F(3,15) = 68.31, p < 0.0001], while no DHPG-induced rise was apparent in Homer1a^-/- mice (DHGP effect: p = 0.70). In contrast to Homer1a deletion, a comparison of baseline glutamate indicated lower glutamate levels in Homer1^-/- versus Homer1^+/+ mice [t(16) = 2.36, p = 0.02]. Further, pan-Homer1 deletion blunted, but did not block, the capacity of DHPG to increase NAC glutamate (Figure 4B) [Genotype × DHPG: F(3,51) = 4.65, p = 0.006], as evidenced by a significant DHPG-induced rise in glutamate in both genotypes [DHPG effect, for Homer1^+/+: F(3,24) = 15.00, p < 0.0001; for Homer1^-/-: F(3,27) = 4.37, p < 0.01]. These data provide evidence for distinct effects of Homer1a and pan-Homer1 deletion upon mGlu1/5-dependent regulation of extracellular glutamate in vivo.

In this study, both Homer1a^-/- (Figure 4C) and pan-Homer1^-/- (Figure 4D) mice exhibited significantly lower baseline glutamate levels than their wild-type controls [for Homer1a: t(13) = 2.39, p = 0.03; for pan-Homer1: t(14) = 3.02, p = 0.009]. In contrast, Homer1a^-/- KO mice exhibited a modest, but statistically significant elevation, in basal dopamine levels (Figure 4E) [t(13) = 2.05, p = 0.045], whereas differences in basal dopamine were not apparent between Homer1^+/+ and Homer1^-/- mice (Figure 4F; t-test, p > 0.35).

Despite employing the same perfusate through the course of study, the effects of depolarization were more pronounced in the Homer1a versus the Homer1 study, which might reflect differences in the genetic background of the two mutant lines. Nevertheless, a marked genotypic difference in K⁺-stimulated glutamate release was apparent in the study of Homer1a mice [Genotype × K⁺: F(2,26) = 7.93, p = 0.002]; while, K⁺ stimulated a rise in glutamate in both genotypes (Figure 4C) [for Homer1a^+/+: F(2,14) = 10.70, p = 0.002; for Homer1a^-/-: F(2,12) = 6.01, p = 0.02], the magnitude of the rise observed in Homer1a^-/- animals was considerably less than that observed in their controls. Although, Homer1^-/- mice exhibited lower glutamate levels than Homer1^+/+ animals, irrespective of the concentration of K⁺ perfused (Figure 4D) [Genotype effect: F(1,14) = 9.67, p = 0.008], Homer1 deletion did not alter the capacity of K⁺ to stimulate glutamate release within the NAC [K⁺ effect: F(2,28) = 13.08, p < 0.0001; Genotype × K⁺: p = 0.11].

In the case of dopamine, Homer1a deletion prevented K⁺-stimulated dopamine release within the NAC (Figure 4E) [Genotype × K⁺: F(2,38) = 4.57, p = 0.02; one-way ANOVAs: for Homer1a^+/+, F(2,26) = 9.32, p = 0.001; for Homer1a^-/-: p = 0.78]. In contrast, pan-Homer1 deletion had no impact upon K⁺-stimulated dopamine release in this region [K⁺ effect: F(2,40) = 6.86, p = 0.003; Genotype effect and interaction, p’s > 0.70]. These data provide novel evidence that the selective deletion of Homer1a, but not the entire Homer1 gene, reduces the excitability of both dopamine and glutamate terminals within the NAC.

Linear regression analyses of the plots of the no net-flux study (Figure 5A) confirmed lower NAC extracellular glutamate content in Homer1a^-/- versus Homer1a^+/+ mice (Figure 5B) [t(13) = 5.85, p = 0.03]. Linear analysis also indicated a significant reduction in the in vivo recovery of glutamate in Homer1a^-/- mice relative to Homer1a^+/+ controls, as indicated by differences in the slopes of the linear regressions (Figure 5C) [t(13) = 5.51, p = 0.04].

To examine an active role for nucleus accumbens Homer1a in the behavioral phenotype of Homer1a^-/- mice, AAV constructs carrying either Homer1a cDNA (AAV-Homer1a) or a scrambled DNA control were infused into the nucleus accumbens of Homer1a^+/+ and Homer1a^-/- mice.

Although we failed to detect an effect of Homer1a deletion upon cocaine-conditioned reward (Figure 3), Homer1a deletion prevents the development of cocaine-induced behavioral sensitization (Park et al., 2013) and the effect of Homer1a over-expression within the NAC is not known. Thus, we employed our cocaine-induced place-conditioning procedures to determine the effects of intra-NAC AAV-Homer1a infusion upon spontaneous and cocaine-induced changes in locomotor activity, as well as place-conditioning, in Homer1a^+/+ and Homer1a^-/- mice.

Pan-Homer1^-/- mice exhibit hyper-emotionality across a variety of paradigms (Szumlinski et al., 2004, 2005a; Jaubert et al., 2007; Wagner et al., 2014, 2015). In stark contrast, the anxiety-like behavior exhibited by Homer1a^-/- herein was indistinguishable from that of wild-type mice, although Homer1^+/- mutants did exhibit signs of hypo-anxiety on the elevated plus maze (Figures 1A,B). The present results are in line with the results of a study by Inoue et al. (2009), in which the Homer1a deletion did not alter anxiety-like behavior on the elevated plus-maze, open field or light–dark box tests (Inoue et al., 2009). These data for Homer1a-null mutants are interesting in light of evidence that transgenic mice over-expressing Homer1a within striatum increases anxiety signs in mice, which could be reversed upon conditional deletion of Homer1a (Tappe and Kuner, 2006). Taken together, the above findings from constitutive mutant mice argue that Homer1a over-expression is sufficient, but not necessary, for the manifestation of anxiety-like behavior.

However, other data in the literature argue that Homer1a induction exerts an “anxiolytic” or “anti-depressant” effect. For example, AAV-mediated Homer1a over-expression within the basolateral amygdala reduces the manifestation of fear-conditioning, as well as social interaction (Banerjee et al., 2016), while AAV-mediated restoration of Homer1a to the prefrontal cortex of pan-Homer1^-/- mice reverses their hyper-anxious and depressive-like phenotype (Lominac et al., 2005). Consistent with these latter data, both Homer1a^+/- and Homer1a^-/- mice exhibited a reduced latency to float in the Porsolt swim test in the present study (Figure 1E). In fact, this particular response to a stressor was the only emotion-related phenotype expressed in common by Homer1a^-/- and pan-Homer1^-/- mice (see Table 1). Moreover, AAV-mediated Homer1a over-expression within the NAC increased the float latency in both Homer1a^+/+ and Homer1a^-/- mice (Figure 6C), arguing that Homer1a induction within both the cell body and terminal regions of the corticoaccumbens projections actively gates a depressive-like phenotype – a finding in line with associations between variants in the Homer1 gene and major depressive disorder (e.g., Rietschel et al., 2010; Strauss et al., 2012; Rao et al., 2017). However, it is noteworthy that Homer1a deletion did not produce a “pro-depressive” effect in our saccharin preference test. In fact, a review of the extant literature suggests that site-specific Homer1a manipulations induce more robust and consistent effects upon negative affect (Lominac et al., 2005; Tappe and Kuner, 2006; Banerjee et al., 2016) than Homer1a deletion (Inoue et al., 2009; Figure 1 and Table 1). This raises the possibility that Homer1a induction within distinct brain regions may exert opposing roles in regulating affective responding that are masked under constitutive inhibition of IEG induction.

Homer1a induction is theorized to facilitate the rearrangement of the synaptic architecture of excitatory glutamate synapses necessary for metaplasticity and learning (e.g., Hu et al., 2010; Fagni, 2012; Marton et al., 2015). Although associative learning is intact in pan-Homer1^-/- mice (Szumlinski et al., 2004), this mutant exhibits deficits several other forms of learning and memory, including simple habituation (Lominac et al., 2005; Szumlinski et al., 2005a), spatial learning/memory (Lominac et al., 2005; Szumlinski et al., 2005a; Jaubert et al., 2007), and instrumental learning (Szumlinski et al., 2005a; Wagner et al., 2014). Moreover, pan-Homer1^-/- mice are deficient in long-term depression (Ronesi and Huber, 2008) and long-term potentiation (Gerstein et al., 2012), while Homer1a^-/- mice fail to exhibit homeostatic AMPA receptor scaling within cortex (Hu et al., 2010). In contrast to pan-Homer1^-/- mice (Szumlinski et al., 2005a), Homer1a-null mutants exhibited no observable deficits in the acquisition phase of a Morris water maze (Figure 2D), arguing that the induction of Homer1a is not necessary for the consolidation or recall of the information pertaining to the platform location.

However, akin to pan-Homer1^-/- mice (Szumlinski et al., 2005a), both Homer1a^+/- and Homer1a^-/- animals spent less time in the quadrant of the pool that formerly contained the hidden platform on the probe test (Figure 2E). While this result might reflect impaired spatial memory recall, such an interpretation is inconsistent with their intact learning of the maze location during the acquisition phase of this experiment. As no genotypic differences were observed in the amount of floating behavior during Porsolt swim testing (Figure 1F) or in the total distance traveled during the probe trial (Figure 2E), it is unlikely that Homer1a deletion altered swimming capacity during the memory probe test. Alternatively, the reduced time spent in the platform quadrant might reflect the deployment of an alternative platform search or escape strategy in Homer1a mutant mice. Indeed, pan-Homer1^-/- mice employ a “chaining” strategy to successfully navigate a water-version of the radial arm maze (Lominac et al., 2005; Szumlinski et al., 2005a) and AAV-mediated restoration of Homer1c, not Homer1a, to the PFC of pan-Homer1^-/- mice reverse their deficits in spatial working memory (Lominac et al., 2005). Further, hippocampal restoration of Homer1c reverses the spatial memory impairments exhibited by pan-Homer1^-/- (Gerstein et al., 2012), as well as aged mice (Gerstein et al., 2013) and hippocampal over-expression of Homer1a impairs the acquisition and/or recall of spatial memories (Klugmann et al., 2005; Celikel et al., 2007). Thus, it is clear that a more concerted research effort is required to understand more precisely how Homer1a induction within specific neurocircuits contributes to spatial and non-spatial learning of relevance to the etiology and treatment of attentional, learning and memory disorders (Wells et al., 2015).

Since their initial discovery, the glutamatergic consequences of Homer1 vs. Homer1a deletion have been studied extensively in vitro, with a focus on the regulation of post-synaptic signal transduction mechanisms (cf. Shiraishi-Yamaguchi and Furuichi, 2007; Worley et al., 2007; Fagni, 2012; Marton et al., 2015). However, transfection of hippocampal neuronal cultures with constitutively expressed Homer isoforms can augment, while transfection with Homer1a reduces, presynaptic neuronal activity (Sala et al., 2001) and a more recent study demonstrated opposing roles for CC- and IEG-Homer1 isoforms in regulating mGlu1/5-stimulated Ca²⁺ entry and glutamate release from astrocytes both in vitro and in situ (Buscemi et al., 2017). Further, CC- and IEG-Homer1 isoforms exert opposing effects upon mGlu1/5-dependent generation of anandamide (Jung et al., 2007), which is well-characterized to inhibit glutamate release via activation of CB1 receptors (e.g., Johnson and Lovinger, 2016). Indeed, we have reported several anomalies with respect to in vivo measures of glutamate function in the brains of pan-Homer1^-/- mice, notably, reduced NAC and elevated PFC basal extracellular glutamate content (Szumlinski et al., 2004, 2005a), and an altered capacity of acute cocaine to elevate extracellular glutamate levels within both the NAC (increased in pan-Homer1^-/-; Table 2) (Szumlinski et al., 2004) and PFC (decreased in pan-Homer1^-/-) (Lominac et al., 2005; Szumlinski et al., 2005a) that suggest a critical role for Homer1 proteins in regulating presynaptic aspects of glutamate transmission.

Herein, we report that, akin to Homer2^-/- mice (Szumlinski et al., 2004), pan-Homer1^-/- mice also exhibit a blunted capacity of the Group1 mGlu receptor agonist DHPG to stimulate glutamate release within the NAC (Figure 4B), which might reflect a “de-scaffolding” of mGlu1/5 receptors within neurons and/or astrocytes in this region (Brakeman et al., 1997; Tu et al., 1998, 1999; Buscemi et al., 2017). This being said, Homer1a^-/- mice also exhibited blunted DHPG-stimulated glutamate release (Figure 4A), as well as reduced basal extracellular glutamate content within the NAC (Figure 5B). These results were rather unexpected given that prior transgenic work argued a more critical role for CC-Homer1 versus Homer1a expression in regulating extracellular glutamate levels in vivo (Lominac et al., 2005), as well as glutamate release in vitro (Buscemi et al., 2017) and Homer1a^-/- mice exhibit increased cell surface expression of mGlu5 in situ and in vitro (Hu et al., 2010). While the source of the extracellular glutamate remains to be determined (i.e., neuronal, glial, or both), the capacity of DHPG to augment NAC glutamate levels in freely moving animals can be blocked by co-infusion of an mGlu1, but not mGlu5, inhibitor (Swanson et al., 2001). By extension then, the failure of both pan-Homer1^-/- and Homer1a^-/- mice to exhibit a DHPG-induced rise in NAC extracellular glutamate likely relates to a deficit in mGlu1-dependent, rather than mGlu5-dependent, signaling, with the DHPG phenotype of pan-Homer1^-/- mice likely reflecting incapacity to induce Homer1a.

DHPG-induced glutamate release within the NAC is also activity-dependent in vivo (Swanson et al., 2001). However, while Homer1 deletion does not alter the extraction fraction index of glutamate clearance/reuptake within the NAC (Szumlinski et al., 2005a), the extraction fraction was lower in Homer1a^-/- mice than wild-type controls (Figure 5C). This difference in extraction fraction was driven primarily by genotypic differences in glutamate flux at concentrations below y = 0 (Figure 5C), suggesting reduced glutamate release, rather than increased glutamate reuptake in Homer1a^-/- animals (Parsons and Justice, 1992). Although Homer1a^-/- mice do not exhibit changes in the frequency of miniature excitatory post-synaptic potentials within cortical pyramidal neurons (Hu et al., 2010), Homer1a^-/- mice exhibited robust deficits in high K⁺-stimulated release of both dopamine and glutamate within the NAC (Figures 4C,E), which is a finding in-line with their blunted dopamine response to acute cocaine and their failure to exhibit both dopamine and glutamate sensitization with repeated cocaine treatment (Park et al., 2013; Figures 8A,B). In contrast, depolarization-induced glutamate or dopamine release was intact within the NAC of pan-Homer1^-/- mice, despite their lower extracellular glutamate levels (Figures 4D,F and Table 2). This result indicates that pan-Homer1 deletion does not grossly impair the excitability of either dopamine or glutamate terminals within this region – a finding consistent with the fact that cocaine can elevate the NAC levels of both neurotransmitters in Homer1^-/- mice (Szumlinski et al., 2004). Importantly, AAV-mediated restoration of Homer1a to the NAC of Homer1a^-/- mice reversed both the anomalies in basal glutamate, as well as the blunted cocaine responsiveness of dopamine and glutamate observed in Homer1a^-/- animals, while NAC Homer1a over-expression in Homer1^+/+ mice was without any overt effect on our neurochemical measures (Figure 8). It remains to be determined whether or not virally mediated Homer1a expression incorporates into the post-synaptic density in a manner akin to endogenous protein to influence neurotransmission. Nevertheless, the present neurochemical data argue that Homer1a induction within the NAC actively regulates, but is not sufficient to augment, basal extracellular glutamate, as well as dopamine and glutamate responsiveness within this region. These data provide confirmatory evidence of a novel role for this IEG Homer1 isoform in regulating at least two neurotransmitters systems within a brain region highly implicated in incentive motivational and attentional processing.

As reported previously (Park et al., 2013), the failure of Homer1a^-/- mice to develop cocaine-induced neurochemical sensitization within the NAC (Figures 8A,B) is associated with a lack of locomotor sensitization in these animals (Figure 7C). Herein, we extend this prior work by demonstrating that AAV-mediated restoration of NAC Homer1a reversed the sensitization phenotype of Homer1a^-/- mice, without significantly affecting spontaneous or cocaine-induced changes in locomotor activity within Homer1a^+/+ controls (Figure 7). While we previously observed no overt effects of Homer1a deletion upon spontaneous locomotion or acute cocaine-induced locomotor-activity (Park et al., 2013), Homer1a^-/- GFP-controls exhibited blunted novelty-induced locomotion (Figure 7A), but greater locomotor activity in response to an acute cocaine injection (Figure 7B), which could relate to surgical/AAV procedures employed herein. Nevertheless, the striking parallels between the effects of manipulating Homer1a induction upon behavioral and neurochemical sensitization within the NAC observed to date argue a facilitatory role for Homer1a induction in the development of dopamine/glutamate plasticity that sensitizes drug-induced psychomotor activity.

The capacity of cocaine to augment NAC Homer1a expression (Brakeman et al., 1997; Ghasemzadeh et al., 2009b; Park et al., 2013) is reported to develop tolerance with repeated drug experience (Ghasemzadeh et al., 2009b). However, repeated cocaine exposure also reduces the NAC expression of constitutively expressed Homer1 and Homer2 proteins (e.g., Swanson et al., 2001; Ary and Szumlinski, 2007; Ben-Shahar et al., 2009; Ghasemzadeh et al., 2009a, 2011; Knackstedt et al., 2010; Loweth et al., 2014). A cocaine-induced reduction in the relative expression of CC-Homers is predicted to bias intracellular signaling within the NAC in favor of the dominant negative actions of the IEG isoforms, which we have now confirmed, herein, to be necessary for the development of drug-sensitized behavior. Consistent with this notion, pan-Homer1 deletion (Szumlinski et al., 2004; Lominac et al., 2005) or anti-sense oligonucleotide-mediated knock-down of Homer1 expression within the NAC augments the acute locomotor-stimulatory effects of cocaine (Ghasemzadeh et al., 2003). Conversely, restoration of the CC-Homer2b isoform to the NAC of cocaine Homer2^-/- mice (Szumlinski et al., 2004) or over-expression of either Homer1c or Homer2b within the NAC of cocaine-sensitized rats (Szumlinski et al., 2006) prevents their sensitized locomotor and glutamate responses to cocaine. Given the association between polymorphisms in the human Homer1 with disorders characterized by preservative behaviors (e.g., addiction, autism, and schizophrenia) (Norton et al., 2003; Dahl et al., 2005; Kelleher et al., 2012), it will be important to understand more precisely the mechanisms through which Homer1a modulates the capacity of cocaine, as well as other psychotomimetic drugs, to induce neuroplasticity within corticostriatal circuits that underpin enduring psychomotor hyperactivity.

Our prior studies of pan-Homer1^-/- and Homer2^-/- mice also demonstrated active and necessary roles for CC-Homer isoform expression within the NAC in regulating more complex forms of drug-induced associative and instrumental learning (Szumlinski et al., 2004, 2005b, 2008b; Lominac et al., 2005; Table 3). Indeed, disruption of Homer1-dependent binding within the NAC core subregion prevents both cue- and cocaine-primed reinstatement of drug-seeking (Wang et al., 2013), although AAV-mediated over-expression of either Homer1c or Homer2b within this subregion does not prevent the incubation of cue-elicited cocaine-seeking in rat models of drug self-administration (Loweth et al., 2014). Given the robust effects of Homer1a deletion upon cocaine-induced behavioral and neurochemical sensitization within the NAC, we were very surprised by the absolute lack of genotypic differences upon the capacity of cocaine to elicit a conditioned place-preference in mice (Figures 3, 7D). The cocaine doses and place-conditioning procedures employed in this study are sensitive to the effects of other transgenic manipulations of Homer and/or mGlu5 function (Szumlinski et al., 2004; Ary et al., 2013; Park et al., 2013). In fact, the dose-response function for cocaine-induced place-conditioning in both pan-Homer1^-/-, as well as Homer2^-/-, mice is shifted to the left of wild-type controls, indicating that deletion of either CC-Homer isoform increases behavioral sensitivity to cocaine-conditioned reward (Szumlinski et al., 2004). Important for data interpretation, the negative results for place-conditioning were derived from the same Homer1a^+/+ and Homer1a^-/- that exhibit blunted cocaine-induced behavioral and neurochemical sensitization (AAV-naïve, Park et al., 2013; AAV-infused, Figures 7, 8) and thus, the disparate findings across the different dependent measures cannot reflect cohort effects.

Although both transgenic and pharmacological evidence indicates that a cocaine-conditioned place-preference can develop independent of a dopamine-sensitized state within the NAC (e.g., Szumlinski et al., 2004, 2007), in our experience and to the best of our knowledge, the Homer1a^-/- mouse is the first example in which the magnitude of drug-conditioned reward in mice is independent of a glutamate-sensitized state within the NAC (e.g., Szumlinski et al., 2005a,b, 2008b, 2017; Penzner et al., 2008). Thus, while increasing NAC glutamate is sufficient to augment the magnitude of drug-induced place-conditioning (e.g., Szumlinski et al., 2017), NAC glutamate hypersensitivity does not appear to be required for this form of drug-related learning. Whether or not Homer1a deletion impacts more complex drug-related instrumental learning remains to be determined.

The NAC receives major glutamate input from the PFC and local manipulations of both CC- and IEG-Homer expression can regulate extracellular glutamate, as well as the cocaine responsiveness of glutamate within the PFC (Lominac et al., 2005; Szumlinski et al., 2005a; Ary et al., 2013). In fact, mimicking cocaine-induced changes in the expression of different Homer isoforms within PFC (Ary and Szumlinski, 2007; Ben-Shahar et al., 2009; Gould et al., 2015), by increasing Homer2 expression or reducing Homer1c expression, produces a number of glutamatergic adaptations within the NAC of cocaine-naïve mice that resemble those observed in cocaine-experience rodents (Ary et al., 2013). Importantly, mimicking the cocaine-induced imbalance in CC-Homer isoforms within PFC is also sufficient to potentiate a cocaine-conditioned place-preference (Ary et al., 2013). Conversely, Homer1c over-expression within ventral PFC prevents cocaine-primed reinstatement in a rat self-administration model (Gould et al., 2015). As withdrawal from repeated cocaine augments the glutamate responsiveness to drug-associated cues (Shin et al., 2016) and prior work indicates that Homer1a induction is required for normal homeostatic scaling of glutamatergic transmission within cortex (Hu et al., 2010), it will be important in future work to characterize the importance of Homer1a induction for the gating of corticofugal glutamate output from PFC subregions and the executive control the PFC exerts over subcortical structures regulating incentive motivation, affect and learning. It is clear that Homer1a function is complex, strengthening or weakening synaptic connectivity in manner that depends upon on-ongoing cellular activity and the specific intracellular signaling pathways engaged (e.g., Park et al., 2013; Marton et al., 2015). Given the interpretational difficulties associated with studying a constitutive mutant model, new animal models are required that are capable of acute up- and down-regulation of this isoform within specific neuronal and glial populations, to gain a deeper understanding of how Homer1a induction bi-directionally influences synaptic strength of relevance to the etiology of human neuropsychiatric disease.