Flies were raised at 25°C in a standard corn meal with a light:dark cycle of 12 h:12 h. The line expressing Aβ1-42 fused with the rat pre-proenkephalin signal peptide was kindly provided by Dr. Mary Konsolaki (Rutgers University). The upstream activating sequence (UAS)-Aβ42 construct is inserted in the 2nd chromosome. Lines w¹¹¹⁸ #5905 (+), elav^c155 [Gal4] #458 (G4), lines from the Df kit and the mutants for CG11796 #51528 and CG17249 #16098 were obtained from Bloomington Drosophila Stock Center (NIH P0OD018537). The CG11796 RNAi line #103482 was obtained from VDRC Stock Center. The elav [Gal4]; [UAS] Aβ42/Cyo line (G4 > Aβ42) was generated for the screen.

Groups of 30–40 male flies were raised at 25°C in 4-inch glass vials with food replacement every 2–3 days. The geotaxis behavior was tested using the RING assay as described (Gargano et al., 2005). The day before the test, 10 flies were shortly anesthetized with CO₂ and placed into a fresh vial. They were let to recover overnight at 25°C, transferred to clear glass vials and placed them in the negative geotaxis device. The device was tapped three times in rapid succession to initiate the response and climbing was recorded for 10 s. The climbed distance in cm was measured for each fly and the average height from five technical replicates per genotype was calculated using the Scion Image software.

Forty heads from 5 to 18-day-old flies were homogenized in 60 μl of RIPA buffer, pH 7.4, containing 1% SDS, 5 mM EDTA, 5 mM EGTA, 1 mM PMSF, 0.5 μg/ml leupeptin, 0.5 μg/ml aprotinin, 1 mg/ml pepstatin and 50 mM NaF. Homogenates were centrifuged at 10,000× g for 1 h at 4°C. Twenty μl of the supernatant containing ~150 μg of total proteins, were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in a 12.5% Tris-tricine gel. After transfer to polyvinylidene fluoride membranes, proteins were analyzed by Western blot. Aβ42 was detected with anti-Aβ monoclonal 6E10 (Biolegend Co.) used at 1:1000. Actin was detected with rabbit polyclonal anti-actin (Sigma) at 1:1000. After washing with PBS-T, membranes were incubated anti-rabbit or anti-mouse horseradish peroxidase-labeled IgGs (Dako, Denmark) at 1:10000. Immunoreactivity was visualized by chemiluminescence with ECL Prime (GE Bioscience, Piscataway, NJ, USA) and scanned with an Image Quant LAS 4000 apparatus (GE Bioscience, Piscataway, NJ, USA). For relative quantitation, optical densities from each lane were obtained and analyzed with the ImageJ software. Synthetic Aβ1-42 was obtained from American Peptide Co.

Adult heads were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS) for 45 min at room temperature (RT). Fly brains were dissected in PBS containing 0.1% Triton X-100 (PT). Brains were blocked in 10% normal goat serum for 1 h in PT and incubated with antibody 6E10 at 4°C overnight. After incubation with Cy3-labeled anti-mouse antibody (Jackson InmunoResearch, West Grove, PA, USA) for 2 h at RT, brain tissue was stained with DAPI, washed with PBS and mounted in PBS containing 80% glycerol. For amyloid fibril staining, brains were incubated in 50% ethanol containing 1% thioflavine S (ThS; Sigma, St.Louis, MO, USA) overnight at 4°C. Samples were washed with PBS containing 50% ethanol and mounted in 80% glycerol. Brain samples from a transgenic mouse carrying the “Swedish” mutation of amyloid precursor protein (Tg2576) were used as positive controls. Images were captured with a Zeiss LSM 510 Meta Confocal microscope.

Fly heads were fixed overnight in Carnoy solution (60% ethanol, 30% chloroform, 10% acetic acid) at 4°C and dehydrated in increasing concentrations of ethanol. Then, they were treated with butanol:ethanol (1:1), butanol:toluene (1:1) and toluene 30 min each, and finally soaked in toluene:paraffin (1:1) for 30 min at 65°C. After a 2-h incubation at 65°C in pure paraffin, heads were embedded and cut in 8 μm serial frontal sections. After H&E staining, images were captured using an OLYMPUS B × 50 Microscope and analyzed with the ImageJ software. Brain tissue loss was quantified as described (Sarantseva et al., 2009). The area occupied by vacuoles with a diameter of at least 3 μm was divided by the total area of the section and expressed as percentage of area loss. At least eight brains per genotype were analyzed.

To perform the genetic screen, the G4 > Aβ42 line was mated with Df lines from the Bloomington Df kit (Cook et al., 2012; Cook, 2016) to generate elav^c155 [Gal4]; [UAS] Aβ42/+> Df/+ (G4 > Aβ42/Df). The experimental design consisted of three stages (Figure 1). In stage I, G4 > Aβ42/Df lines were analyzed at 5 and 18 days post-eclosion (d.p.e) to find a modified phenotype as compared to G4 > Aβ42. Genetic controls included G4>+ and +>Aβ42. Those Df lines that showed a difference of at least 50% in negative geotaxis only at 18 d.p.e in a single biological experiment were selected. In stage II, each chromosomal deletion; elav^c155 [Gal4]; Df/+ (G4 > Df) was assessed to rule out that it did not affect negative geotaxis in the absence of Aβ42 expression. Three independent biological experiments were performed comparing G4 > Aβ42 with G4 > Aβ42/Df to select the Df lines that reached statistical significance. Deleted genes were queried for the identification of human orthologs with expression in the adult CNS (see below). If the deletion was large and included more than 10 human orthologs, overlapping deletions were analyzed as in stage II to reduce the number of candidates. Deletions with less than 10 human orthologs were selected for analysis with RNAi or mutant lines in stage III.

Genomic deletions were queried in Bloomington Stock web page¹. The corresponding gene list was obtained from FlyBase² (Attrill et al., 2016) using the GBrowse function and the Hit List tool. Each gene was searched for its human ortholog with the highest weighted score using the Drosophila RNAi Screen Center (DRSC) Integrative Ortholog Prediction Tool (DIOPT) from the DRSC³. Fly gene expression was searched in NCBI web page⁴ and the RNA-seq Profile provided by FlyBase on the gene query subtitle expression data⁵. Gene products, their known functions, patterns of expression in humans, protein-protein interactions and association with human diseases were obtained from UNIPROT⁶, Genecards⁷ and OMIM⁸ databases.

RNA from 35 fly heads was extracted with the TriZol reagent (Invitrogen) according to manufacturer’s instructions. cDNA was generated from 3 μg of RNA, previously treated with DNAse (Promega) using the SuperScript III system (Invitrogen). SYBR-Green quantitative real-time PCR (qRT-PCR) was performed using KAPA SYBR_FAST Universal 2X qPCR Master Mix. Reactions were run in a Stratagene Mx3005P cycler (Agilent Technologies) and analyzed by the calibration curve method. For CG11796 primers 5′AAAGGAACCAAACCTGAA GC 3′ (forward) and 5′ATCCCTGATAGCCAAGTGGT 3′ (reverse) were used. RPL32 was amplified for normalization using the following primers: 5′ATGCTAAGCTGTCGCACA AATG 3′ (forward) and 5′GTTCGATCCGTAACCGATGT 3′ (reverse).

Results are presented as the mean ± SEM of at least three independent biological experiments unless otherwise stated. Data were analyzed by repeated measures (RM) two-way ANOVA with post hoc Bonferroni’s test, RM one-way ANOVA followed by Least Significant Difference (LSD) Fisher’s test or Student’s t test using the Prism^® Graphpad 6 software. Wilcoxon non-parametric test were used when indicated. The level of significance was set at p < 0.05.

A transgenic line with constitutive, pan-neuronal expression of Aβ42 maintained at 25°C was examined as a candidate for the screen. Western blots of fly head homogenates showed a ~4.5 kDa band consistent with detergent-soluble Aβ42 correctly targeted and cleaved in the secretory pathway. A minor band consistent with SDS-resistant Aβ42 oligomers was also seen. Between 5 and 18 d.p.e there was a robust 3-fold increase of Aβ42 levels (Figures 2A,B). Negative geotaxis was not impaired in 5-day-old flies as compared with controls, strongly suggesting that there were no developmental effects upon the CNS due to Aβ42 expression. In 18-day-old flies, a significant decrease in climbing ability (~50%) was apparent only in Aβ42-expressing animals as compared to genetic controls, G4>+ and +>Aβ42 (Figure 2C). Microscopic examination of the brains of affected flies revealed very mild vacuolization and negative ThS staining (see below). Therefore, this line showed age-dependent Aβ42 accumulation and CNS neurotoxicity, and the magnitude of the functional decline was optimal for the search of enhancers and suppressors. In addition, the accretion of non-fibrillar Aβ42 suggests that toxicity was induced by soluble oligomers, as proposed for AD. Taken together, these features and experimental conditions made this Aβ42 transgenic line highly suitable for a forward genetic screen.

One hundred and ninety-nine lines with defined deletions from the 2nd, 3rd and 4th chromosomes, accounting for approximately 6300 genes, were tested in the first stage of the screen. Negative geotaxis of G4 > Aβ42 line was compared to G4 > Aβ42/Df lines at 5 and 18 d.p.e. Figure 3 shows actual examples of the three possible outcomes: Df 29667 had no modifying effect, Df 27917 worsened and Df 7681 rescued Aβ42-induced climbing dysfunction. At this stage, 73 G4 > Aβ42/Df lines showed a difference in climbing ability of at least 50% when compared to G4 > Aβ42 and such differences were only seen in aged animals. These lines were selected and analyzed in stage II and six lines met statistical criteria to be considered as positive hits. Df lines 24392, 27369, 27372, 27404 and 27917 worsened negative geotaxis while line 7681 reduced Aβ42 toxicity to a full rescue of the phenotype (Figure 4). In the absence of Aβ42 expression, Df lines showed no intrinsic effect and none of the enhancer Df lines induced climbing impairment in G4 > Aβ42 line at 5 d.p.e, ruling out a possible acceleration of Aβ42 toxicity (not shown). Within these six Df lines, 36 Drosophila genes with human orthologs remain to be tested to identify enhancers and 14 genes to pin point suppressors of Aβ42 neurotoxicity. Interestingly, 14 out of 15 enhancer and six out of seven suppressor Df lines described in a previous screen based on negative geotaxis (Liu et al., 2015) were selected in stage I of our screen but did not reach statistical significance in stage II and were not further analyzed.

Thus far, three out of the five enhancer Df lines that passed stage II have been partially analyzed in stage III. The enhancer Df line 27372 included the deletion of CG17249 whose human ortholog is PRCC. We used a line carrying a Piggy Bac transposon in the 3′ region of CG17249 to assess toxicity. A significant enhancement in Aβ42 neurotoxicity was observed in mutant hemizygous flies (Figure 5A). Although unlikely, the 3′ insertion may compromise the expression of neighboring genes and therefore, RNAi experiments are required to validate CG17249. Df lines 27917 and 27369 also worsened negative geotaxis in the presence of Aβ42 and the overlapping chromosomal segment included CG11796 whose human ortholog is HPD encoding HPPD, a key enzyme involved in tyrosine catabolism. To determine if a reduced expression of CG11796 was capable of enhancing Aβ42 toxicity, we used two independent approaches: a mutant line in which a Mi[Mic] transposon was inserted in the CG11796 gene and a specific RNAi with pan-neuronal expression using the elav promoter. These lines had no impairment in negative geotaxis as compared with control flies despite the reduction of CG11796 mRNA. Yet, in the presence of pan-neuronal Aβ42 expression, CG11796 downregulation in both the RNAi and mutant lines induced a significant enhancement of Aβ42 toxicity, similar to the overall effect of the chromosomal deletions detected at stages I-II of the screen (Figures 5B,C). The specificity of the RNAi was assessed by qRT-PCR from fly heads, which showed a strong reduction of CG11796 mRNA of approximately 85% in G4 > CG11796^RNAi and 55% in CG11796^Mut, similar to the expected ~50% mRNA reduction in Df line 27917 (Figure 5D).

Aβ42 levels were analyzed in the brains of flies with partial Df of CG11796 at 18 days of age, when the toxic phenotype was detected. Confocal immunofluorescence showed extensive intraneuronal perinuclear Aβ accumulation which was ~2-fold higher in both CG11796 hemizygous mutant and CG11796^RNAi as compared with flies expressing Aβ42 alone (Figure 6). Western blots of head homogenates showed a 70%–80% increase in the Aβ monomer band in CG11796 mutant and RNAi lines, consistent with the immunofluorescence results (Figure 7). The increment of Aβ abundance was not accompanied by ThS staining, indicating that a partial Df of CG11796 expression promoted the accumulation of non-fibrillar Aβ species (Figure 8). Instead, the pattern of immunostaining and detergent solubility suggest the accretion of intraneuronal oligomeric Aβ which concurs with a higher neurotoxicity in CG11796^Mut and CG11796^RNAi flies. To assess neurodegeneration further, the extent of vacuolization in the brain was determined for each genotype. As mentioned above, there was a mild though significant increase of vacuolization in flies expressing Aβ42 as compared with their genetic controls. Yet, tissue loss did not increase in Aβ42-transgenic flies expressing CG11796 mutant or RNAi (Figure 9). Together, these results strongly suggest that a partial Df of the HPD ortholog promotes the accumulation of toxic Aβ42 oligomers in the CNS leading to cellular dysfunction without histologically detectable neuronal loss.